ID: 904490249

View in Genome Browser
Species Human (GRCh38)
Location 1:30854210-30854232
Sequence CTACCATTGGCGGAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904490249_904490260 -7 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490260 1:30854226-30854248 ATGGTAGGGGAAAAGGGACGGGG No data
904490249_904490261 -3 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490261 1:30854230-30854252 TAGGGGAAAAGGGACGGGGCAGG No data
904490249_904490259 -8 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490259 1:30854225-30854247 AATGGTAGGGGAAAAGGGACGGG No data
904490249_904490262 14 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490262 1:30854247-30854269 GGCAGGCACACCACTATCAAAGG No data
904490249_904490263 15 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490263 1:30854248-30854270 GCAGGCACACCACTATCAAAGGG No data
904490249_904490258 -9 Left 904490249 1:30854210-30854232 CCTGCACCTTCCGCCAATGGTAG No data
Right 904490258 1:30854224-30854246 CAATGGTAGGGGAAAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904490249 Original CRISPR CTACCATTGGCGGAAGGTGC AGG (reversed) Intergenic
No off target data available for this crispr