ID: 904496142

View in Genome Browser
Species Human (GRCh38)
Location 1:30887844-30887866
Sequence GAGAAGAGCAGGGCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904496142_904496147 9 Left 904496142 1:30887844-30887866 CCAAGGCAGGCCCTGCTCTTCTC 0: 1
1: 0
2: 1
3: 68
4: 490
Right 904496147 1:30887876-30887898 TCTCCCTGTGTGTAAAACCGAGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904496142 Original CRISPR GAGAAGAGCAGGGCCTGCCT TGG (reversed) Intronic
900014478 1:138662-138684 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
900044343 1:493864-493886 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
900065750 1:728770-728792 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
900482352 1:2905363-2905385 GTGAGGAGCTGGGCCTTCCTGGG - Intergenic
900600916 1:3502314-3502336 AGGAAGAGCAGGCCCTACCTCGG - Intronic
900612355 1:3549492-3549514 GAGAAGATGGGGGGCTGCCTGGG + Intronic
901456679 1:9367050-9367072 GGGAAGAGCAGGGATCGCCTGGG + Intronic
901685011 1:10938944-10938966 GAGCAGAGCAAGTCCTGCGTGGG - Intergenic
902087925 1:13877450-13877472 GTGAAGAACCAGGCCTGCCTGGG + Intergenic
902169625 1:14599259-14599281 GAGCAGAGCACGCCCGGCCTCGG + Intronic
902192556 1:14773809-14773831 GAGGAGAGCAGGCCTGGCCTGGG - Intronic
902792361 1:18778003-18778025 AAGAAAAGCCTGGCCTGCCTTGG - Intergenic
903383202 1:22910599-22910621 AAGAGGGGCAGGGCCTGGCTGGG - Intronic
903664116 1:24996226-24996248 GGGGAGAGAAGGGCCAGCCTGGG - Intergenic
903682177 1:25104436-25104458 GAGGAGGGCAGGGGCTGCCTTGG - Intergenic
903738498 1:25544702-25544724 GAGAAGAGAGTGGCTTGCCTGGG + Intronic
903765061 1:25728761-25728783 GGGAAACGCAGTGCCTGCCTGGG + Intronic
903853831 1:26323985-26324007 GAGAAGAGCACGACTTGCCCAGG + Intronic
904328269 1:29741487-29741509 GAAAAGAGAAGGGCTTGCCTAGG + Intergenic
904476647 1:30769333-30769355 GAGAAGAGGGAGGCCTGGCTGGG - Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
905796538 1:40819298-40819320 GAGGAGCGCTGTGCCTGCCTGGG - Intronic
906215069 1:44033877-44033899 GGGAAGGGCATGGCCAGCCTGGG + Intergenic
906240181 1:44238033-44238055 GAGAAGAGCAGAGGCCGCGTAGG - Intronic
906625396 1:47320911-47320933 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
907158747 1:52356473-52356495 GCCCAGAGCAGGACCTGCCTTGG + Intronic
908421214 1:63960096-63960118 GAAAAGTGCAGGGTCTACCTGGG - Intronic
908654379 1:66372463-66372485 GAGCAGAACAGGGACTGCCAGGG + Exonic
908957546 1:69651911-69651933 AAGAAGAGGAGGGCATGGCTTGG + Intronic
908959954 1:69684895-69684917 GAGCAGAGCAGGGATGGCCTGGG - Intronic
911052436 1:93681953-93681975 GGGCAGAGGAGGGCCTGGCTAGG - Intronic
911879268 1:103213735-103213757 ATGAAGAGCAGGGCTTCCCTTGG - Intergenic
912570548 1:110618044-110618066 GAGAAGAGCAGAGAGGGCCTGGG + Intronic
912661559 1:111535978-111536000 GAGGAGAGGAGGGGGTGCCTGGG - Intronic
912954906 1:114148485-114148507 GGGGAGAGCAGGAGCTGCCTCGG + Intronic
913085027 1:115428966-115428988 ATGAAGAGCAGGGCCTCCATTGG + Intergenic
913489814 1:119368423-119368445 GAGAAGAGCAAGCACAGCCTGGG - Intergenic
914517282 1:148384647-148384669 GTGAAAAGCAGGGGCTGGCTAGG + Intergenic
918883537 1:190158891-190158913 GAAAAGAGAAAGGACTGCCTAGG + Intronic
920201238 1:204261096-204261118 GAGAAGAGGAGGAGCTGGCTAGG + Intronic
921056954 1:211549570-211549592 GAGGACACCAGGGCCTGCTTGGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922100875 1:222476119-222476141 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
922733744 1:227968553-227968575 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
924343797 1:243056236-243056258 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
1062844462 10:693132-693154 GAGAGGAGCAGCCCCTTCCTCGG + Intergenic
1063958673 10:11288140-11288162 GAGAAGCGCAGGCTCTGCCAGGG + Intronic
1064807165 10:19148279-19148301 GGGAAGAGCACGGGCTGCCCAGG + Intronic
1066013504 10:31215778-31215800 GTGAAGAGTCAGGCCTGCCTTGG - Intergenic
1067368655 10:45661332-45661354 GGGAGGAGCAGGGCCTGCTCAGG - Intronic
1067539943 10:47143986-47144008 CACAACAGCAGGGCCTGCATTGG + Intergenic
1067799363 10:49348455-49348477 GTGCAGTCCAGGGCCTGCCTGGG - Intergenic
1067916633 10:50406922-50406944 CAGGAGCGCAGGACCTGCCTGGG - Intronic
1067945685 10:50686722-50686744 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1068975997 10:63010182-63010204 GACAAGAGCAAGGGCTGCTTTGG - Intergenic
1069689489 10:70340535-70340557 GAGCTGACCAGGGCCTACCTCGG + Exonic
1070640826 10:78168648-78168670 GAGCAGATCAGTGCTTGCCTCGG + Intergenic
1070761386 10:79026529-79026551 GAGGTGGGCAGGGCCTGGCTGGG + Intergenic
1070867198 10:79713595-79713617 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1070880990 10:79851719-79851741 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1071203604 10:83249335-83249357 GAGAAGATAATGGCCTGGCTTGG - Intergenic
1071605510 10:86984518-86984540 GAGAACACCAGGGCCTGTCGTGG - Intergenic
