ID: 904494584

View in Genome Browser
Species Human (GRCh38)
Location 1:30879480-30879502
Sequence CTTTCTGGGCAGAGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 1, 2: 7, 3: 72, 4: 589}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904494584_904494591 -6 Left 904494584 1:30879480-30879502 CCAGCTCCCCTCTGCCCAGAAAG 0: 1
1: 1
2: 7
3: 72
4: 589
Right 904494591 1:30879497-30879519 AGAAAGAAAAATACCCACGGTGG 0: 1
1: 0
2: 2
3: 29
4: 347
904494584_904494589 -9 Left 904494584 1:30879480-30879502 CCAGCTCCCCTCTGCCCAGAAAG 0: 1
1: 1
2: 7
3: 72
4: 589
Right 904494589 1:30879494-30879516 CCCAGAAAGAAAAATACCCACGG 0: 1
1: 0
2: 2
3: 33
4: 396
904494584_904494595 15 Left 904494584 1:30879480-30879502 CCAGCTCCCCTCTGCCCAGAAAG 0: 1
1: 1
2: 7
3: 72
4: 589
Right 904494595 1:30879518-30879540 GGAGGAGCTAGAACTCCCCATGG 0: 1
1: 0
2: 1
3: 16
4: 190
904494584_904494592 -3 Left 904494584 1:30879480-30879502 CCAGCTCCCCTCTGCCCAGAAAG 0: 1
1: 1
2: 7
3: 72
4: 589
Right 904494592 1:30879500-30879522 AAGAAAAATACCCACGGTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904494584 Original CRISPR CTTTCTGGGCAGAGGGGAGC TGG (reversed) Intronic
900365568 1:2310716-2310738 CTTGCGGGGGAGAGGGGAGGTGG + Intergenic
900436627 1:2634116-2634138 CTTTCTGGGGAGCTGGGAGTGGG + Intergenic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
900741830 1:4334907-4334929 CTTTCTGTCTACAGGGGAGCAGG + Intergenic
900815662 1:4841927-4841949 CTTTATAGGCAAAGGGGAGATGG + Intergenic
900960271 1:5914764-5914786 CTTCCTAGGCTGAAGGGAGCAGG + Intronic
901236815 1:7671641-7671663 TTTTCTGGGCACAGGGTAGATGG - Intronic
901274474 1:7980493-7980515 CTTGCTGGGCACTGGGGACCAGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902343438 1:15799333-15799355 GTTGCTGGTCAGAGGGGTGCTGG - Intergenic
902398864 1:16146612-16146634 CTCGCTCAGCAGAGGGGAGCTGG + Intronic
902512545 1:16974325-16974347 CGTTCTGGGCAGGGCAGAGCTGG + Intergenic
902646764 1:17804981-17805003 GTTTCTGAGCAGAGAGGAGGTGG - Intronic
903475807 1:23618557-23618579 CTCTCTGGGCAAGGGGGATCAGG - Intronic
903814415 1:26054231-26054253 CTCTCTGGTCACAGGCGAGCAGG - Intronic
903847776 1:26288697-26288719 CTTTCTGTGCAATGGGGAGATGG + Intronic
904120984 1:28197663-28197685 CTTTGTGGGCAGAGGTGAGGTGG - Intergenic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904688489 1:32276509-32276531 CTGCCTGGGAAGAGGGGAACGGG + Intronic
905025200 1:34845015-34845037 CTGGCTGGGCAGAAGGCAGCAGG + Intronic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
906286392 1:44590570-44590592 CATTCTGGGGAGCGGGGAACCGG - Intronic
907020283 1:51060182-51060204 CTCTCTGGGGAGAGGAGACCTGG - Intergenic
908127139 1:61043295-61043317 CTGTCTGGGGCCAGGGGAGCCGG - Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908413951 1:63894199-63894221 CATTCTGGGCAGGATGGAGCAGG + Intronic
908590919 1:65632282-65632304 ATTTCTGGGCATAGGGGAGATGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
912588142 1:110785809-110785831 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
912805657 1:112755053-112755075 CTTTCTAGGGAGAGCAGAGCAGG + Intergenic
912857905 1:113188118-113188140 GTTTCTGGGTAGTGGGGAACAGG - Intergenic
913062518 1:115221128-115221150 ATTTGTGGGCAGAGGGGTGGGGG + Intergenic
913103863 1:115594531-115594553 CTTTCTGGGCAGGGGAGACTCGG + Intergenic
914337022 1:146724715-146724737 CTTTCTGGTGAGCTGGGAGCAGG + Intergenic
914428126 1:147597983-147598005 CTTGCTGAGCAGAGGTGATCTGG + Intronic
915282331 1:154830956-154830978 AGGTCTGGGCAGAGGGGAACTGG + Intronic
915797410 1:158751889-158751911 ATTCCTGGGCAGAAGGGGGCAGG - Intergenic
915976907 1:160397417-160397439 CTTTCTGGGAAGGTGGGTGCTGG + Intergenic
916055768 1:161068287-161068309 CTCACTGGGCAGAGTGGAGGTGG - Intronic
917207178 1:172588883-172588905 CCTTCTGGGCAGCGGTGAACAGG + Exonic
917973186 1:180221643-180221665 CTTTCTGGGCAGCGGAGTACTGG + Intergenic
918036897 1:180882501-180882523 TTAGCTGGGCAGAGGGGTGCAGG - Intronic
918132735 1:181643789-181643811 CATTCTTGGCAGCGGGGAGATGG + Intronic
919606826 1:199693647-199693669 CTTTCTGGGAAGTGGGGGACAGG - Intergenic
919608986 1:199721765-199721787 CATTCTGGGAAGCGTGGAGCAGG - Intergenic
919705322 1:200669966-200669988 CTTTCCGGGCGGCGGGGAGGCGG + Exonic
920508951 1:206536595-206536617 CTATCTTGGCAGAGGGGTGATGG - Intronic
920764009 1:208813585-208813607 CTCTCTGTGCAGTGGGCAGCAGG - Intergenic
920792395 1:209105752-209105774 GTTTCTGGGCAGGGTGGAGGAGG + Intergenic
922449274 1:225723701-225723723 CTTTCTGTGCAGCGAGAAGCAGG + Intergenic
922567833 1:226612433-226612455 CCATCTGGAAAGAGGGGAGCAGG + Intergenic
922913828 1:229239547-229239569 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
923149349 1:231219593-231219615 CTTTCTAGGAAGTGGGGAGCGGG - Intronic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
924744435 1:246818753-246818775 CGTTCTGGGCAGGGCAGAGCTGG - Intergenic
924770423 1:247075037-247075059 CTTTCATGGCTGAGGTGAGCAGG + Intronic
1062785703 10:263041-263063 CTTTGTGGGCAGAAAGCAGCAGG - Intergenic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1062956865 10:1546288-1546310 CTTTCCGTGCAGAGAGCAGCAGG + Intronic
1063759163 10:9052732-9052754 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1064250568 10:13703461-13703483 CTTTCTGGGCCGATGGGCTCAGG - Intronic
1064561339 10:16597898-16597920 CTGTGTGGGCAGATGAGAGCTGG + Intronic
1065381661 10:25096861-25096883 CTTTCTGTGCACTGGGGAGAGGG - Intergenic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1065639412 10:27766697-27766719 GTGTTTGGGCAGAAGGGAGCTGG - Intergenic
