ID: 904495999

View in Genome Browser
Species Human (GRCh38)
Location 1:30887095-30887117
Sequence CAGAGACAGCCTGAAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904495995_904495999 -2 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904495999 1:30887095-30887117 CAGAGACAGCCTGAAAGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 300
904495994_904495999 1 Left 904495994 1:30887071-30887093 CCACCTCACACTCAGCTCCCTGC 0: 1
1: 0
2: 4
3: 70
4: 611
Right 904495999 1:30887095-30887117 CAGAGACAGCCTGAAAGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 300
904495993_904495999 7 Left 904495993 1:30887065-30887087 CCAGCACCACCTCACACTCAGCT 0: 1
1: 0
2: 2
3: 32
4: 371
Right 904495999 1:30887095-30887117 CAGAGACAGCCTGAAAGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904495999 Original CRISPR CAGAGACAGCCTGAAAGCCT GGG Intronic