ID: 904496004

View in Genome Browser
Species Human (GRCh38)
Location 1:30887119-30887141
Sequence GTGAGTAGAAATGGAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904495994_904496004 25 Left 904495994 1:30887071-30887093 CCACCTCACACTCAGCTCCCTGC 0: 1
1: 0
2: 4
3: 70
4: 611
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314
904495997_904496004 7 Left 904495997 1:30887089-30887111 CCTGCACAGAGACAGCCTGAAAG 0: 1
1: 0
2: 3
3: 36
4: 356
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314
904495995_904496004 22 Left 904495995 1:30887074-30887096 CCTCACACTCAGCTCCCTGCACA 0: 1
1: 1
2: 6
3: 67
4: 545
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314
904496000_904496004 -8 Left 904496000 1:30887104-30887126 CCTGAAAGCCTGGGAGTGAGTAG 0: 1
1: 0
2: 0
3: 14
4: 189
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314
904495996_904496004 8 Left 904495996 1:30887088-30887110 CCCTGCACAGAGACAGCCTGAAA 0: 1
1: 0
2: 2
3: 28
4: 368
Right 904496004 1:30887119-30887141 GTGAGTAGAAATGGAGGACAAGG 0: 1
1: 0
2: 2
3: 23
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904496004 Original CRISPR GTGAGTAGAAATGGAGGACA AGG Intronic