1065835782 10:29656829-29656851 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1067266288 10:44748267-44748289 CTTTCAGCAAAGAGGGGAGCTGG + Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068290496 10:54996032-54996054 CTTTCTGTGCAGTGGGGAGCAGG + Intronic
1068647607 10:59485419-59485441 GTCTGTCGGCAGAGGGGAGCAGG - Intergenic
1068700641 10:60016003-60016025 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1068933161 10:62612078-62612100 TTTTCTGGAGAGAGGGGAGTAGG + Intronic
1069598189 10:69686407-69686429 CTTTCTGGCCAGAGCTGAGCAGG + Intronic
1069680770 10:70283813-70283835 CGGTCCGGGCAGAGGTGAGCAGG + Intergenic
1070204473 10:74242903-74242925 CTCTCAGTGGAGAGGGGAGCTGG - Intronic
1070327403 10:75397450-75397472 CGTTTTGTGCAGAGTGGAGCAGG - Intergenic
1070788195 10:79174441-79174463 TTTGATGGGCAGTGGGGAGCCGG + Intronic
1071056221 10:81510840-81510862 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1071073525 10:81724781-81724803 CTTTCTGTGCAGAGAGCTGCAGG + Intergenic
1073085082 10:100883172-100883194 CTCACTGGGCAGTGGGGAGATGG + Intergenic
1073145999 10:101282401-101282423 GTCTCTGGGCAGAGGGGAATTGG - Intergenic
1073257045 10:102159325-102159347 CTGTCAGGGCAGAGGTGACCAGG + Exonic
1073311937 10:102549130-102549152 CCTTGTGGGCAGAGTGGAGGTGG + Intronic
1073574628 10:104612223-104612245 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
1074563777 10:114558106-114558128 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1075307892 10:121384078-121384100 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1075907398 10:126093572-126093594 CTCACTGGGCAGAGTGGAGATGG - Intronic
1076287907 10:129319070-129319092 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1076322662 10:129594962-129594984 TTGACTGGGGAGAGGGGAGCCGG + Intronic
1076783688 10:132738586-132738608 CTTTCTGGGAAGAAGGCGGCGGG - Intronic
1077218431 11:1404755-1404777 CTTAGTGGGCAGTGGGTAGCGGG - Intronic
1077232471 11:1464094-1464116 CTTCCTGAGCAGTGGGGAGCTGG - Intergenic
1077269602 11:1669328-1669350 CTTTCTGTGCAGAGAGCAGGGGG + Intergenic
1077297320 11:1832294-1832316 CTTCGTGGGGAGAGAGGAGCCGG + Intronic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1078144433 11:8713256-8713278 CTCTCTGGGGACAGGGGAGATGG + Intronic
1078334196 11:10450955-10450977 CGCGCTGGGCAGAGCGGAGCGGG - Exonic
1079086162 11:17446664-17446686 CTGTCTTGGCAGAATGGAGCGGG + Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1079990268 11:27239337-27239359 CCTTCTGGGGAGAGGGTAACGGG - Intergenic
1080432922 11:32215249-32215271 CTGACTGTGCAGAGGGGAACGGG - Intergenic
1080604406 11:33852881-33852903 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1080667246 11:34346453-34346475 CTTTCTGGGGAAAGGGGCACAGG + Intronic
1080811885 11:35712651-35712673 CTGTCAGTGCAGAGAGGAGCTGG - Intronic
1081025285 11:38005071-38005093 CTTTGTGGGGTGGGGGGAGCGGG + Intergenic
1081191188 11:40104600-40104622 CCATCTGGAAAGAGGGGAGCAGG - Intergenic
1081233508 11:40616755-40616777 TGTTGTGGGGAGAGGGGAGCGGG + Intronic
1081726918 11:45336557-45336579 TTTCCTGGGCAGAGAGGCGCAGG + Intergenic
1081872972 11:46391632-46391654 CTGTCTGGCGCGAGGGGAGCTGG - Intergenic
1082663826 11:55949350-55949372 CTCTCAGGGGAGAGGGGAGCTGG - Intergenic
1083147680 11:60771268-60771290 CTGTATGGGGAGAGGGGACCAGG - Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083399688 11:62415015-62415037 GTAGCTGGGCAGAGGGGAGAGGG - Intronic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1083956079 11:65983590-65983612 CTTTCTGGGTAGAGGTGGGAAGG - Intergenic
1084227729 11:67727787-67727809 CTTTCTGGGCTGAGGTGGCCTGG + Intergenic
1084543664 11:69802815-69802837 ATTTCTTGTCTGAGGGGAGCAGG + Intergenic
1084547848 11:69823259-69823281 CTCTCTGGGTAGAGGAGAGGAGG + Intergenic
1084658161 11:70531415-70531437 CATGCTTGGCAGAGGTGAGCTGG + Intronic
1085100552 11:73796588-73796610 CTTCCTGGGCAGAAGGGGGCAGG + Intronic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085407397 11:76271486-76271508 GTTTCTGGGCAGCTTGGAGCCGG - Intergenic
1085466630 11:76728470-76728492 CTCACTGGGCAGGGGGGAGCTGG + Intergenic
1087010029 11:93504641-93504663 CTTCCTGGGCAGATGATAGCAGG - Intronic
1088568406 11:111197305-111197327 CTTTCTGGGCAGAGCAGGTCCGG + Intergenic
1088687410 11:112296573-112296595 CTTTCTGATTAGAGGGGAGTGGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1089630666 11:119782267-119782289 CCCTCGGGGCAGAGGTGAGCAGG - Intergenic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090976494 11:131684409-131684431 GTTTCCAGGCAGAGTGGAGCAGG - Intronic
1092045487 12:5429743-5429765 CTTTGTGGAGAGAGGGGAGGAGG - Intergenic
1092765535 12:11849752-11849774 CTTTCTGGGAGAAGGGGAGGTGG + Intronic
1092963666 12:13620496-13620518 GGTTCTGGGCAGTGGTGAGCTGG - Intronic
1093592329 12:20917655-20917677 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1093731230 12:22568032-22568054 CTCTCAGCGGAGAGGGGAGCTGG + Intergenic
1093731379 12:22569138-22569160 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1094757865 12:33492874-33492896 CTTTGTGGGGAGAGGGGTGTCGG + Intergenic
1096160266 12:49370785-49370807 CTTTCTGGGCAGGTGGGAGGAGG - Intronic
1096470138 12:51870370-51870392 GTGTCTGGGCAGTGGGGAGAAGG - Intergenic
1097051600 12:56226460-56226482 CTTTCTAGGCTGAGGAGAGTGGG - Intronic
1097747848 12:63318825-63318847 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1097895842 12:64824505-64824527 GCTTCTGGGCACGGGGGAGCTGG + Intronic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1098140094 12:67442470-67442492 CATTTTGGGGAGAGGGCAGCGGG + Intergenic
1098694411 12:73534637-73534659 CTTTCTAGCCAGAAGAGAGCTGG - Intergenic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1099609441 12:84848929-84848951 CTGTCTGAGCAGAAGGGACCTGG - Intergenic
1100672869 12:96835500-96835522 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1101054535 12:100898742-100898764 CTTATTGGGCTGAGGGGAACAGG - Intronic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1101709073 12:107248151-107248173 GATTCTGGGCAGAGGTTAGCTGG - Intergenic
1102206532 12:111094666-111094688 TTTTCTGGGCTGGGGGGAGATGG + Intronic
1102469138 12:113149742-113149764 CCTTCTGGGCCGAGCTGAGCAGG + Intergenic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102880187 12:116479014-116479036 CTTTCTGGGCAGAGGGGTTATGG + Intergenic
1103020931 12:117533761-117533783 CTTTTTGGGCAACGGAGAGCAGG + Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103322845 12:120101877-120101899 CTTTCTGGGCTGGGCAGAGCGGG - Intronic
1103980897 12:124736362-124736384 ATGGCAGGGCAGAGGGGAGCTGG - Intergenic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1104358564 12:128111068-128111090 CTCTCTGGGCACAAGGGAGAGGG - Intergenic
1104798231 12:131534653-131534675 GTTTCTGGGAAGAGCAGAGCTGG + Intergenic
1104834204 12:131776847-131776869 CTTTCTGGGTAAAGAGGGGCAGG + Intronic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106301351 13:28469069-28469091 CTGCCTGGGAAGAGGGGAGGAGG - Intronic
1106305560 13:28506021-28506043 CTTCCTGGGCACAGGGCACCTGG - Intergenic
1107379022 13:39835785-39835807 ATTTCTGGGAGAAGGGGAGCAGG - Intergenic
1108647993 13:52449958-52449980 ATATCTGGGCAGAGGGGTGAGGG - Intronic
1108849390 13:54708371-54708393 ATTCCTGGGCAGAGAGGGGCAGG - Intergenic
1109004355 13:56852439-56852461 CTTTCTGGGGAGGGCAGAGCAGG + Intergenic
1109522129 13:63527452-63527474 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1110537376 13:76667145-76667167 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111487798 13:88926884-88926906 GTTCCTGGGCAGAAGGGAGTGGG - Intergenic
1111558628 13:89913819-89913841 CTTTCTGTGCTGAGAGCAGCGGG + Intergenic
1112430504 13:99346568-99346590 CATTCTGGGCAGAGAGGAAAGGG - Intronic
1112549291 13:100404547-100404569 CTATCTAGAAAGAGGGGAGCAGG + Intronic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1114908641 14:27164012-27164034 CTTTCAGGGAAGAGAGGAGCTGG - Intergenic
1116081997 14:40186283-40186305 ATAGCAGGGCAGAGGGGAGCAGG - Intergenic
1116716351 14:48431377-48431399 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1118349817 14:64965742-64965764 CTGTCTGGGGAGCGGGGAGAAGG + Intronic
1118738807 14:68723151-68723173 CGTTCTGGGCTGTGGGGAGTGGG - Intronic
1119197400 14:72727204-72727226 CTTTCTGGGCAGAGGAGCAGTGG - Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119539781 14:75430262-75430284 CTTTCTTTCCAGAGTGGAGCTGG - Intronic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121780342 14:96618058-96618080 CTACCTGGGAAGAGGAGAGCAGG + Intergenic
1121867057 14:97372437-97372459 CCAACTGGGCAGAGGAGAGCAGG - Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1124069278 15:26376490-26376512 CTTTCTGTGCAGTGAGCAGCTGG - Intergenic
1124115282 15:26836762-26836784 CTTTCTGTGCGGTGGGCAGCAGG - Intronic
1124490401 15:30151647-30151669 CTTGCTGGGCAGAGCTCAGCTGG + Intergenic
1124753131 15:32386682-32386704 CTTGCTGGGCAGAGCTCAGCTGG - Intergenic
1124974870 15:34522382-34522404 CTTGCTGGGCAGAGCTCAGCTGG - Intergenic
1125470513 15:39997905-39997927 CTTACTGAGCAGAGTGAAGCAGG + Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1126773283 15:52078372-52078394 TTTTCTGGTCTGAGGGAAGCTGG - Intergenic
1127017776 15:54708237-54708259 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1127490446 15:59457253-59457275 CGTTCTGGGCAGGAGGGAGCAGG - Intronic
1127629441 15:60813229-60813251 CTTCCTGGGCAGAGAGGATATGG - Intronic
1127839224 15:62816188-62816210 CTCTCGGGGCAGCGGGGAGATGG - Intronic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1128862203 15:71083332-71083354 CTTTCTGGGGGCAGGGGAGGGGG + Intergenic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1129230197 15:74192810-74192832 CTTTCTGGTGAGAGAGGAGGAGG - Intronic
1129272846 15:74428578-74428600 CTTTCTGGGCAGAAAGGAGGAGG + Intronic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1130956445 15:88630371-88630393 CTTCCTGGGCAGGGTGGGGCAGG + Exonic
1132055965 15:98650136-98650158 CTGACCGGGCAGTGGGGAGCGGG + Intronic
1132332527 15:101022654-101022676 CTCTCTGGGGAGAAGGGAGAAGG - Intronic
1132338871 15:101065663-101065685 CTCTGAGGGCAGAGGGGAGGAGG + Exonic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1133047368 16:3096208-3096230 TTTTCTGAGCAGAGCAGAGCAGG + Intronic
1133254673 16:4509434-4509456 CTCTCTGGCCAGTGTGGAGCCGG - Exonic
1134453955 16:14380163-14380185 TTTTCTGGGCAGAGGAGAAAGGG - Intergenic
1134552378 16:15144105-15144127 CTTGCTGGGCGGAGGGGAACCGG - Intergenic
1134597394 16:15506871-15506893 CTTTCTGTGCAGCGAGTAGCAGG + Intronic
1135421761 16:22309592-22309614 CTTTCAGGGCAGGTGGGAGATGG - Intronic
1135921333 16:26651380-26651402 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135927123 16:26705287-26705309 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135994181 16:27235949-27235971 CTCTCTGGGCACAGGGGAAGAGG + Intronic
1136772972 16:32857618-32857640 GTTTCTGTGGAGTGGGGAGCTGG + Intergenic
1136897642 16:34003901-34003923 GTTTCTGTGGAGTGGGGAGCTGG - Intergenic
1137334345 16:47533397-47533419 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1137623127 16:49889839-49889861 CTTCCAGGGCATAGAGGAGCTGG + Intergenic
1137804106 16:51287490-51287512 CTCTCTGGGCTGATGGGAGAGGG - Intergenic
1137982634 16:53082846-53082868 CTGACAGGGCAGAGAGGAGCTGG - Intronic
1138102886 16:54268657-54268679 CGGACTGGGCAGAGGAGAGCTGG + Intronic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1139508212 16:67410181-67410203 CTTTCTAGCCAGTGGGGAGGAGG + Intronic
1139511833 16:67432137-67432159 CTTCCTGGGCACAGAGGACCAGG - Intronic
1139696817 16:68680949-68680971 CTTTCTGGGGAGAAAGGAGAGGG - Exonic
1140067297 16:71622353-71622375 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
1140376079 16:74446438-74446460 CTTATGGGGCAGAGTGGAGCTGG + Intergenic
1140712541 16:77691722-77691744 ATCTCAGGGCAGAGGGGAGGAGG + Intergenic
1140936426 16:79674818-79674840 CTTTCTGGGTAGGAGGGACCCGG - Intergenic
1140960530 16:79907506-79907528 CTTTCTGGGTAGAAGGCAGCAGG + Intergenic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1142131238 16:88432480-88432502 CTTCCTGGGCACAGGGGAGAAGG - Exonic
1142265847 16:89063668-89063690 CTTACGGTGCAGAGGGGAGATGG - Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1203075397 16_KI270728v1_random:1119728-1119750 GTTTCTGTGGAGTGGGGAGCTGG + Intergenic
1142787882 17:2238510-2238532 CTTTCTGGTCAGAGGTGGGGAGG + Intronic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1142921092 17:3187229-3187251 CTTTGTGGGGTGGGGGGAGCGGG - Intergenic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143706773 17:8703535-8703557 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144993124 17:19247689-19247711 TTTTCTGGGTAGTAGGGAGCAGG + Intronic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1145208219 17:20995745-20995767 CTTTATGGGCAGACTGGACCAGG + Intergenic
1145826679 17:27882394-27882416 TTTCCTGGACAGAGAGGAGCTGG + Intronic
1145993221 17:29091509-29091531 GTTACTGGGCTGTGGGGAGCTGG + Intronic
1146255421 17:31389487-31389509 CTAACTGGGGACAGGGGAGCTGG - Intergenic
1146745489 17:35324929-35324951 CTTTCTGTGCAGGGAGCAGCAGG + Intergenic
1147261003 17:39209856-39209878 ATTTATAGGCGGAGGGGAGCGGG - Intergenic
1148472250 17:47902142-47902164 CTATCTGGGGTGAGGGGAGGAGG + Intronic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1148883691 17:50755293-50755315 CTTTGTGGGGAGATGGGAGGTGG + Exonic
1149557675 17:57585743-57585765 CTTTCTGAGCTCAGGGGAGATGG - Intronic
1149567172 17:57648634-57648656 CACTCTGGGCAGTGGGGTGCTGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150186486 17:63187135-63187157 TTCAGTGGGCAGAGGGGAGCTGG + Intronic
1150315908 17:64168614-64168636 ATTTCCGAGGAGAGGGGAGCAGG - Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151521464 17:74633388-74633410 CTGTCTGGGGAGCAGGGAGCTGG - Intergenic
1152188602 17:78874429-78874451 TTTTCTGGGCTGAGGGCAGAGGG + Intronic
1152220785 17:79064292-79064314 CCTGCTGGGCACAGGGGAACAGG - Intergenic
1153503152 18:5769154-5769176 CTTACTGGGAAGAGAGGAGAGGG + Intergenic
1153648677 18:7219773-7219795 CTTGCAGGCCAGAAGGGAGCAGG - Intergenic
1153820643 18:8828664-8828686 CTCTCTGGGCAGATGGCAGAGGG + Intronic
1154292097 18:13117217-13117239 ATTTCTGGGCGGATGGGGGCAGG - Intronic
1154499452 18:14987975-14987997 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1158530404 18:58255769-58255791 CGTTCTGGGCGAAGGGGTGCGGG - Intronic
1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG + Intergenic
1159327295 18:66938641-66938663 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160970990 19:1767704-1767726 TTTTCTGGGCAGGTGGGATCAGG - Intronic
1162015470 19:7844525-7844547 CTCTCTGGGCAGGGAGGGGCTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1163128349 19:15256713-15256735 TTTTCTGGGCAGAGAGGAGGTGG - Intronic
1165160057 19:33810846-33810868 CATGCTGGGCACAGGGCAGCCGG - Intronic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165261652 19:34624136-34624158 CTTTCTAGGCAGAGAGGTGTGGG + Intronic
1165386823 19:35514662-35514684 CTTGCTGGGCAGGGGTGAGGCGG - Intergenic
1165680090 19:37766743-37766765 CTGTCTGGTATGAGGGGAGCAGG + Intronic
1165819410 19:38665159-38665181 AGTTCTGGGCAGTGGGGAGTGGG - Intronic
1165905145 19:39189174-39189196 CTGTCAGGGCAGAGAAGAGCAGG - Intergenic
1166142316 19:40811676-40811698 GGTTGTGGGAAGAGGGGAGCAGG - Intronic
1166185206 19:41135121-41135143 GGTTGTGGGAAGAGGGGAGCAGG + Intergenic
1166201086 19:41238400-41238422 CTTCCTGGGAACAGGGGAGGGGG + Intronic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
1168144885 19:54415447-54415469 CTGGCTGGGCTCAGGGGAGCGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925965277 2:9059931-9059953 CTTTCTGGGAAGAGCAGGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926401137 2:12498371-12498393 CTTTTTGGGAAAATGGGAGCTGG + Intergenic
926562713 2:14435123-14435145 CTTTCAGCGGAGAGGGGAGCTGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927046312 2:19282521-19282543 GTTTCTGGCCAGAGGGGAAGGGG - Intergenic
927261228 2:21093150-21093172 CTTTCTTGGCAGAGGACTGCGGG - Intergenic
927289557 2:21392615-21392637 CTTCCTGGGCTAAGGGGAGAGGG - Intergenic
927471231 2:23379173-23379195 CTTTCTGTGCTGAGGGGTCCAGG - Intergenic
927707268 2:25304149-25304171 CTTCCAGCGCAGAGGGGAGGGGG + Intronic
928196833 2:29222294-29222316 CTTTGGGGGCAGAGGGGAGTTGG + Intronic
928421385 2:31139683-31139705 CTTTATGGGGAGAGAGGGGCAGG - Intronic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
930800542 2:55438437-55438459 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
