ID: 904495995

View in Genome Browser
Species Human (GRCh38)
Location 1:30887074-30887096
Sequence TGTGCAGGGAGCTGAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 545}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904495995_904496003 16 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904496003 1:30887113-30887135 CTGGGAGTGAGTAGAAATGGAGG 0: 1
1: 1
2: 3
3: 24
4: 318
904495995_904496001 13 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335
904495995_904496004 22 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314
904495995_904495998 -3 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904495998 1:30887094-30887116 ACAGAGACAGCCTGAAAGCCTGG 0: 1
1: 1
2: 4
3: 39
4: 410
904495995_904495999 -2 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904495999 1:30887095-30887117 CAGAGACAGCCTGAAAGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904495995 Original CRISPR TGTGCAGGGAGCTGAGTGTG AGG (reversed) Intronic