1071634113 10:87235819-87235841 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1071647561 10:87368036-87368058 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1071730861 10:88247148-88247170 GAGGAGGGCAGAGCCTGGCTTGG + Intergenic
1072636230 10:97180154-97180176 GCGAAGAGGAGGGCCACCCTGGG + Intronic
1073059748 10:100726314-100726336 GAGAGGGGCAAGGCCTGACTGGG + Intergenic
1073543570 10:104331236-104331258 TAGGAGAGCAGGGGCTGCCTGGG - Intronic
1073879091 10:107959092-107959114 GACAATGGCAGGGCCTGACTTGG - Intergenic
1074426255 10:113354053-113354075 AAGAAGAGCAGCCACTGCCTTGG + Intergenic
1074435263 10:113428669-113428691 GAGCAGAGCAGGGCCTGGAATGG + Intergenic
1074447716 10:113534052-113534074 GGGATGAGCAGAGCCTGGCTGGG + Intergenic
1074813873 10:117130542-117130564 GCCAATAGCTGGGCCTGCCTGGG - Intronic
1075085578 10:119412375-119412397 GTGAAGAGCTGGGCGTGCTTGGG + Intronic
1075916646 10:126173738-126173760 GAGTATAGCAGAGTCTGCCTGGG + Intronic
1075985314 10:126780024-126780046 GGGAAGTCCAGGGCCTGCTTGGG - Intergenic
1076294672 10:129375320-129375342 GTGCAGAGCAGGGGCTGACTTGG + Intergenic
1076305207 10:129461318-129461340 GAGAAGAGGAAGGCCTGCGGAGG + Intergenic
1076536869 10:131184091-131184113 GAGAAGAGAAGGGCTTTGCTGGG - Intronic
1076970675 11:130339-130361 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
1077093091 11:788361-788383 GAGAAGGGCAGGGTCGGCCTTGG + Exonic
1077103491 11:832371-832393 ACGAAGGGCAGGGCCGGCCTAGG - Intergenic
1077177444 11:1197173-1197195 GGGAAGAGCACAGCCAGCCTCGG - Intronic
1077194436 11:1272261-1272283 GAGAGGAGCAGGGCCGGTCCTGG - Intergenic
1077578973 11:3404824-3404846 GAGAAGAGCAGATACTGCCATGG - Intergenic
1078476562 11:11635239-11635261 AAGCAGAGCAGAGCTTGCCTTGG - Intergenic
1079375788 11:19890639-19890661 GTGAAGATCTGGGCCTCCCTTGG - Intronic
1080464733 11:32486125-32486147 GAGAAGTGCAGGACCTGATTAGG + Intergenic
1081709838 11:45209542-45209564 CCCAAGAGCAGGGCCTGCGTGGG - Intronic
1081777785 11:45688009-45688031 GAGAAAAGCAGCCCCTGCCAGGG + Intergenic
1083301033 11:61739715-61739737 GTGGAGAGCAGGGCCGGCCTTGG + Intronic
1083363608 11:62128327-62128349 GGGAACACCAGGGCCTGTCTGGG + Intronic
1083487183 11:62990622-62990644 GTGAAGAGCAGGGGCAGTCTAGG + Intronic
1083683444 11:64361776-64361798 GAGGGCTGCAGGGCCTGCCTGGG + Intronic
1083852288 11:65375455-65375477 GAGGAGAGCGGGGCCAGCCCCGG + Exonic
1084235998 11:67788343-67788365 GAGAAGAGCAGATACTGCCATGG - Intergenic
1084422259 11:69066284-69066306 GAGCAGAGCAAGGCCTTCCGAGG - Intronic
1084632971 11:70367622-70367644 GAGAAGAGGTGGGTCTCCCTGGG + Intronic
1084891488 11:72239193-72239215 GAGGAGTGGAGGGGCTGCCTGGG - Exonic
1085389415 11:76174977-76174999 GGGAAGAGCAGGGTGGGCCTGGG + Intergenic
1085399176 11:76225328-76225350 GGGGGGAGCAGGGTCTGCCTGGG + Intergenic
1088368264 11:109061487-109061509 TAAAAGAGCAGGGCCAGACTGGG - Intergenic
1088542209 11:110924903-110924925 GAGAAGAGCAGGTCAAGCATGGG + Intergenic
1089086154 11:115818642-115818664 GGCAGGAGCAGGGCATGCCTGGG - Intergenic
1089558900 11:119333628-119333650 GAAAAGGGCAGGGCCGGGCTTGG + Intergenic
1089596121 11:119581590-119581612 TAGGAGAGCAAGGCCAGCCTGGG + Intergenic
1090240671 11:125179393-125179415 GAGCAGGGCAGGGCCTCCCTGGG + Intronic
1090797344 11:130146449-130146471 GAGCAGAGTGGAGCCTGCCTAGG - Intergenic
1091283333 11:134394570-134394592 GAGAGCAGCAGTGCCTTCCTGGG - Intronic
1091287089 11:134413396-134413418 GGGAAGAGCAGGGCCCGGCTTGG - Intergenic
1091655261 12:2341426-2341448 TAGAAGAGCAGGGCCTCACCTGG - Intronic
1091676954 12:2498579-2498601 GAGAAGAATAAGGCCTGCCCAGG + Intronic
1091950850 12:4591773-4591795 TAGAAGAGCATGGCCAGCCAGGG + Intronic
1092155025 12:6276597-6276619 GAGCAGAGCAGGGCTGACCTGGG - Intergenic
1092253745 12:6915404-6915426 AAGAAGAGGATGGGCTGCCTGGG - Exonic
1092262761 12:6961263-6961285 GAGAAGGGTTGGCCCTGCCTGGG - Exonic
1093905669 12:24689449-24689471 GAGAGGAGCAGGACATGGCTGGG + Intergenic
1095909195 12:47408614-47408636 GAGAAGAAAATGGCCTGCCCTGG - Intergenic
1095965244 12:47863140-47863162 GTGAAGAGCAGCACCAGCCTGGG - Intronic
1097152795 12:56991863-56991885 GACCAGACCAGGGCCTTCCTTGG + Intergenic
1097787745 12:63779865-63779887 GAAACGGGCTGGGCCTGCCTCGG + Exonic
1100407326 12:94283073-94283095 GATAAGAGCTGGGGCTGCATGGG + Intronic
1100511627 12:95280405-95280427 GAGAGGAGAAGGGGCTGGCTGGG - Intronic
1100980290 12:100157798-100157820 GTGGAGAGCAGGCCTTGCCTTGG + Intergenic
1102077682 12:110073152-110073174 GAGCAGGGCAGGGTGTGCCTGGG - Intronic
1102392674 12:112562288-112562310 GACAAGACCAAGGCCTGCCAGGG - Intergenic
1102540890 12:113618282-113618304 CAGAAGATCAAGGCCAGCCTGGG + Intergenic
1103012054 12:117465343-117465365 CAGAAGAGCAGTGTCTGCTTAGG + Exonic
1103464790 12:121133341-121133363 GCGCAGGGCAGGGCGTGCCTGGG + Intronic
1103716162 12:122946576-122946598 TGGAAGAGCAGGGGATGCCTTGG + Intronic
1103740098 12:123085256-123085278 GAGAAGCCCAGGTCCTGCCCAGG - Intronic
1103814834 12:123646468-123646490 CAGGAGAGCAAGGCCAGCCTGGG - Intronic
1104414493 12:128586880-128586902 GAGGAGAGCAGGTGCTGCCCAGG - Intronic
1104784939 12:131443376-131443398 GAGAAGAGATGGGCCGGCCTGGG + Intergenic
1104862022 12:131928967-131928989 GAGAGGAGCGGGGCCAGCGTGGG + Intergenic
1104897517 12:132171593-132171615 GAGTAGAGCAGGGCCCTCCCAGG + Intergenic
1106486353 13:30176297-30176319 GAGAACAGCTGGGCTTTCCTTGG - Intergenic
1107086603 13:36432526-36432548 GGGAAGAGCGGGGCCCGCTTTGG + Exonic
1107141938 13:37008463-37008485 TAGAAGAGCAGGGCCGGGCATGG + Intronic
1108837045 13:54563465-54563487 GAGAAGATCAGGGACTTACTTGG - Intergenic
1110678345 13:78277481-78277503 GAGAAGAAAAGGGCCTCCCTGGG - Intergenic
1111949730 13:94701335-94701357 TAGAACAGCAGGGCAAGCCTCGG - Intergenic
1112928403 13:104705471-104705493 GCCAGGAGGAGGGCCTGCCTGGG - Intergenic
1113375440 13:109761129-109761151 GAGAGGACCGGGGCCTCCCTGGG - Intronic
1114269953 14:21094472-21094494 GAGAGGAGGAAAGCCTGCCTCGG - Intronic
1114427186 14:22633803-22633825 GAGAAGAGCAAGCCCTTCCTTGG + Exonic
1114455118 14:22849020-22849042 GAGAAGAGGAGGGGGAGCCTAGG + Intronic
1117960870 14:61160234-61160256 GAGCAGAGCAGAGTTTGCCTGGG - Intergenic
1118137598 14:63045969-63045991 GAGCAGGGCAGGGACTGGCTGGG + Intronic
1118750896 14:68807309-68807331 GACAAGAGCAGGCCCTGGTTTGG - Intergenic
1119554369 14:75542054-75542076 GCGCAGAGCAGGGCTTGGCTCGG - Intronic
1119731723 14:76955535-76955557 GAGAGGGCCAGGGCCTGCGTGGG - Intergenic
1119866743 14:77980864-77980886 CAGAACAGCTGGCCCTGCCTCGG + Intergenic
1121434544 14:93910541-93910563 GGGAAGGGCAGGGTCAGCCTGGG - Intergenic
1121535045 14:94685437-94685459 GAACAGTGGAGGGCCTGCCTGGG - Intergenic
1122154495 14:99742136-99742158 GTGAAGGGCTGGGCCTGCCTGGG + Intronic
1122609697 14:102973557-102973579 GAGAAGGGGAGGGCCTGGCTCGG + Intronic
1122836289 14:104432563-104432585 GTGGAGACCAGGGCCTGCCTGGG + Intergenic
1122919094 14:104872662-104872684 CAGAAGGTCAGGGCCTGCCCAGG - Intronic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1124220466 15:27846349-27846371 GAGCAGGGCAGGGCCTGCTGAGG - Intronic
1124686319 15:31785815-31785837 GAGGAGAGCAGCACCTTCCTTGG + Intronic
1125730924 15:41892451-41892473 AAGAGGAGCAGGGCCTGTCTTGG - Intronic
1126559234 15:50025376-50025398 GAGAAGAGCAGGGGCAGACAGGG - Intronic
1129191373 15:73939574-73939596 AAGCAGAGCAGTGGCTGCCTGGG + Intronic
1129517171 15:76163759-76163781 GGAAAGAGCTGGGGCTGCCTGGG - Intronic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1130404587 15:83586868-83586890 GGGAAGACCAGTGTCTGCCTTGG - Intronic
1131094079 15:89645224-89645246 GTGGAGAGCAGGGGCTGCCAGGG + Intronic
1131098763 15:89672126-89672148 AAGAAGAGCATGGACGGCCTGGG - Intronic
1131133001 15:89912303-89912325 GTCCAGAGCAGGGCCTGCCTGGG - Intronic
1131711719 15:95062735-95062757 TAGAGGAGCATGGCATGCCTTGG + Intergenic
1132019593 15:98348816-98348838 GAGATGAGGAGGGCCTTCCCTGG - Intergenic
1132302591 15:100785331-100785353 AGGAAGGGAAGGGCCTGCCTGGG + Intergenic
1132403911 15:101530820-101530842 GAGCAGAGCAGGCCCTGCTGTGG - Intergenic
1132438357 15:101832457-101832479 GAGAAGAGCAGAGCTTTCCGTGG + Intergenic
1132651058 16:1021620-1021642 GGGTGGAGTAGGGCCTGCCTTGG + Intergenic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1133042251 16:3066913-3066935 CACAAGAGCAGGGCCTGCGTGGG - Intronic
1133042262 16:3066953-3066975 CACAAGAGCAGGGCCTGCGTGGG - Intronic
1133042273 16:3066993-3067015 CACAAGAGCAGGGCCTGCGTGGG - Intronic
1133042284 16:3067033-3067055 CACAAGAGCAGGGCCTGCGTGGG - Intronic
1133042295 16:3067073-3067095 CACAAGAGCAGGGCCTGCGTGGG - Intronic
1133287385 16:4696962-4696984 GGGAGCAGCAGGGCCTGTCTGGG - Intronic
1133347576 16:5080916-5080938 GAGAAGAGCAGACACTGCCATGG - Intronic
1133578794 16:7123015-7123037 GAAAAGATCAGGGGCTGCCAGGG + Intronic
1133819648 16:9225352-9225374 GAATAGAGCAGTCCCTGCCTGGG + Intergenic
1136012111 16:27370467-27370489 AAGAAGAAGAAGGCCTGCCTGGG + Intergenic
1136064063 16:27747045-27747067 AAGTTAAGCAGGGCCTGCCTGGG + Intronic
1136538941 16:30917678-30917700 GAGAAGCTCAGGGTCAGCCTTGG - Intergenic
1137002569 16:35242405-35242427 GCGCAGAGCAGTGCATGCCTGGG + Intergenic
1137235081 16:46609911-46609933 GAGGAGAGCAGAGGGTGCCTGGG - Intronic
1137273404 16:46917934-46917956 GAGGAGGACAGGGCCTGGCTTGG + Intronic
1137692598 16:50439929-50439951 CAGAAGAGCAGGGGTTGCCAGGG + Intergenic
1138191348 16:55016569-55016591 GAGAGGGGCAGGGACTGCATGGG + Intergenic
1138347107 16:56326773-56326795 GAGCAGAGCAGGTGCTGCCCCGG - Intronic
1138448126 16:57077544-57077566 GAGAAGAGCAGGGGCTGGGGTGG - Intronic
1138588940 16:57988957-57988979 GAGAAGAGCTGGACTTGCCCAGG + Intergenic
1138589186 16:57990413-57990435 GAGAAGAGCTGGACTTGCCCAGG + Intergenic
1139349722 16:66327488-66327510 GAGAGGAACGGGGCCTGACTGGG + Intergenic
1139627934 16:68206772-68206794 CAGAAGATCAGGACCAGCCTGGG + Intronic
1139656313 16:68389180-68389202 GAGCAGAGCAGGGAGGGCCTGGG + Intronic
1139663573 16:68439335-68439357 GAGGAGACCAGGGTCTGGCTGGG - Intronic
1139710362 16:68771220-68771242 AAGAAGATCAGAGCCTGCGTAGG - Intronic
1139912667 16:70407757-70407779 GAGAACAGCAGGGACTGTTTTGG + Intronic
1140295113 16:73702288-73702310 GCAAAGAGAAGGGGCTGCCTGGG + Intergenic
1140374503 16:74434048-74434070 GAGGAAAGCATGGCCTGGCTAGG - Intergenic
1141956692 16:87376761-87376783 GAGCAGAGCTTGGGCTGCCTGGG - Intronic
1142165758 16:88586757-88586779 GAGCAGAGCAGGGCCTGGCAAGG - Intronic
1142193296 16:88727684-88727706 AGGAAGGGCCGGGCCTGCCTGGG + Intronic
1142355609 16:89600203-89600225 CACATGGGCAGGGCCTGCCTGGG + Intergenic
1142449575 16:90167144-90167166 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1142457516 17:64702-64724 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
1142457604 17:65150-65172 GACAAGACCTGGGCCTGTCTAGG + Intergenic
1142485681 17:246419-246441 GAGAAGAGGAGGGACTTCCTCGG - Intronic
1142485737 17:246737-246759 GAGATGGTGAGGGCCTGCCTGGG + Intronic
1143303424 17:5927795-5927817 CAGAAGCTCAGTGCCTGCCTAGG + Intronic
1143322210 17:6075658-6075680 CAGAAGAGCAGGGCCTGGGGAGG - Intronic
1143426648 17:6844926-6844948 GAGAGGAGCAGGAGCTGACTTGG + Intergenic
1144585846 17:16487227-16487249 AAGAAGAGCAGGCCCAGCGTAGG + Intronic
1144661391 17:17073110-17073132 GAGCAGAGGAGTGGCTGCCTGGG - Intronic
1144678600 17:17177572-17177594 GGGGAGAGCAAGGCCTGTCTGGG - Intronic
1145975950 17:28984503-28984525 GGGAAGAGCTGTGCCTGCCCTGG - Intronic
1145995696 17:29103609-29103631 GAGAAGAGCAGCTGCTGCATGGG - Exonic
1146003735 17:29147940-29147962 GAGATAAGAAGGGTCTGCCTAGG + Intronic
1146480920 17:33204246-33204268 GAGACAAGTAGGGCCTGCCTGGG - Intronic
1146693922 17:34894750-34894772 GAGAAGACAAGGGGCTGGCTAGG + Intergenic
1147364367 17:39950790-39950812 GAGGAGAGTAGGGGCTGCGTGGG - Intergenic
1147553227 17:41460023-41460045 CAGAAGAGCAGGGCCAGCCCCGG - Exonic
1147667148 17:42155923-42155945 GAGAAGAGCTGACCCTGGCTAGG - Intergenic
1148391627 17:47276767-47276789 GAGAGGAGCAGGGCTTCCCCTGG + Intronic
1148446863 17:47743188-47743210 TTGAAGAGCAGGTCCTACCTGGG - Exonic
1148772249 17:50074154-50074176 GAGAGAAGCTGGGACTGCCTGGG + Exonic
1149499132 17:57138260-57138282 GCTGAGAGCAGGGCTTGCCTGGG - Intergenic
1149605684 17:57923545-57923567 TAGGACAGCATGGCCTGCCTTGG + Intronic
1151459741 17:74247493-74247515 GTGAAGAGCAGGCCTGGCCTGGG + Intronic
1151683831 17:75635519-75635541 TACAGGAGCAGGGCCTGCCAGGG + Intronic
1151714500 17:75824432-75824454 GAGAAGATCTGGGCCAGGCTGGG - Exonic
1151719671 17:75847952-75847974 GAAATGAGCGTGGCCTGCCTTGG + Intronic
1151815756 17:76470615-76470637 GAGCAGGGAAGGGGCTGCCTGGG - Intergenic
1151842898 17:76630303-76630325 GAGAAAGGCAGGGCCGGCCAAGG + Intronic
1151890532 17:76948434-76948456 GAGAAGAGAGGGGCCTGGCCTGG - Intronic
1152067346 17:78119029-78119051 GAGAAGAGCACCCCCAGCCTGGG + Exonic
1152157718 17:78645875-78645897 GAGAAGAGCAGGGCTGGCCAGGG - Intergenic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1153992230 18:10410701-10410723 GAGAACAGGAGTGCCTGCCCTGG + Intergenic
1156368126 18:36448444-36448466 GAGAAGAGCAGGGCAGGGCAGGG - Intronic
1157855910 18:51105496-51105518 TAGAAGTTCAGGGCCAGCCTGGG - Intergenic
1157932907 18:51842741-51842763 GAGCTGAGCTGGGCCAGCCTGGG + Intergenic
1158019758 18:52827524-52827546 GAAAAGAGCATGTGCTGCCTAGG - Intronic
1159998757 18:74995208-74995230 GTGAACGGCAGGGCCTGGCTTGG + Intronic
1160428809 18:78797259-78797281 GAGGAGAGCTGGGCCCGCCCTGG + Intergenic
1160710653 19:549558-549580 GAGGGGAGCAGGGCCCGCCGAGG - Intronic
1160755489 19:754959-754981 TGGAAGAGGAGGGCCTGGCTTGG + Intronic
1160755523 19:755059-755081 TAGAAGAGGAGGGCCTGGCTTGG + Intronic
1161694493 19:5758430-5758452 GAACAGAGCAGGGCTTGGCTGGG + Intronic
1161793534 19:6374293-6374315 GAGGAGAGCAGGGTCTGGCCGGG - Exonic
1163025028 19:14505902-14505924 GAGCAGGGCAGGGCGTGTCTAGG - Intergenic
1163429135 19:17256516-17256538 GGGAAGAGCTGGGCCAGCCTGGG + Exonic
1163751180 19:19078764-19078786 GAGCAGAGAAGGGCCTCCCAGGG + Intronic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1163809385 19:19421153-19421175 GAGACAAGCAGGGCCTGGCTTGG + Intronic
1164696747 19:30250572-30250594 GAGCAGAGCAGGACCTTGCTAGG + Intronic
1164752229 19:30665511-30665533 GGGCTGAGGAGGGCCTGCCTGGG + Intronic
1165806388 19:38583621-38583643 GGGAAGGGCTGGCCCTGCCTGGG + Intronic
1166116620 19:40659724-40659746 GAGAAGAGCAGAGCTTTCCATGG - Intergenic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167381362 19:49140063-49140085 GAGAAGAGCTGTCCCGGCCTGGG - Exonic
1168669309 19:58229054-58229076 GAAACGAGCAGGGCCTGCGGGGG + Intronic
925132500 2:1503653-1503675 GAGGAAATCAGGGTCTGCCTGGG - Intronic
925183193 2:1830261-1830283 GAGAAGAGAACTTCCTGCCTGGG - Intronic
925196629 2:1931141-1931163 GAGAAGGGTGGGGCCGGCCTGGG + Intronic
925391195 2:3495323-3495345 TAGAAGTGCAGAGCCTGCCTGGG + Intergenic
925491833 2:4403699-4403721 GGGAAGAGCGGGGTCGGCCTAGG + Intergenic
925732067 2:6926352-6926374 GAGAAAATGAGGGTCTGCCTGGG + Intronic