932302530 2:70677216-70677238 ATATCTGGGGAGAGGGGAGAGGG + Intronic
933699751 2:85245961-85245983 CTTTCTGGGCAAAGGAGAGCTGG - Intronic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
934670242 2:96208103-96208125 CTTTCTGGGCCGTGGGGTGGGGG - Intronic
935052727 2:99537065-99537087 CTTGGTGGGCAGGGGGCAGCTGG + Intergenic
935094959 2:99935415-99935437 CTTTTAAGGGAGAGGGGAGCAGG + Intronic
935765640 2:106365038-106365060 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
936451357 2:112636133-112636155 CTTTCAGGGTAGAGGAGAGCAGG + Intergenic
936467693 2:112767807-112767829 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
938180682 2:129179304-129179326 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
938237937 2:129721929-129721951 CTTTCTGGGGTGAGGTGGGCGGG + Intergenic
938369712 2:130761595-130761617 CTTCCTGGGCTGAAGGCAGCTGG - Intronic
938498656 2:131818343-131818365 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
940373140 2:152923818-152923840 CTAACTGGGCAGAATGGAGCTGG + Intergenic
941007582 2:160263369-160263391 CCTCATGGGCAGTGGGGAGCTGG - Intronic
942470904 2:176258621-176258643 CTTTCTGGGCTGAGAAGACCTGG + Intergenic
944861856 2:203822701-203822723 CTTTCTGGGAGCAGGGGAGTTGG - Intergenic
945113628 2:206389367-206389389 CTTTCTGGGAAGAGTAGGGCAGG + Intergenic
945489993 2:210443245-210443267 CTTTTTGGGGGGAGGGGAGTGGG + Intronic
946411686 2:219518359-219518381 CATTCTGGGTGGAGGAGAGCTGG + Intronic
946595634 2:221302957-221302979 CATTCTAGGCAGAGGGGACATGG - Intergenic
946737957 2:222773475-222773497 CTTTTTGGGAGGAGGGGAGAGGG - Intergenic
946811541 2:223530787-223530809 CTTTCAGAGGAGAGGAGAGCTGG - Intergenic
946938117 2:224742862-224742884 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
947483130 2:230521628-230521650 CTTTCTGTGCAGTGAGCAGCTGG + Intronic
947791744 2:232872712-232872734 CTGTCTGGGGAGGGGGGAGATGG - Intronic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
948588347 2:239035143-239035165 CTTTCTGGGCGGTGAGGACCCGG - Intergenic
948884271 2:240875090-240875112 CTTTCTGGGGAGAAAGAAGCAGG - Exonic
948939993 2:241190821-241190843 CTCCAGGGGCAGAGGGGAGCCGG - Intronic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1170231140 20:14048114-14048136 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1170695824 20:18657768-18657790 CTTTCTGGGCAGTTGGCAGGAGG + Intronic
1170960408 20:21020387-21020409 GTTTGCGGGCAGAGGGAAGCCGG - Intergenic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1172646446 20:36473070-36473092 CTTCCGGGGCAGAGCTGAGCTGG + Intronic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1173010848 20:39180603-39180625 CTTCCAGGGGTGAGGGGAGCGGG + Intergenic
1173437884 20:43048890-43048912 GTGGCTGGGCAGAGGCGAGCAGG - Intronic
1173514242 20:43653663-43653685 ATTTTTGGGCTGTGGGGAGCTGG + Intergenic
1173670565 20:44795979-44796001 ATCTGTGGGGAGAGGGGAGCGGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174412216 20:50343591-50343613 CCTGGTGGGCAGATGGGAGCAGG + Intergenic
1175525255 20:59629312-59629334 CTTCCTGGGAAGAAGGGAGGTGG - Intronic
1175900134 20:62356749-62356771 CTTCCTGGGCACAGGGCAGTGGG + Intronic
1176267665 20:64219058-64219080 CTTTCTTGGGAGAGGTGAGTTGG + Intronic
1176717861 21:10368512-10368534 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1177320290 21:19512385-19512407 TTTTCTGAGAAGAGGGGAACAGG - Intergenic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1177639696 21:23830819-23830841 CTTTCTGGTCAGGGAGCAGCAGG + Intergenic
1177989338 21:28019127-28019149 GTTCATGGGCAGAAGGGAGCAGG - Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178790069 21:35691677-35691699 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179725563 21:43339695-43339717 CTTACATGGCAGAGGGTAGCTGG + Intergenic
1180299087 22:11021418-11021440 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181129320 22:20721129-20721151 CTTTCAGCACACAGGGGAGCAGG - Intronic
1181318284 22:21985276-21985298 CTCCCTGGTCAGAGTGGAGCTGG - Intergenic
1181481345 22:23201191-23201213 GTTTCTGGGCACAGCAGAGCTGG + Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181560971 22:23699611-23699633 AGTCCTGGGCAGAAGGGAGCTGG + Intergenic
1181628942 22:24140377-24140399 CTCCCTGAGCAGAGGGGACCAGG + Intronic
1182274517 22:29177924-29177946 TTCTCTGGGCAGAGGGTAGGTGG + Intergenic
1182289909 22:29268831-29268853 ATTTGTGGGCCGAGGGGTGCCGG + Intronic
1182379193 22:29872631-29872653 AGTTCTGGGCAGAAGGGAGAAGG + Intergenic
1182744039 22:32591853-32591875 CGTCCTGGGCAGAATGGAGCTGG - Intronic
1183187210 22:36299039-36299061 TTTCCTGGGGAGAGGGGAGTAGG + Exonic
1183263280 22:36810209-36810231 CTTTATGGTCAGAGGGGCTCTGG + Intronic
1183544612 22:38448890-38448912 CCAGCAGGGCAGAGGGGAGCTGG - Intronic
1183666694 22:39250231-39250253 CGTCCTGGGGTGAGGGGAGCTGG + Intergenic
1184093886 22:42306190-42306212 CTTTCTGCGAGGCGGGGAGCTGG - Intronic
1184179238 22:42808641-42808663 CTTTCAGGCCAGAGGGCATCTGG + Intronic
1184251250 22:43261590-43261612 CTTTCTGTGGAGAGGACAGCTGG - Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184673666 22:46028615-46028637 CTTTCTTGGGAGGTGGGAGCAGG + Intergenic
1184846933 22:47093864-47093886 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1184950787 22:47841276-47841298 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
949419782 3:3853500-3853522 GTTTTTGTGCAGAGGGGAGAGGG + Intronic
950131709 3:10551855-10551877 CTTCCTGGGCTGTGGGAAGCAGG + Intronic
950254472 3:11493161-11493183 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
