ID: 904486057

View in Genome Browser
Species Human (GRCh38)
Location 1:30825087-30825109
Sequence GGATTAAAATAGAGGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904486053_904486057 7 Left 904486053 1:30825057-30825079 CCAGGAGAAAATGGCAAGGCAGT No data
Right 904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904486057 Original CRISPR GGATTAAAATAGAGGGAGCA CGG Intergenic
No off target data available for this crispr