925890627 2:8431230-8431252 AAGAAGAGGAGCCCCTGCCTAGG + Intergenic
926104360 2:10141225-10141247 CAGCAGAGCTGGGCCTGGCTGGG - Intergenic
927645946 2:24877094-24877116 GGGAGGAGGAGGGGCTGCCTTGG - Intronic
928840403 2:35598771-35598793 GGGAAGAGGGGGGCCTTCCTGGG - Intergenic
929048022 2:37809634-37809656 GAAAAGAGCAGAGCCTGCAGGGG - Intergenic
929594896 2:43169832-43169854 GAACAGAGCAGGTCCTCCCTGGG - Intergenic
929861649 2:45683416-45683438 GAGAAGGGCAAGACCTGCCAAGG - Intronic
931628965 2:64282623-64282645 GAGGAGAGCAGGGTCTCCCCTGG + Intergenic
931800280 2:65751278-65751300 GAGGAGGGCATGGCCTTCCTTGG + Intergenic
932487210 2:72091385-72091407 GATAAGAGCCAGGCCTGCCATGG - Intergenic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
932840853 2:75081137-75081159 AAGAAGAGCCAGGCCTGCCCTGG + Intronic
933878697 2:86646172-86646194 GATCAGAGCATGGCTTGCCTGGG - Intronic
934767235 2:96886488-96886510 GAGGAGGGGAGAGCCTGCCTGGG + Intronic
935056257 2:99570150-99570172 GGCAGGAGCAGGGCCTTCCTAGG - Intronic
936111702 2:109670575-109670597 GAGGAGAACAGCCCCTGCCTTGG - Intergenic
937253963 2:120541616-120541638 GAGCAGAGCTGGGCCAGCCAAGG + Intergenic
937258766 2:120572384-120572406 AAGATGAACAGGGCCTGTCTTGG - Intergenic
938407081 2:131038693-131038715 GACAGGAGCAGGGCTTTCCTGGG - Intronic
938421982 2:131153541-131153563 GAACTGGGCAGGGCCTGCCTGGG - Intronic
939173848 2:138726967-138726989 GAAAAGATCAGTGGCTGCCTGGG - Intronic
939234041 2:139468213-139468235 ATGAAGAGCATGACCTGCCTGGG + Intergenic
941388587 2:164883400-164883422 AAAAAGAGCAGTGGCTGCCTAGG - Intergenic
942767137 2:179470095-179470117 GAGAAAAGCATGGCCTGCGGTGG - Intronic
943091511 2:183381081-183381103 GAGGAGTTCAGGACCTGCCTAGG - Intergenic
943555953 2:189404019-189404041 AAGAAGAGCTGGGCCTGGCATGG - Intergenic
945199535 2:207267366-207267388 GATGAGAGAAGGGCTTGCCTTGG - Intergenic
946945603 2:224818691-224818713 GAAAAGAGCAGGGGCTGGCAGGG - Intronic
947575476 2:231270246-231270268 GAGGAGAGCAAGGCTTGCCGGGG - Intronic
948265295 2:236631681-236631703 TGCAAGGGCAGGGCCTGCCTGGG + Intergenic
948668086 2:239548758-239548780 GAGGCGGGCAGAGCCTGCCTTGG + Intergenic
948807579 2:240459639-240459661 GCAGAGTGCAGGGCCTGCCTGGG + Intronic
948836377 2:240628044-240628066 CAGAAGTCCAGGGCCAGCCTTGG - Intronic
1169340572 20:4793377-4793399 GAGAAGAGCATGGGCTCCCTGGG + Intronic
1170214430 20:13876675-13876697 GAGCAGAGAAGGGCCTGATTGGG + Intronic
1170569519 20:17625035-17625057 GCCAAGGCCAGGGCCTGCCTTGG + Intronic
1171208337 20:23298431-23298453 GAGGAGAGCAGGAGCTCCCTGGG - Intergenic
1171208345 20:23298465-23298487 GAGGAGAGCAGGAGCTCCCTGGG - Intergenic
1171266665 20:23776626-23776648 GAAAAGTGCAGGGCCCTCCTGGG + Intergenic
1172425452 20:34852475-34852497 GAGTGGGGCAGGGGCTGCCTGGG + Exonic
1172429366 20:34876862-34876884 GAGAAGAGTGGGGGCTCCCTGGG + Intronic
1172623176 20:36332753-36332775 GATCAGAGCTGGGCCTGCCTGGG + Intronic
1172759948 20:37314820-37314842 GGGAAGGGCAGTCCCTGCCTCGG - Intronic
1172907768 20:38381728-38381750 CACAAGTTCAGGGCCTGCCTGGG - Intergenic
1173582094 20:44154647-44154669 GAGAAAGCCCGGGCCTGCCTGGG + Intronic
1174575289 20:51532893-51532915 GAGAGAAGCAGGGCCTGGCCTGG + Intronic
1175245681 20:57580625-57580647 AAGAAGAGCAGTGGCTGCGTAGG - Intergenic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1176091292 20:63319689-63319711 TAGGAGAGCAGGACCTTCCTTGG + Intronic
1176099707 20:63359331-63359353 GGAAAGGGCAGGGCCTGGCTGGG + Intronic
1176284370 21:5011701-5011723 GAGCTGAGCAGGGTCTGCCCTGG + Intergenic
1178684109 21:34697816-34697838 GAGAACTGCGGGGCCTGCCAAGG + Intronic
1179617759 21:42593115-42593137 TCGAAGTGCAGGGCCGGCCTGGG - Intergenic
1179726048 21:43341745-43341767 GAGACGAGCAGGGGCTGGCCTGG - Intergenic
1179820738 21:43935436-43935458 GAGGAGGGCAGGGCCAGCATAGG + Intronic
1179872811 21:44251774-44251796 GAGCTGAGCAGGGTCTGCCCTGG - Intronic
1179923805 21:44521723-44521745 CAGAGGAGCAGGCCCTGCCTGGG + Intronic
1179963213 21:44783680-44783702 GGAAAGAGCAGGGATTGCCTGGG + Intronic
1180184637 21:46133398-46133420 GACTAGAGAAGGGCCTGCCCCGG + Intergenic
1180558344 22:16595510-16595532 GTGCAGAGCAGGGTCTGCGTCGG + Intergenic
1181408618 22:22702778-22702800 GCGAAGAGGAAGGCCAGCCTGGG + Intergenic
1181442398 22:22943363-22943385 TAGGAGGGGAGGGCCTGCCTGGG + Intergenic
1181727621 22:24822414-24822436 GAAAAGATCAGGGGCTGCCAGGG - Intronic
1182077185 22:27502868-27502890 GAGAACACCAGTGCCTGCTTTGG - Intergenic
1182429397 22:30291092-30291114 GGGAGGAGCAGAGCCTCCCTGGG - Intronic
1182549800 22:31094501-31094523 GCACAGAGCAGAGCCTGCCTGGG + Intronic
1182685462 22:32119659-32119681 GAGCACTGCAGGGCCAGCCTGGG - Intergenic
1183618477 22:38959272-38959294 GAGAGGAGCAGGGTCCTCCTCGG + Intronic
1183668794 22:39260055-39260077 GGGAAGGGAAGGACCTGCCTGGG - Intergenic
1183712755 22:39515350-39515372 TAGAAAAGCAGGGCCTGTCTGGG - Exonic
1183737261 22:39650899-39650921 GAGGAGAGCAGGGCCTCTGTGGG + Intronic
