ID: 904483862

View in Genome Browser
Species Human (GRCh38)
Location 1:30811223-30811245
Sequence CTGTCTATGCAAATAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904483862_904483865 23 Left 904483862 1:30811223-30811245 CCAAGCTTTATTTGCATAGACAG No data
Right 904483865 1:30811269-30811291 AAAGGGACAGTGTCTGCCTAAGG No data
904483862_904483863 5 Left 904483862 1:30811223-30811245 CCAAGCTTTATTTGCATAGACAG No data
Right 904483863 1:30811251-30811273 ACAGTTGAGCTTAGAAGAAAAGG No data
904483862_904483864 6 Left 904483862 1:30811223-30811245 CCAAGCTTTATTTGCATAGACAG No data
Right 904483864 1:30811252-30811274 CAGTTGAGCTTAGAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904483862 Original CRISPR CTGTCTATGCAAATAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr