ID: 904496001

View in Genome Browser
Species Human (GRCh38)
Location 1:30887110-30887132
Sequence AGCCTGGGAGTGAGTAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904495994_904496001 16 Left 904495994 1:30887071-30887093 CCACCTCACACTCAGCTCCCTGC 0: 1
1: 0
2: 4
3: 70
4: 611
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335
904495993_904496001 22 Left 904495993 1:30887065-30887087 CCAGCACCACCTCACACTCAGCT 0: 1
1: 0
2: 2
3: 32
4: 371
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335
904495997_904496001 -2 Left 904495997 1:30887089-30887111 CCTGCACAGAGACAGCCTGAAAG 0: 1
1: 0
2: 3
3: 36
4: 356
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335
904495996_904496001 -1 Left 904495996 1:30887088-30887110 CCCTGCACAGAGACAGCCTGAAA 0: 1
1: 0
2: 2
3: 28
4: 368
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335
904495995_904496001 13 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904496001 1:30887110-30887132 AGCCTGGGAGTGAGTAGAAATGG 0: 1
1: 0
2: 2
3: 35
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904496001 Original CRISPR AGCCTGGGAGTGAGTAGAAA TGG Intronic