1184496618 22:44846031-44846053 GAGAGGAGCCAGCCCTGCCTTGG - Intronic
1184604129 22:45562584-45562606 GGGAAGGGCAGGGTGTGCCTGGG + Intronic
1184815155 22:46863294-46863316 AGGATGAGCAGGGCTTGCCTCGG + Intronic
1185224192 22:49643767-49643789 GAGAAGCCGAGGGCCTGGCTGGG - Intronic
949096195 3:88721-88743 GAGAAGAGGAAGGGATGCCTAGG + Intergenic
950114685 3:10443199-10443221 GAGGAGAGCATGGCCTGGATTGG - Intronic
950249071 3:11448859-11448881 GAGACCCCCAGGGCCTGCCTTGG - Intronic
951344006 3:21523851-21523873 GAGAAGAGGAGGGCAAGACTGGG + Intronic
953406675 3:42663287-42663309 GAGAAGAGTAGGGGCTGGGTGGG - Intronic
953930545 3:47003681-47003703 GAGATGGGGAGGGGCTGCCTAGG - Intronic
954037214 3:47857687-47857709 GTGAAGAGCAGGGCCAGGGTGGG - Intronic
954325033 3:49858945-49858967 GGGACCTGCAGGGCCTGCCTAGG + Exonic
954669147 3:52278791-52278813 GAGACGTGCAGGGCCTTCCCGGG + Intronic
954706155 3:52481679-52481701 GTGAAGAGCAGGCCCTGGATGGG + Intronic
954715178 3:52523359-52523381 GGGCAGAGCAGAGCCTGCATTGG + Intronic
955919655 3:63942154-63942176 CAGAAGAGCAGGGATTTCCTGGG + Intronic
956683499 3:71803465-71803487 AAGCAGAGCAGGGCCTCTCTGGG - Intergenic
957051963 3:75418141-75418163 GAGAAGAGCAGACACTGCCATGG - Intergenic
960536782 3:118823860-118823882 GAGAAGTCAAGGGCCTGCCTTGG - Intergenic
960613401 3:119575305-119575327 TAGAAGAGCAGGGGCTGTCAGGG + Intergenic
960820119 3:121721416-121721438 CAGGAGTGCAAGGCCTGCCTGGG + Intronic
961270661 3:125685313-125685335 GTGTAGAGCCAGGCCTGCCTTGG + Intergenic
961381638 3:126499538-126499560 GAGAAAAGCAGGGGCAGCCGTGG + Intronic
961449369 3:126995500-126995522 GACCAGAGCAGGGCTGGCCTCGG - Intronic
962937148 3:140091459-140091481 GAAAACACCAGAGCCTGCCTGGG + Intronic
966845357 3:184124857-184124879 CAGAAGTTCAGGACCTGCCTGGG - Intergenic
966906455 3:184529691-184529713 AAGAAGGGCAGGTACTGCCTGGG + Intronic
966928292 3:184659708-184659730 AAGAAGCTCAGGGCCTGGCTGGG + Intronic
967803060 3:193685602-193685624 GAGAACAGCAAGGACTGCTTGGG - Intronic
967945677 3:194802039-194802061 CAGAGGAGCAGGGGCTGCCTGGG - Intergenic
967955729 3:194876126-194876148 GAGAAGAGCGGAGCGTGCCGGGG + Intergenic
968052697 3:195666390-195666412 GAGGACAGCAGCACCTGCCTCGG + Intergenic
968301426 3:197619542-197619564 GAGGACAGCAGCACCTGCCTCGG - Intergenic
968487642 4:871605-871627 GAGGTCAGCAGGGCCTGCCTTGG + Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968809132 4:2792342-2792364 GAGAAGAGGAGGGGCTTCCTGGG - Intergenic
968930478 4:3576181-3576203 CAAAAGAGCAGGTCCTGCCCTGG - Intergenic
968935467 4:3607910-3607932 GGGAAGAGGAGGGCCAGGCTGGG + Intergenic
969183911 4:5461654-5461676 GGGGAGAGCAGGGCCAGCCCTGG - Intronic
969487404 4:7479991-7480013 GAGAAGCTCAGGGTCTGCTTAGG + Intronic
969676551 4:8617600-8617622 AAGCACAGCAGGGCCTGGCTGGG + Intronic
971729682 4:30361347-30361369 TAGAGGAGCAAGGCCAGCCTTGG + Intergenic
972168972 4:36321840-36321862 GAGTAGAGCAGAGAATGCCTTGG - Intronic
972689209 4:41380353-41380375 GAGGAGATCAAGGCCAGCCTAGG - Intronic
973762073 4:54126939-54126961 GAGAAGAGCTGGGACCTCCTGGG - Intronic
976509979 4:85897185-85897207 GCAAAGAGCAGGGCCAGGCTGGG - Intronic
979258916 4:118631452-118631474 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
980097905 4:128512241-128512263 GAGAAGAGCAAGGTCTGACAGGG - Intergenic
980792542 4:137637938-137637960 GAGAAGAGCTGTGTCAGCCTAGG - Intergenic
980843849 4:138300385-138300407 CAGAAGAGCAAGGCTAGCCTGGG - Intergenic
981615381 4:146639054-146639076 GAGAAGTGCCGGGCCAGCCGGGG - Exonic
982973320 4:162018741-162018763 CAGAAGAGCAGGAACTGACTTGG - Intronic
985578289 5:683825-683847 GAGAAGACCAGGGACCGCCAAGG - Intronic
986338346 5:6770709-6770731 GAGAAGAGCCTGCCCCGCCTGGG - Intergenic
986929076 5:12795448-12795470 TGGAAGAGCAGGGCCTGACTGGG - Intergenic
988730663 5:33969768-33969790 GAGAGGAGCAGAGCCTCCCCTGG + Intronic
990334153 5:54756013-54756035 CAGAAAATCAGGGGCTGCCTAGG + Intergenic
991367038 5:65879437-65879459 TAGTAGAGATGGGCCTGCCTCGG + Intergenic
994902232 5:105789512-105789534 GGGAAGAGCAGGGAGTGCCCTGG - Intergenic
995088368 5:108141794-108141816 GAGGAGAGCAGTGCAGGCCTGGG - Intronic
995201266 5:109427362-109427384 CAGAAGTTCAAGGCCTGCCTGGG + Intergenic
995258613 5:110075544-110075566 GAAAAGAGCAGAGCATTCCTGGG - Intergenic
995482935 5:112610701-112610723 GAGAAGAGCATTGGTTGCCTTGG + Intergenic
995526618 5:113055306-113055328 GAGATGAGGAGGGCAGGCCTGGG - Intronic
995870447 5:116738553-116738575 CTACAGAGCAGGGCCTGCCTAGG - Intergenic
996380029 5:122853694-122853716 CAGGAGTTCAGGGCCTGCCTGGG - Intronic
996535583 5:124573698-124573720 GAAAATAGAAGGGCCTGCCAAGG - Intergenic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997443590 5:133925809-133925831 GTTCAGAGCAGGCCCTGCCTTGG - Intergenic
997472755 5:134125784-134125806 GAGTAGGGCAGGGCCTGCCCGGG + Intronic
998136968 5:139679009-139679031 GAGTAGAGCAGGCCCTGCCCCGG + Intronic
998402803 5:141856667-141856689 GTGAAGAGAAAGGCCTGTCTGGG - Intronic
998781503 5:145661948-145661970 GAGATGAGCAGAGCCTGAATTGG + Intronic
999837753 5:155392729-155392751 GAGAGGAGAAGGACCTGCCTTGG - Intergenic
1001552185 5:172611060-172611082 GAGAAGACCTGGGCGTCCCTTGG + Intergenic
1001634223 5:173198250-173198272 GAGAAGAGCAAGCCCAGGCTGGG - Intergenic
1001638190 5:173227700-173227722 TAGAAGAGCAGGGCCTGGAGAGG + Intergenic
1002416662 5:179124385-179124407 GAGAAGAGCAGGGCGTGCTTAGG - Intronic
1002560150 5:180075796-180075818 AACAAGAGCAGGGCCTTCCTAGG - Intergenic
1002729500 5:181325065-181325087 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1002912619 6:1501897-1501919 GAGAAGAGAAGGGACTGACGGGG + Intergenic
1003197656 6:3929360-3929382 GAGAAGTGTAGTGCATGCCTTGG + Intergenic
1004086694 6:12456457-12456479 GAGAAGAGCAAGTCCGCCCTTGG + Intergenic
1004294905 6:14401585-14401607 GGACAGACCAGGGCCTGCCTGGG + Intergenic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006562557 6:34926245-34926267 GAGAAGGGCAGGGCCTGCTGGGG + Intronic
1006564535 6:34943607-34943629 AAGAAGATCAGTGCCTGCCATGG - Intronic
1007197463 6:40075047-40075069 GGGAACTGCAGGGCTTGCCTGGG - Intergenic
1007968048 6:46021752-46021774 GAGAAGATCAGTGGCTGCCAGGG + Intronic
1008584342 6:52935313-52935335 CAGAAGATCAGTGACTGCCTGGG + Intergenic
1009242701 6:61200522-61200544 GAGAAGAGGCGGGCCTGGATTGG + Intergenic
1009498653 6:64382990-64383012 AAGAAAGGCAAGGCCTGCCTGGG + Intronic
1010361526 6:75000693-75000715 GAGGAGATCAAGGCCAGCCTGGG + Intergenic
1012999858 6:106011426-106011448 GAGAATACCAGGACTTGCCTGGG + Intergenic
1013132172 6:107243724-107243746 GAGAAAGGCAGGTCCTGGCTGGG + Intronic
1014603333 6:123443495-123443517 AAGAAGAGCCAGGCCTGGCTGGG + Intronic
1017070655 6:150573140-150573162 GGGAGGAGCCGGTCCTGCCTGGG + Intergenic
1017558785 6:155604624-155604646 GAGAAAATCACGGCCTGCCAAGG - Intergenic
1017998940 6:159561130-159561152 AAGAAGAGCAGGGCAGGCCATGG + Intergenic
1018118680 6:160613803-160613825 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018119281 6:160619355-160619377 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018119884 6:160624901-160624923 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018120485 6:160630445-160630467 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018121081 6:160635994-160636016 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018121683 6:160641537-160641559 CAGGAGAGAAGGACCTGCCTAGG - Intronic
1018915697 6:168131151-168131173 GAGAAGAGCAGCACCTGACCGGG + Intergenic
1018937743 6:168284570-168284592 GAGAAGAGGAGGGGCTGGCTTGG + Intergenic
1019188089 6:170232687-170232709 GAAAACAGCGGGGCCTGCATGGG - Intergenic
1019277416 7:183114-183136 GAGAAGAGCAGGTTTTGTCTTGG + Intergenic
1019578753 7:1749919-1749941 CAGAAGAGAGGCGCCTGCCTTGG + Intergenic
1019600671 7:1882127-1882149 GAGATGAGGAGGGGCAGCCTTGG + Intronic
1019601654 7:1886714-1886736 CAGCAGAGCAGGGCCTGCCCAGG - Intronic
1019629143 7:2037355-2037377 CAGGAGAGCAAGGCGTGCCTGGG - Intronic
1019726868 7:2607672-2607694 GAGAAAGGCAGGGCCTGCTGGGG - Intronic
1019971948 7:4548587-4548609 GAGAGGTGCAGGGCCTATCTTGG - Intergenic
1020214762 7:6181432-6181454 GAGGGGAGCAGTGCCTGCCAAGG - Intronic
1023042380 7:36183000-36183022 CAGGTGAGCAGGGCCAGCCTGGG + Intronic
1024073820 7:45808499-45808521 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1024649513 7:51391698-51391720 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
1025175983 7:56802684-56802706 GGCAAGAGCAGGGCCTGCAGAGG + Intergenic
1025182495 7:56830567-56830589 GGTAAGAGCAGGGCCTGCAGAGG + Intergenic
1025695811 7:63773738-63773760 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1025912659 7:65840608-65840630 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1027267544 7:76502626-76502648 TAGAAGAGTAGGGCAGGCCTAGG - Intronic
1027319359 7:77002491-77002513 TAGAAGAGTAGGGCAGGCCTAGG - Intergenic
1029514547 7:101017393-101017415 GGTAAGTGCAGAGCCTGCCTGGG - Intronic
1030044424 7:105482164-105482186 GGGCAGAGCAGGGCCTGGCAGGG - Intronic
1030867666 7:114719633-114719655 GAGAAGAGCTGGACTTTCCTAGG - Intergenic
1031076241 7:117215629-117215651 AGGATGAGCAGGACCTGCCTAGG - Intronic
1032018404 7:128393668-128393690 GAGTAGAGCAGGGGCAGTCTGGG - Intronic
1032051220 7:128652186-128652208 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1032310331 7:130780325-130780347 TAGAAGAGCATGGCAAGCCTTGG + Intergenic
1032616506 7:133478104-133478126 GAAAAGAAAAGGGCCTGCTTAGG - Intronic
1033139449 7:138812346-138812368 AAGAAGAGCTGGGCCTACATTGG - Intronic
1033741876 7:144282402-144282424 GAGGAGACCAGGGCCTTCCGAGG + Intergenic
1033752025 7:144367212-144367234 GAGGAGACCAGGGCCTTCCGAGG - Exonic
1034081718 7:148284585-148284607 GAGAAGACCAGGCTCTACCTGGG - Intronic
1034639790 7:152593461-152593483 GGGAAGGTCAGGGCCTGCTTTGG + Intergenic
1035052060 7:156004723-156004745 GCGCAGAGCTGGGCCTGCTTGGG + Intergenic
1035064705 7:156096224-156096246 GAGAAGAACAGGGAGGGCCTCGG - Intergenic
1035237456 7:157508175-157508197 GAGCACCGCAGGGACTGCCTGGG + Intergenic
1035289937 7:157831426-157831448 GGGAAGAGCAGGGCAGGGCTGGG + Intronic
1035535456 8:387519-387541 GAGGAGAGCCGGGCCAGCCTCGG + Intergenic
1035719853 8:1783853-1783875 GTGAACAGCCGTGCCTGCCTTGG + Exonic
1036381378 8:8238309-8238331 GAGAAGAGCAGACACTGCCATGG + Intergenic
1036708466 8:11061940-11061962 GGGAGGAGCAGGGCCAGCCGAGG - Intronic
1036847281 8:12178683-12178705 GAGAAGAGCAGACACTGCCATGG - Intergenic
1036868646 8:12421004-12421026 GAGAAGAGCAGACACTGCCATGG - Intergenic
1037717607 8:21413037-21413059 CAGAAGACCAAGGCCTGGCTGGG + Intergenic
1038241032 8:25808016-25808038 GAGGAAAACAGGGCCTGGCTGGG + Intergenic
1038372310 8:27006537-27006559 GGGAAGAGCTGGGCCGGCCAAGG + Intergenic
1038702287 8:29859865-29859887 GAAAAGTGCAGGGCCTGACTTGG - Intergenic
1039444403 8:37619484-37619506 GAGAAGACCAAAGCCAGCCTTGG + Intergenic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1040776090 8:51044788-51044810 GAGGATAGCAGGGCCTGCAGTGG - Intergenic
1041552797 8:59119626-59119648 GAGGAGAGCACGGCCTGGCTGGG + Intergenic
1042692865 8:71522816-71522838 TAGAAGCTCAGGGCCAGCCTGGG - Intronic
1043359292 8:79452061-79452083 GAGAAGGTCAGGGACTACCTGGG + Intergenic
1043400196 8:79877073-79877095 GAGAGGACAAGGGCCTGCCTTGG - Intergenic
1045043269 8:98247698-98247720 GATGAGAGGAGGGCCTGCGTAGG + Intronic
1045846703 8:106645394-106645416 GAGAGAAGCAGGGCATGCCTAGG - Intronic
1048865726 8:138760269-138760291 CAGAAGGGCCGGGCCTGCCCTGG + Exonic
1048983543 8:139716339-139716361 CAGAAGAGCCTGGCCTGTCTGGG - Intergenic
1048987788 8:139744521-139744543 GTGCAGAGCTGGGCCTGCCTCGG - Intronic
1049018180 8:139936291-139936313 AAGAAGCGCACTGCCTGCCTCGG - Intronic
1049095744 8:140547185-140547207 AGGCAGAGCAGGGCATGCCTTGG - Intronic
1049356126 8:142189293-142189315 GAGAAGAGCAGTCCCTCCCCAGG + Intergenic
1049379368 8:142304377-142304399 GAGAAGGGCGTGGCATGCCTGGG - Intronic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049598876 8:143498079-143498101 GAGAACGGCAGGAACTGCCTGGG + Intronic
1050667428 9:7956538-7956560 GAGAAGTTCGGGGCCAGCCTGGG + Intergenic
1051218083 9:14820413-14820435 GAGAAGAGTAGGTGCTTCCTAGG - Intronic
1052140802 9:24980185-24980207 GAGAGGAGCAGTCCCTTCCTGGG + Intergenic
1054454714 9:65423946-65423968 GGGAAGAGGAGGGCCAGGCTGGG - Intergenic
1055228093 9:74025789-74025811 GAAAAGAGCAAGGCATGTCTAGG - Intergenic
1055482754 9:76725992-76726014 GAGAAGGGCAGGGGTTGCCAGGG + Intronic
1056837750 9:89971003-89971025 GAGAAGACCAGGGCTTGGCGAGG + Intergenic
1057040804 9:91846104-91846126 GAGAACAGCAGGCCTTGCCTGGG - Intronic
1057353248 9:94317342-94317364 GGGCAGAGCAGGGGCTGCCTGGG - Intergenic
1057439814 9:95074807-95074829 GGGAAGAGCAGGTGCGGCCTGGG - Intronic
1057654503 9:96940250-96940272 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1058711275 9:107681648-107681670 CAGAATACCAGGGCCTGCCAAGG - Intergenic
1059227406 9:112684925-112684947 GAGAAGAGCAGGCACTGCAGAGG - Exonic
1059411279 9:114133833-114133855 GACAGAAGAAGGGCCTGCCTGGG + Intergenic
1060055588 9:120410113-120410135 GAGAATAATAGTGCCTGCCTTGG - Intronic
1060735091 9:126061681-126061703 GAGCAGAGCAGCGTGTGCCTAGG + Intergenic
1060750143 9:126163390-126163412 GAGCAGACCAGGCTCTGCCTGGG - Intergenic
1060786220 9:126453363-126453385 GAGCAGACCAGGGCCTGGCTGGG + Intronic
1060828615 9:126700320-126700342 CAGATGAGCAGGGCCTGGCAGGG + Exonic
1061669419 9:132180305-132180327 CAGCAGAGGATGGCCTGCCTTGG - Intronic
1061669961 9:132183082-132183104 GAGAATTCCATGGCCTGCCTCGG + Intronic
1061930347 9:133829132-133829154 GGGAAGCGCAGTGCCTGCCAAGG + Intronic
1062283130 9:135760676-135760698 GAGAAGAGCCAGGCCTGGCCTGG - Intronic
1062677454 9:137755262-137755284 GAGCAGACCAGGGGCTGCCTGGG - Intronic
1203577471 Un_KI270745v1:20334-20356 GGCAAGAGCAGGGCCTGCAGAGG - Intergenic
1187313112 X:18165822-18165844 TAGAAGAGCAGGGCTGCCCTCGG + Intronic
1188486068 X:30683878-30683900 GAGAAGCCCAAGGCCTGCTTTGG - Intronic
1190233867 X:48601493-48601515 GAGAACCATAGGGCCTGCCTAGG - Intronic
1190533910 X:51407603-51407625 TAGGAGTGCAGGGCCTGGCTGGG - Exonic
1190533936 X:51407735-51407757 TGGAAAAGCAGGGCCTGGCTGGG - Exonic
1192196486 X:69032145-69032167 GAGAAGGGAAGGGCCTTGCTTGG - Intergenic
1192556283 X:72092208-72092230 GTGAAGAGCAGTGGCTGCCAGGG - Intergenic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic
1193696146 X:84709207-84709229 CAGAAGAGCAGGCCCTGCAAGGG + Intergenic
1196562354 X:117165524-117165546 GAGAAGAGCAGGGTGTGCTATGG + Intergenic
1197989539 X:132302884-132302906 GAAAAGATCAGGGCCAGGCTGGG - Intergenic
1198518155 X:137428572-137428594 GAAGCCAGCAGGGCCTGCCTGGG + Intergenic
1199826206 X:151503151-151503173 GAGAAGAGTAGGGCCAGGTTTGG + Intergenic
1199979046 X:152911071-152911093 GGGAGGAGCAGGGCTTGCCTGGG + Intergenic
1200212630 X:154353563-154353585 GAGCAGTGAAGGGGCTGCCTGGG + Exonic
1202019203 Y:20447879-20447901 GAGAAGAGCAGCACCAGTCTCGG + Intergenic