951056521 3:18152670-18152692 CTTACTGGACAGTGGGGAACAGG + Intronic
952258292 3:31714311-31714333 CTTGCTGGGCAGACAGTAGCTGG + Intronic
952830711 3:37562463-37562485 CTTTCGGGGCAGCGGGGAGGGGG - Intronic
953962008 3:47273625-47273647 TGTTATGGGCAGACGGGAGCTGG - Exonic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
954947679 3:54440632-54440654 TGTTGTGGGCGGAGGGGAGCAGG - Intronic
955732762 3:62004665-62004687 CTTTCTGTGCAGCGAGCAGCCGG + Intronic
956110577 3:65866531-65866553 CTTTCTGTGCTGGTGGGAGCAGG - Intronic
956217230 3:66861000-66861022 CTTTGTGGGCAGAGGAGATGAGG + Intergenic
958973408 3:100638301-100638323 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
960166101 3:114403229-114403251 CTTTCTTCACAGAAGGGAGCTGG + Intronic
960236748 3:115292122-115292144 CTTTCTCCTCAGAGGGGAACAGG + Intergenic
960953358 3:123013816-123013838 GCTTCAGGGAAGAGGGGAGCTGG + Intronic
961393471 3:126570295-126570317 CCTCCTGGGGTGAGGGGAGCTGG + Intergenic
961675587 3:128563666-128563688 GTTTCCAGGCAGTGGGGAGCAGG - Intergenic
961747008 3:129070477-129070499 CTTTCTGTGCAGTGAGCAGCGGG - Intergenic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
962149903 3:132881629-132881651 CTTTCTGGGGTGAGGTGACCTGG + Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
964137640 3:153363235-153363257 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965216296 3:165868574-165868596 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
965542033 3:169880222-169880244 ATTCCTGGGCAGAAGGGGGCAGG + Intergenic
966944064 3:184765253-184765275 CTTTCTGGACACAGAGGAGCTGG - Intergenic
967186240 3:186947015-186947037 CTTTCTGGCCTGGGGGCAGCAGG + Intronic
967444854 3:189554918-189554940 GCTCCTGGGCAGAAGGGAGCAGG - Intergenic
968268018 3:197377574-197377596 CTTTCTAGGGCGAGGAGAGCTGG + Intergenic
968642223 4:1720536-1720558 CTTTCGGGGCCTCGGGGAGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969526774 4:7707852-7707874 CTGGCTGGGGAGAGGTGAGCTGG + Intronic
970720351 4:18981001-18981023 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
971386687 4:26147060-26147082 CTTTCTGAGCCGAGGTGAGGAGG + Intergenic
972652015 4:41027203-41027225 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
972771046 4:42197111-42197133 ATTTCTGTGCAGAGGTGTGCTGG - Intergenic
974618437 4:64322363-64322385 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
975989073 4:80238127-80238149 CTTTCCGGGCAGGATGGAGCAGG + Intergenic
976462893 4:85333452-85333474 ATTTCCAGGCAGAGGTGAGCAGG - Intergenic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
977786601 4:101042342-101042364 TTTTCAGGGCAGAGGGAAGGTGG - Intronic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
979188117 4:117824318-117824340 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
979500756 4:121437099-121437121 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
980627489 4:135391922-135391944 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
982100327 4:151960842-151960864 CTTTCTGAGCAGACAGAAGCAGG - Intergenic
982326068 4:154129193-154129215 CTTTCTGGTCTGAGGGCAGGTGG + Intergenic
983172528 4:164552101-164552123 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
984030928 4:174603167-174603189 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984076943 4:175195071-175195093 CTTTCTGTGCAGCAGGCAGCAGG + Intergenic
984783673 4:183549059-183549081 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984984837 4:185318062-185318084 TTTTGTGGGCAGAAGGGGGCAGG - Intronic
985284793 4:188326031-188326053 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985295248 4:188430987-188431009 CTTTCTGTGCAGCGAGTAGCAGG - Intergenic
985411836 4:189693797-189693819 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
985873453 5:2577407-2577429 CTTTCTGGGCAGTGGTGAAGGGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986503886 5:8429808-8429830 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987256651 5:16161181-16161203 CTTTCTGGGGTGGGGGGAGGGGG - Intronic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
989213183 5:38878102-38878124 CTTTCTGGGCACAGGAGTGAAGG - Intronic
989549926 5:42722568-42722590 CTCACAGGGCAGAGGGCAGCAGG - Intergenic
990172026 5:53062200-53062222 TTTTCTAGGCAGAGGGAAGTGGG - Intronic
990194233 5:53294973-53294995 CTTTCTGGGAATAGGGGAGATGG - Intergenic
990503853 5:56425109-56425131 CTTTCTTGGCAGTGGGGAATTGG - Intergenic
990793087 5:59504826-59504848 TTTTCTGGGGAGAGCAGAGCAGG - Intronic
991210025 5:64093164-64093186 CTTTGTGGGGTGGGGGGAGCGGG + Intergenic
992661319 5:78963821-78963843 CACTTTGGGCAGGGGGGAGCTGG + Intronic
992903957 5:81326704-81326726 CTCTCTGGGCAGAGGAGGCCTGG - Intergenic
993554309 5:89316565-89316587 CTTGTTGGGGAGTGGGGAGCTGG - Intergenic
994119947 5:96102257-96102279 CTTTCAGTGTAGAAGGGAGCAGG + Intergenic
994245425 5:97471248-97471270 GCTTCTGGGCAGAAGAGAGCAGG - Intergenic
994822557 5:104672378-104672400 CTTTTTGGGGAGCGGGGAGATGG + Intergenic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
998637339 5:143970835-143970857 CTCTCTGGGTTGAGGGGAGAGGG + Intergenic
998835289 5:146197398-146197420 TTTCTTGGGCAGGGGGGAGCAGG - Intergenic
999008208 5:148005698-148005720 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
999308304 5:150535035-150535057 CTTGCAGGGCAGAGCGGGGCGGG + Intronic
999319704 5:150606276-150606298 TTGTTGGGGCAGAGGGGAGCAGG - Intronic
1000622900 5:163505578-163505600 CGTTCTGGGCCTAGGGGAGGCGG + Exonic
1000694829 5:164367899-164367921 CTTTCTGGGCAGGACAGAGCTGG + Intergenic
1001220723 5:169898220-169898242 GTTGATGGGCAGAGGAGAGCTGG - Intronic
1001304242 5:170560136-170560158 TTTTCTGGGCAGTGTGGGGCAGG + Intronic
1001320757 5:170679098-170679120 TCTTCTGGGCAGATGGGATCTGG + Intronic
1001576132 5:172765177-172765199 CTCGGTGGGCAGAGGGGAGCAGG + Intergenic
1001670301 5:173468181-173468203 GTGTCTGGGCAGAGAGGAGAAGG + Intergenic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1001720248 5:173851269-173851291 GTGGCTGGGCAGTGGGGAGCTGG - Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002397533 5:178969762-178969784 CAAACTGGGCAGAGTGGAGCTGG - Intergenic
1002633769 5:180597051-180597073 CCTGCTGTGCGGAGGGGAGCAGG + Intergenic
1002642723 5:180638099-180638121 TGTGTTGGGCAGAGGGGAGCTGG - Intronic
1002785889 6:399768-399790 TTTGCTGCTCAGAGGGGAGCTGG + Intronic
1002925111 6:1601536-1601558 CTTCCTGAGCAGATGGGAGGAGG - Intergenic
1002999747 6:2319815-2319837 CTCTCAGAGGAGAGGGGAGCTGG + Intergenic
1003127750 6:3369165-3369187 ATTCCTGGGCAGAAGGGAACTGG + Intronic
1004567583 6:16813245-16813267 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1006409582 6:33864797-33864819 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
1007180518 6:39926156-39926178 CTTCCTGGGCTGAGGGCACCTGG + Intronic
1007187394 6:39983962-39983984 CTTCCTGGGCAGAGAGGTGCAGG - Intergenic
1007805616 6:44443180-44443202 CTTTCAGGCCAGAAGGGAGTGGG - Intronic
1008406903 6:51128327-51128349 CTTTATGGTCAGAGGAGACCAGG - Intergenic
1009314530 6:62201079-62201101 CTGTTTGGGGTGAGGGGAGCAGG + Intronic
1009456074 6:63858025-63858047 CATTCTGGAAAGAGGGGACCAGG + Intronic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1009610182 6:65931122-65931144 GTTCCTGGGGAGAAGGGAGCAGG - Intergenic
1010556156 6:77281947-77281969 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1012057152 6:94427562-94427584 CTTGCAGGGCAGGAGGGAGCTGG - Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014740507 6:125143440-125143462 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
1014954642 6:127599900-127599922 CTCTCTAGAAAGAGGGGAGCAGG + Intergenic
1014960241 6:127674443-127674465 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1015828492 6:137341985-137342007 CTTTCAAAGCAGGGGGGAGCAGG + Intergenic
1015844127 6:137500638-137500660 TTTGCAGGGCAGAGGGGAGGAGG + Intergenic
1016205773 6:141466743-141466765 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1016210812 6:141531497-141531519 TTTCCTGGGCAGAAAGGAGCAGG + Intergenic
1017073706 6:150599749-150599771 CCCTCAGGGCAGAGGGGAGGCGG + Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017635339 6:156437585-156437607 CTTTCTGGGAAGAGGGCAGCTGG - Intergenic
1018190072 6:161302840-161302862 CTTTTAGGGCAGGGAGGAGCTGG + Intergenic
1019205728 6:170360050-170360072 CTGACAGGGAAGAGGGGAGCAGG - Intronic
1019383378 7:739987-740009 CTGGCTGGGCCGTGGGGAGCAGG - Intronic
1019405794 7:883352-883374 CTCTCTTGGCAGACGGAAGCTGG - Intronic
1019704054 7:2489016-2489038 CTTTCCGGGCAGGGGTGAGCTGG - Intergenic
1019719391 7:2559184-2559206 GTTCCTGGGCACCGGGGAGCCGG + Exonic
1019963963 7:4484003-4484025 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1020112006 7:5452541-5452563 CTCTCTGGGCAGAGCGGGGCGGG - Intronic
1021097235 7:16547864-16547886 GTTCCTGGGCAGAGGGGGGCAGG + Intronic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1023375736 7:39553174-39553196 CTTTGGGGGCAGGGGGGAGGGGG - Intergenic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024961594 7:54981978-54982000 GTCTCTGCGCTGAGGGGAGCTGG - Intergenic
1025618224 7:63142986-63143008 CTTTCAGTGGAGAGGGGACCTGG - Intergenic
1026918708 7:74139429-74139451 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1026933295 7:74237299-74237321 CTTCTTGGGCAGAGGAGAGCGGG - Intronic
1030048970 7:105521791-105521813 CTGGCCGGGCAGAGCGGAGCGGG + Intronic
1030787864 7:113684694-113684716 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1030902224 7:115138993-115139015 CTTGTTGGGGGGAGGGGAGCAGG - Intergenic
1031026614 7:116686312-116686334 ATTTCTGGGCAGAGGCAAGAAGG - Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032135933 7:129277688-129277710 CTCTTTGGGGAGAGGGGAGTGGG + Intronic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033380423 7:140811432-140811454 CTCTCAGGGGAGAGGGGAGTAGG + Intronic
1033537884 7:142328802-142328824 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1033551401 7:142451464-142451486 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033553666 7:142470029-142470051 CTTTATGTGCAGAGAGGAGATGG - Intergenic
1034285136 7:149879238-149879260 CTATCTGGGCAGGGGTGAGGGGG + Intronic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1034480808 7:151319317-151319339 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1034494500 7:151411440-151411462 CTTTCTGGGCAGAGGGGCCAAGG + Intergenic
1034689968 7:153006530-153006552 CTTTCATGTCAGAGGGGACCAGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035381780 7:158445307-158445329 CAGTCAGGGCAGAGGTGAGCAGG - Intronic
1035890432 8:3337031-3337053 CTTTCTGGGGAGGCTGGAGCTGG + Intronic
1036748745 8:11429694-11429716 CTGTCTGCTCAGAGGCGAGCTGG + Intronic
1037516280 8:19635153-19635175 CCATCAGGGCAGAGGGGACCAGG + Intronic
1037624324 8:20594113-20594135 CTCTCTCGGCAGAAGGGAGAGGG + Intergenic
1037699488 8:21261958-21261980 CCTTCAGGGCAGATGGGAGGAGG - Intergenic
1037973668 8:23193155-23193177 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1038215975 8:25562074-25562096 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1038289871 8:26239465-26239487 GTTTCTGGGCAGAGTGAAGGAGG - Intergenic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1039269719 8:35867742-35867764 ATTTCTGTGCAGAGAGCAGCAGG - Intergenic
1039379809 8:37074573-37074595 GTCCCTGGGAAGAGGGGAGCTGG - Intergenic
1039403432 8:37292754-37292776 ATTCCTGGGCAGAGTGGAGCTGG - Intergenic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1040650494 8:49443592-49443614 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040650502 8:49443692-49443714 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040659205 8:49549592-49549614 CTTTCTGTGCAGGGAGCAGCAGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1040718027 8:50282148-50282170 TTCTCTGGCCAGAGGGGAGCTGG - Intronic
1041029630 8:53723711-53723733 GGTTCTGGGCAGAGAGGAGATGG - Intronic
1041131957 8:54710653-54710675 CTGTCAGCGGAGAGGGGAGCTGG + Intergenic
1041398001 8:57411494-57411516 CTTTCTGGGAAGAGGAGGACAGG - Intergenic
1042004906 8:64169382-64169404 TTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1043438961 8:80260214-80260236 CTTTCAGTGAAGAGGGGAGCTGG + Intergenic
1043439004 8:80260441-80260463 TTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1045111542 8:98942049-98942071 CTTTCTGCGCCGAGGGCTGCTGG + Intronic
1046262238 8:111783577-111783599 CTTCCTGGGAAGTGGGGAGGGGG + Intergenic
1046372449 8:113327507-113327529 CCTACTGGGAAGAGGGGAGTGGG - Intronic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1047673113 8:127170529-127170551 CTTTGTGGGGAGAGGGGACGTGG + Intergenic
1048442792 8:134472268-134472290 TGTTCTGGGCTAAGGGGAGCAGG - Intergenic
1048841928 8:138574255-138574277 CCTTCTGGGAAAAGGGGAGTTGG - Intergenic
1049146881 8:141006909-141006931 CTTGCTGGGTAGACTGGAGCTGG - Intergenic
1049221537 8:141430908-141430930 CTTCCTGGGAAGAGGGGAACAGG - Exonic
1049730296 8:144173939-144173961 CTCTTGGGGGAGAGGGGAGCTGG + Intronic
1050793751 9:9509710-9509732 CTTTCTGTGCAGTGAGTAGCAGG + Intronic
1051996126 9:23219941-23219963 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1052580637 9:30349899-30349921 GTTTCTGAGCAGAGAGGGGCAGG - Intergenic
1052660152 9:31419195-31419217 CTTTATAGGCACAGGGGGGCAGG - Intergenic
1052707541 9:32011063-32011085 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1053147633 9:35722711-35722733 CTTTCTTGGCAGAGGTGAGGTGG + Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1055189866 9:73504926-73504948 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1056627054 9:88262564-88262586 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1056801598 9:89695880-89695902 GTTCCTGGGCTGAGGAGAGCAGG + Intergenic
1056809361 9:89752362-89752384 CTTTTTGGGTAGAGGGGTGAGGG + Intergenic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1057194233 9:93107866-93107888 CTTTCTGGGCTGGGAGAAGCTGG + Intronic
1057197049 9:93121068-93121090 TTCTCTGGGCACAGGGGAGCTGG - Intergenic
1057227555 9:93300423-93300445 CCTTCTGGGCAGAGGTGCCCGGG - Intronic
1057395787 9:94678851-94678873 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1057551522 9:96054106-96054128 CTTCCAGGGCAGAAGGGGGCTGG + Intergenic
1058612901 9:106794200-106794222 ATTCCTGGGCAGGGGGGATCGGG + Intergenic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059049593 9:110909413-110909435 CTTTCAGTGCAGTGGGCAGCAGG + Intronic
1059419178 9:114180587-114180609 CCATCTGTGCAGAGAGGAGCTGG - Intronic
1059929026 9:119242499-119242521 CTTTCTTGGAAGAGGGGAAGAGG - Intronic
1060008839 9:120025550-120025572 CTTTCTGGCCTAAGGGGAGATGG - Intergenic
1061062588 9:128258075-128258097 CCTTCTGGGCCGAGGCCAGCAGG + Exonic
1061222852 9:129262287-129262309 CTCTCTGGGCAGAGGGGTCTGGG + Intergenic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1061428675 9:130517483-130517505 ACTTCGGGGCAGAGGGGAGAGGG - Intergenic
1061442238 9:130613429-130613451 CTTTGTGGGAAGAGGATAGCTGG + Intronic
1062211803 9:135368733-135368755 CTTTCTGTGCAGAGAGCCGCAGG + Intergenic
1062227779 9:135463197-135463219 AGTTTAGGGCAGAGGGGAGCTGG + Intergenic
1062234710 9:135502292-135502314 CCTTCTGGGCTGCGGGGAGGAGG + Intronic
1062392590 9:136339872-136339894 CGCTCGGGGCAGAGGGGACCCGG - Intronic
1062567060 9:137168101-137168123 GTCTCTGAGCAGTGGGGAGCGGG + Exonic
1203670760 Un_KI270755v1:9184-9206 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186186688 X:7027200-7027222 GTAACTGGGCATAGGGGAGCAGG - Intergenic
1189378204 X:40482257-40482279 CGTTCTGGGCAGAATGGAACAGG + Intergenic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1192209912 X:69121451-69121473 CTTTCTCGGCATGGGGGAGAGGG - Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1194672158 X:96747142-96747164 CTTTTTGGGGAGAGGGGTGTTGG + Intronic
1195108489 X:101623191-101623213 CCCTCAGGGCAGTGGGGAGCTGG - Exonic
1195334103 X:103832317-103832339 CTTTCTCGGCGGTGGGGACCCGG + Intergenic
1196294103 X:113979196-113979218 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1196872386 X:120125317-120125339 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197422058 X:126249791-126249813 CATTCTGGGAAGATGGGACCAGG - Intergenic
1197723790 X:129762243-129762265 GGGTCTGGGCTGAGGGGAGCTGG - Intronic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198336213 X:135669150-135669172 CTTTCAGGGGAGAAGGCAGCTGG - Intergenic
1198533540 X:137566661-137566683 CGTTCTGGGCACAGGCGATCCGG - Exonic
1199861130 X:151801279-151801301 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1200154324 X:153967321-153967343 CTTGCTCAGGAGAGGGGAGCTGG - Intronic