ID: 904486083

View in Genome Browser
Species Human (GRCh38)
Location 1:30825201-30825223
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904486077_904486083 -10 Left 904486077 1:30825188-30825210 CCAGGACCTGAAAGAGCCAGATG No data
Right 904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG No data
904486073_904486083 28 Left 904486073 1:30825150-30825172 CCGAATCAGGAGGACTGCTGGGA No data
Right 904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr