ID: 904496690

View in Genome Browser
Species Human (GRCh38)
Location 1:30891228-30891250
Sequence CCATGGGGACAGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 676}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904496690_904496703 15 Left 904496690 1:30891228-30891250 CCATCTGCCCTCTGTCCCCATGG 0: 1
1: 0
2: 7
3: 89
4: 676
Right 904496703 1:30891266-30891288 CTGAGGACAGGTGCCTCTTCAGG 0: 1
1: 0
2: 3
3: 17
4: 196
904496690_904496699 -2 Left 904496690 1:30891228-30891250 CCATCTGCCCTCTGTCCCCATGG 0: 1
1: 0
2: 7
3: 89
4: 676
Right 904496699 1:30891249-30891271 GGCTGTCTAGGGCAACCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
904496690_904496700 3 Left 904496690 1:30891228-30891250 CCATCTGCCCTCTGTCCCCATGG 0: 1
1: 0
2: 7
3: 89
4: 676
Right 904496700 1:30891254-30891276 TCTAGGGCAACCCTGAGGACAGG 0: 1
1: 0
2: 2
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904496690 Original CRISPR CCATGGGGACAGAGGGCAGA TGG (reversed) Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900582432 1:3415721-3415743 CCGTGGGGGCAGCGGGCAGGAGG - Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900864828 1:5260780-5260802 CCAAGGAGACAGGGGGCAAATGG - Intergenic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
902096068 1:13947044-13947066 CCATGGGGGCAGAGATCAGAGGG - Intergenic
902434742 1:16391175-16391197 CCATGGGGCTAGAAGGGAGATGG + Intronic
902455638 1:16532159-16532181 CCATGAGGACAGACAGCAGAAGG - Intergenic
902496535 1:16875756-16875778 CCATGAGGACAGACAGCAGAAGG + Intronic
902526836 1:17064350-17064372 CCATCTTGACAGTGGGCAGAGGG + Intergenic
902920975 1:19665735-19665757 CCATGAGGACCGAGGGTGGACGG - Exonic
903020060 1:20387326-20387348 CCAAGGGGGATGAGGGCAGAAGG + Intergenic
903217265 1:21850191-21850213 TGCTGGGGACAGAGGGCAAAGGG + Exonic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903501249 1:23801057-23801079 CCGAGGGGGCAGGGGGCAGAGGG + Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905125688 1:35714729-35714751 GGATGGGGACAGAGGACATAGGG - Exonic
905690307 1:39937774-39937796 CCAAGGGGATAGAATGCAGAGGG + Intergenic
905766349 1:40604819-40604841 CCATGGGGATAGGGTGCAGTTGG - Intergenic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
905884376 1:41484016-41484038 CCATGGGGATTGGGGGCAGGGGG - Intronic
906844896 1:49181232-49181254 CCATGGGAACAGAGTGTACAAGG - Intronic
906871293 1:49484562-49484584 TCATGGAGACAGAGAGTAGAAGG + Intronic
906906426 1:49898933-49898955 TCATGGAGACAGAGAGTAGAAGG + Intronic
907283847 1:53367948-53367970 ACTTGGGGACAGAGGGCATGGGG - Intergenic
907306247 1:53514644-53514666 CCATGGGCAGAGGGGACAGATGG + Exonic
907324743 1:53629623-53629645 CCATGGGCAGAGGGGACAGAAGG - Intronic
907406519 1:54256949-54256971 CCATGGGCACAGCGGGGACATGG + Intronic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
908680427 1:66654874-66654896 CAACAGAGACAGAGGGCAGATGG + Intronic
908960447 1:69691127-69691149 CCATGGGGAAGCAGGTCAGAGGG + Intronic
909362582 1:74781027-74781049 GTAGGGGGTCAGAGGGCAGATGG + Intergenic
911267870 1:95764276-95764298 ACATGGAGACAGAGAGTAGAAGG + Intergenic
915123790 1:153649327-153649349 CCATGGGGGATGTGGGCAGATGG + Intergenic
915322126 1:155061939-155061961 CCACCGGGTCAGCGGGCAGAGGG - Exonic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916380286 1:164202327-164202349 TCATGGTGACAGAGAACAGAAGG + Intergenic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
916670688 1:167016944-167016966 CCATGGAGATAGAGAGTAGAAGG + Intronic
916679368 1:167090179-167090201 ACATGGGGACCTAGGGCTGAAGG - Intronic
916729734 1:167555121-167555143 TCATGGAGACAGAGAGTAGAGGG - Intergenic
916817921 1:168371534-168371556 CCATGGAGACAGAGTCCAGCTGG - Intergenic
917802347 1:178581997-178582019 TCAAGGGGCCAGAGAGCAGATGG - Intergenic
918227939 1:182503536-182503558 CCATGGAGAAAGAGAGTAGAAGG + Intronic
919204423 1:194403123-194403145 TCTTGGAGACAGAGAGCAGAAGG + Intergenic
919513648 1:198495036-198495058 CCTCAGGGACAGAGGGCACAGGG + Intergenic
919878680 1:201888667-201888689 CCATGGGCACTGCGGGCAGTTGG - Intronic
919937654 1:202265252-202265274 CCATGGTGACAGAGAGCATGGGG - Intronic
920495116 1:206449001-206449023 CCATGGGGAAAGAGGCTTGAGGG + Intronic
920550172 1:206854047-206854069 CCATGGAGATAGAGAGTAGAAGG + Intergenic
920695407 1:208178303-208178325 GCATGGGGACAGTGTGCACAGGG + Intronic
921241613 1:213189830-213189852 TCATGGAGACAGAGAGTAGAAGG - Intronic
921670131 1:217916019-217916041 CCATGGGGCCAGATGGCATGGGG - Intergenic
922215442 1:223516282-223516304 CTATGGGGACAAAGAACAGATGG - Intergenic
922739211 1:228006357-228006379 CAATGGGGACAGCGGCCAGGTGG - Intergenic
923392766 1:233530371-233530393 CTATAGGGACATAGGCCAGAAGG - Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
923669286 1:236026172-236026194 GCAGGGAGACAGAGGGAAGATGG + Intronic
924279519 1:242422203-242422225 CCATGAGGAGGGAGGGCAGGAGG + Intronic
924515570 1:244762635-244762657 TCATGGAGATAGAGGGTAGAAGG - Intergenic
924750733 1:246886646-246886668 CCATGGACACAGAGGGCCGATGG + Intronic
924789647 1:247233404-247233426 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1062836661 10:640301-640323 CGATGGGGTCACACGGCAGATGG + Intronic
1062978529 10:1702661-1702683 CCCTGGGGAATGGGGGCAGAAGG - Intronic
1063204826 10:3820919-3820941 CCATGGAGGCAGAGGACAGCAGG - Intergenic
1063447729 10:6130168-6130190 CCATGGGGAAGGTGAGCAGAGGG + Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064501456 10:15977819-15977841 CCATGGGATCAGAGGAGAGAAGG - Intergenic
1065876927 10:30005220-30005242 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1065891812 10:30127677-30127699 CCATTTGGAGAGATGGCAGAGGG + Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067790497 10:49283996-49284018 TTATGGGGACACAGGGCAGTGGG + Intergenic
1067977078 10:51038509-51038531 TCATGGAGATAGAGGGTAGAAGG - Intronic
1068032283 10:51718734-51718756 CCATAGAGACAGAGAGTAGAAGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068447654 10:57143562-57143584 CAATAGGGGCAGAGGCCAGACGG - Intergenic
1068503282 10:57867007-57867029 CCATGGAGATTGAGGTCAGAAGG + Intergenic
1069680748 10:70283730-70283752 CCTTCGGGCCAGCGGGCAGAGGG + Intergenic
1069852806 10:71421274-71421296 ACATGGTGGCAGAAGGCAGAGGG - Intronic
1070483013 10:76903591-76903613 ACACGGAGACAGAGGGCACATGG - Intronic
1070490730 10:76973949-76973971 CACTGGGGAAACAGGGCAGAGGG - Intronic
1070828940 10:79407026-79407048 GCAAGGGGACAGAGACCAGAAGG - Intronic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071462825 10:85914573-85914595 CCATGTCCACAGAGGGCAGCTGG - Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1072634082 10:97166010-97166032 CCAAGGAGACAGATGGCAGAGGG - Intronic
1072920290 10:99571139-99571161 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073106540 10:101035569-101035591 CCATCCGGACACAGGGGAGAAGG + Exonic
1074446648 10:113526108-113526130 CCATGGGGAGAAAGGGGACAGGG + Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075087296 10:119422160-119422182 CCCTGGGAACAGCTGGCAGAGGG + Intronic
1075719149 10:124574876-124574898 CCCTGGGGAGAGAGTGGAGAAGG - Intronic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076338829 10:129728742-129728764 CCAGGGGGACAGAGAACAGGGGG - Intronic
1076402476 10:130193091-130193113 CCATGGGGACTGTGGGCAGATGG - Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076549324 10:131267746-131267768 CCTTGGGGACATGGGGCACAGGG + Intronic
1076704414 10:132293467-132293489 TCATGGGGACACAGGGCAGGCGG + Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077037259 11:501402-501424 CTAAGGAGACAGAGGGCTGAGGG + Intronic
1077192789 11:1262421-1262443 CCCAGGGGACAGGGGGCAGGGGG + Intergenic
1078121436 11:8513995-8514017 TCATGGAGATAGAGGGTAGAAGG - Intronic
1078612130 11:12830040-12830062 GCATGGACACAGAGGCCAGAAGG + Intronic
1079203748 11:18396138-18396160 GCATCGGGCCAGAAGGCAGAAGG - Intronic
1079242156 11:18728797-18728819 CCAGGCTGACAGAGGACAGAGGG + Exonic
1080099904 11:28447998-28448020 GCATGGGGACAGAGTGGAGGGGG - Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1082711879 11:56562145-56562167 ACATGGCGACAGAGGAGAGAGGG - Intergenic
1083266120 11:61547647-61547669 GGAGGGGGACAGAGGGGAGAAGG + Intronic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083533290 11:63445027-63445049 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1083658774 11:64242452-64242474 CCACGGGGGCCGAGGGCAAAAGG + Exonic
1083708846 11:64535005-64535027 CTTTGGGGACAGCAGGCAGAAGG + Intergenic
1083811608 11:65109677-65109699 CCAAGGAGGCAGAGGACAGAGGG - Intronic
1083855248 11:65390027-65390049 CCTTGGGGACAGGGAGGAGAAGG + Intronic
1084109422 11:67004029-67004051 CCATGGGGGCAACGGGCAGTGGG + Intergenic
1084197188 11:67530135-67530157 CCATGGAGCCAGAGGGCTGTGGG + Intergenic
1084318178 11:68357875-68357897 CCCTGGGGACAAAGGGGAAAGGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084958631 11:72704441-72704463 CCATTGGGAAAGTGGGCAGATGG - Intronic
1085122656 11:73977029-73977051 CCATGGGGTCAGTGGCCAGCGGG + Intronic
1085297457 11:75439122-75439144 CCGTGGGAACAGGGAGCAGAGGG + Intronic
1085412092 11:76297397-76297419 CCATGGGGCCAGCGGGCACTGGG - Intergenic
1085460593 11:76690675-76690697 TCTAGGGGACAGAGGACAGAGGG + Intergenic
1085804119 11:79618940-79618962 CCAAGGGCAGACAGGGCAGAAGG - Intergenic
1086135359 11:83438819-83438841 CCAAGGCTACAGAAGGCAGAGGG - Intergenic
1086673185 11:89571845-89571867 CCTTGTGGACAAAGGACAGACGG + Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087076802 11:94133263-94133285 TGTTGGGGACAGAGAGCAGAAGG + Intronic
1087416768 11:97866523-97866545 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1089198664 11:116710465-116710487 CCATGGGGACACGGGGCAGGGGG + Intergenic
1089281019 11:117374553-117374575 CCATGGGCTTAGAAGGCAGATGG + Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089499175 11:118922682-118922704 CGATGGGGGGAGGGGGCAGAAGG - Intronic
1089619598 11:119714647-119714669 CGATGGGGAGAGAGGGGACAGGG - Intronic
1090125141 11:124076408-124076430 CCTTGGGGACACAGGACATAGGG + Intergenic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090676353 11:129000806-129000828 TCATGGAGACAGAGAGTAGAAGG - Intronic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091391712 12:130009-130031 CCATGGGCACAGAGAGCACCAGG + Intronic
1091450631 12:570201-570223 CCGAGGGGACGGCGGGCAGAAGG + Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091750710 12:3019800-3019822 CCTGGGGGACAGAAGGCAGCAGG - Intronic
1093620972 12:21288473-21288495 TCATGGAGATAGAGAGCAGAAGG + Intronic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1094186499 12:27648808-27648830 CCATGGAGATAGAGAGTAGAGGG + Intronic
1095416226 12:41979707-41979729 CCATGGCAACAGAAAGCAGACGG + Intergenic
1095815305 12:46415497-46415519 TCATGGAAACAGAGAGCAGAAGG - Intergenic
1096025112 12:48353562-48353584 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1099293741 12:80804400-80804422 CCATGGAGATAGAGGGTAGAAGG - Intronic
1099763688 12:86954395-86954417 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101414819 12:104499816-104499838 CCATGGCCACAGGGGGCAGAAGG - Intronic
1101560972 12:105857709-105857731 CCACGGGCACAGAGGGCACCAGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102124518 12:110469171-110469193 TGTTGTGGACAGAGGGCAGAGGG + Intronic
1102250924 12:111387050-111387072 CCATAGAGACAGAGAGCAGATGG - Intergenic
1102262029 12:111448734-111448756 CCATGTGGACTGACGGTAGATGG - Exonic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103962046 12:124615127-124615149 TCATGGGGACAGAGTTCAGCTGG - Intergenic
1104034946 12:125091659-125091681 CTATGGGGAAAGAAGCCAGAAGG + Intronic
1104188367 12:126454474-126454496 CCATGGGGTCAGAGGAAGGATGG - Intergenic
1104964769 12:132503959-132503981 CCATGGGGGCAGGGGGCTGAGGG - Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105854742 13:24363378-24363400 CCAAGGGGAGAGAGCGCAGGGGG + Intergenic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106471617 13:30060968-30060990 GGCTGGGGACAGAGGACAGAGGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106916392 13:34520059-34520081 CCCTGGAGACAGAGGGATGAAGG + Intergenic
1107608749 13:42090820-42090842 CCATGGGGACAGAGCCCCCATGG + Intronic
1110491799 13:76118306-76118328 GCTTGGGGACAGAGCGGAGAGGG - Intergenic
1111916317 13:94364458-94364480 CCATGGGGACATATGGCATTGGG - Intronic
1113549996 13:111185322-111185344 CCCTGGGGACAGGACGCAGATGG - Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114522322 14:23347283-23347305 CCATGGGAACAGAGAGCCAAGGG - Intronic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1115114393 14:29862058-29862080 CCATGGGGATACAGAGTAGAAGG - Intronic
1115949292 14:38701718-38701740 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1116043456 14:39714318-39714340 CCATGGGGATAGAGGGATGTGGG + Intergenic
1117033813 14:51705719-51705741 TGATGGGGAAAGAAGGCAGATGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117548688 14:56812611-56812633 CCTTGGGGACAGTGGGCATGGGG + Intergenic
1117737009 14:58777728-58777750 CCATGGGGTCAGAGGGCAAGGGG + Intergenic
1118321043 14:64753595-64753617 CCATGGGCAGAGTGTGCAGATGG - Exonic
1118765468 14:68906692-68906714 GAATAGGGACAGAGGGCTGAGGG - Intronic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119430722 14:74566741-74566763 CCTTGGGGACACGGGGGAGAGGG - Intronic
1119505288 14:75167466-75167488 GCATGAGGACAGAGAGGAGAGGG - Intronic
1119613462 14:76082947-76082969 CCACAGGGACAGAGGGGAGTGGG - Intronic
1120109142 14:80532541-80532563 ATATGGAGACAGAGGGCTGAGGG + Intronic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1120984682 14:90324204-90324226 CCATTGGGACTGAGGGGAAATGG + Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121597610 14:95177660-95177682 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1121619838 14:95338456-95338478 TCATGGAAACACAGGGCAGAGGG + Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122029682 14:98903101-98903123 CCATGGAGACAGGGGACACAAGG - Intergenic
1122074667 14:99228456-99228478 ACATGGTGGCAGAGGGCAGGAGG + Intronic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122631404 14:103109261-103109283 ACATGGGGACAGGGTGGAGAGGG - Intronic
1122631502 14:103109514-103109536 ACATGGGGACAGGGTGGAGAGGG - Intronic
1122696787 14:103558167-103558189 CGGTGGGGTCAGAGGGCAGTCGG - Intronic
1122929194 14:104925721-104925743 CCCTGGGGACAGTGGGGACACGG + Intronic
1122930649 14:104931754-104931776 CCCTGGGGACAGAGTGCTGGTGG - Exonic
1123043662 14:105500835-105500857 CTATGGGGACAGAGGGGATGGGG - Intergenic
1123469517 15:20539729-20539751 TCCTGGGGACAGAGGGCCCAAGG - Intronic
1123632904 15:22274521-22274543 CCAAGGGGGCAGTGGGCACAAGG - Intergenic
1123648545 15:22460970-22460992 TCCTGGGGACAGAGGGCCCAAGG + Intronic
1123729795 15:23134715-23134737 TCCTGGGGACAGAGGGCCCAAGG - Intronic
1123747963 15:23332197-23332219 TCCTGGGGACAGAGGGCCCAAGG - Intergenic
1124073221 15:26415028-26415050 TCATGGGGATAGAGTGTAGAAGG + Intergenic
1124142523 15:27089321-27089343 CCATGGGGACTGCAGGCAGCAGG - Intronic
1124280330 15:28356049-28356071 TCCTGGGGACAGAGGGCCCAAGG - Intergenic
1124302368 15:28555563-28555585 TCCTGGGGACAGAGGGCCCAAGG + Intergenic
1124422116 15:29531514-29531536 CCATGGGGACGGAAGGCAAAAGG + Intronic
1125725830 15:41867696-41867718 CCATGGGCACAGACTGCAGCTGG - Intronic
1125731556 15:41895140-41895162 CCAGGGGCAGTGAGGGCAGAAGG - Intergenic
1125766620 15:42140791-42140813 CCCCTGGGACAGGGGGCAGAAGG + Exonic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126123822 15:45277617-45277639 CCATAGAGACAGAAGGGAGATGG + Exonic
1126599540 15:50415142-50415164 AAATGGTGACAGAGGGAAGAGGG - Intergenic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1127672756 15:61211666-61211688 TGATGGCCACAGAGGGCAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127833223 15:62769229-62769251 TCATCGGGACAGAGGGCTTAGGG - Intronic
1127837533 15:62802146-62802168 TCATGGAGATAGAGGGTAGAAGG - Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128342896 15:66835064-66835086 CCATGGGAACACAGGGGAGCCGG + Intergenic
1128355805 15:66925604-66925626 CCAGGGAGAGAGTGGGCAGAGGG - Intergenic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1128998137 15:72311916-72311938 GCTTGGGTAGAGAGGGCAGATGG - Intronic
1129661325 15:77554628-77554650 CCTTGGGGAGCGAGCGCAGAAGG + Intergenic
1129712362 15:77826785-77826807 GAATGGGGAGAGGGGGCAGATGG - Intergenic
1129773602 15:78218483-78218505 CAGTGGGGACACAGAGCAGAAGG + Intronic
1129946749 15:79545142-79545164 TCATGGGAACAGAGAGGAGAGGG + Intergenic
1131400344 15:92120440-92120462 GCAGGGAGACAGAAGGCAGATGG - Intronic
1131528122 15:93168294-93168316 CTATAGGGACAGAGAACAGATGG - Intergenic
1132387116 15:101408474-101408496 CCAGGGAGACACAGGGCAGAAGG + Intronic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132619178 16:856273-856295 GCATGGGGACTGAGGCCAGGTGG + Intronic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1132973891 16:2702056-2702078 CCAGGGGGACGGAGCACAGACGG - Intronic
1133201975 16:4209315-4209337 GCCTGGGGGCAGGGGGCAGAGGG - Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133266592 16:4588274-4588296 CCATGAGGACAGCTGGAAGAAGG + Exonic
1133344227 16:5059599-5059621 CCATGGGCAAAGTGGGCAGCCGG - Intronic
1133699240 16:8293805-8293827 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1135107758 16:19665360-19665382 CCATGGAGACAGAGAGTAGAAGG - Intronic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135869808 16:26138843-26138865 TCCTGGAGAAAGAGGGCAGAGGG + Intergenic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1136358627 16:29763073-29763095 CCACAGGGACAGAAAGCAGATGG - Intergenic
1137273743 16:46919764-46919786 GGATGGGGACAGAGGCCAGGAGG + Intronic
1137851178 16:51745423-51745445 TCATGGAGATAGAGGGTAGACGG + Intergenic
1138110759 16:54321951-54321973 TCATGGGGACAGAAAGTAGAGGG + Intergenic
1138350716 16:56344979-56345001 CCCTGGGGACAGAGGACAGCAGG + Exonic
1138510177 16:57504096-57504118 CCCTTGGGACTGAGGGCAGAGGG + Intergenic
1138695746 16:58811563-58811585 CCATGGGGACAGAGCCCACATGG + Intergenic
1139341020 16:66267856-66267878 CCAAGGGGAGAGGGGACAGAAGG + Intergenic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139506145 16:67399028-67399050 CTATGGGCTCAGAGGGCTGAGGG + Intronic
1140449780 16:75061333-75061355 TCATGGACACAGAGGGTAGAAGG - Intronic
1141056197 16:80816937-80816959 CCTTGGGGACAGTGGGTAGGAGG - Intergenic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141834663 16:86530795-86530817 CCAAGGACACAGAGGGCCGAGGG + Exonic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142207272 16:88789841-88789863 CTATGGAGACAGACAGCAGAGGG + Intergenic
1142212264 16:88813840-88813862 CCTTGTGGACAAAGGACAGACGG + Exonic
1142212744 16:88816228-88816250 CCATGGAGACAGTGGGCACAGGG - Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142750625 17:1985361-1985383 CCCTGGGGACAGAGAGTAGGAGG - Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143622897 17:8091200-8091222 CCCTGGGGACACAGGGCAAAGGG - Intergenic
1143712623 17:8744887-8744909 CAATGGGGGCAGGGGGCAGGGGG - Intronic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144322869 17:14147460-14147482 CCATGGAGATAGAGAGTAGAAGG + Intronic
1144449501 17:15364439-15364461 CCATGGTGACACTGGGGAGAGGG - Intergenic
1144753985 17:17668509-17668531 GCATGGGGGCAGAGAGCAGGAGG - Intergenic
1145995983 17:29105283-29105305 CCATGGGCAGTGAGGGCAGCAGG + Intronic
1146449950 17:32964990-32965012 CCAAGGGGACAAAGGAAAGAGGG + Intergenic
1146517209 17:33498561-33498583 CCTGGGGGAAAGAGTGCAGAGGG + Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1146657851 17:34645524-34645546 GGAAGGGGAGAGAGGGCAGAAGG + Intergenic
1146705332 17:34997041-34997063 CCCTGGGGGCATAAGGCAGATGG + Intronic
1146944217 17:36863175-36863197 CCTTGGGAACAGGGTGCAGAGGG - Intergenic
1147254636 17:39174570-39174592 CCATGGCCACGGAGGGTAGAGGG + Exonic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147965800 17:44193626-44193648 CCATGGGGACTGAGGGGAAAGGG + Exonic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150575481 17:66426861-66426883 CCATGAGGAAAGCTGGCAGAAGG + Intronic
1151128865 17:71875186-71875208 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1151567151 17:74905038-74905060 ACATGGGGACAGAAGGCAGCGGG + Intergenic
1152070238 17:78130697-78130719 CCATGGGGTGAGAGGGGAGGAGG + Intronic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152736491 17:81999897-81999919 CCAGGGGGACAGAAAACAGAGGG - Intronic
1152937999 17:83151923-83151945 GCAGGGAGACAGTGGGCAGAAGG + Intergenic
1155040876 18:22064780-22064802 CCAAGGTGTCAGAGGGAAGAAGG + Intergenic
1155417050 18:25610136-25610158 ACATGGGGACAGAGGGTGTATGG + Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157298364 18:46462096-46462118 CCCTGGGGACTGTGGGCAGGAGG + Exonic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157809548 18:50684857-50684879 CCATAGGGATTGAGGCCAGAGGG + Intronic
1157851827 18:51061384-51061406 CCATAGAGACAGAGAGTAGAAGG - Intronic
1158023586 18:52870294-52870316 CCTTGGGGACATGGGGCACAGGG + Intronic
1158660189 18:59380277-59380299 CCATAGAGACAGAATGCAGATGG + Intergenic
1158765058 18:60440928-60440950 CAATGGGGACAGAGATTAGAAGG - Intergenic
1158841743 18:61395125-61395147 GCCAGGGGACAGAGAGCAGAGGG - Intronic
1158890371 18:61866598-61866620 TGATGGAGATAGAGGGCAGATGG - Intronic
1159148939 18:64494993-64495015 CCAGGTGGACAGAGAGCTGAGGG + Intergenic
1159875151 18:73802819-73802841 CCATGGGAACAGGTGGCAGCAGG + Intergenic
1160124294 18:76156141-76156163 GCTCGGGGAGAGAGGGCAGAGGG - Intergenic
1160383642 18:78479720-78479742 CCGAGGGCACAGTGGGCAGAGGG - Intergenic
1160471586 18:79139852-79139874 TCATGGAGACAGAGAGTAGAAGG - Intronic
1160497672 18:79384643-79384665 CCATGGAGACAGACAGCAGGTGG + Intergenic
1160538371 18:79607315-79607337 CCATGGGGCCAGAGGGACGGAGG + Intergenic
1160605756 18:80048542-80048564 CCATGAGGACAGAGACCAGAAGG + Intronic
1160907473 19:1458232-1458254 TCATGGGGACAGAGGGCCCAGGG - Intronic
1160963743 19:1736522-1736544 CCATGTGGACAGAGTCGAGAGGG + Intergenic
1161008257 19:1947384-1947406 TCCTGGGGACAGAGGTCAGATGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161384575 19:3984106-3984128 GCCTGGGTACAGAGGGCACAGGG + Intronic
1161509043 19:4660563-4660585 CCATGGGGACAGGGAGGAGAGGG - Intronic
1161855661 19:6763557-6763579 CTATTGGGACAGGTGGCAGAGGG - Intronic
1162341063 19:10091827-10091849 CCATGGGGGCAGAGGCCATGGGG - Intronic
1162855581 19:13465955-13465977 CCATAGAGACAGAATGCAGATGG + Intronic
1162856913 19:13475763-13475785 CAATGGAGGCAGGGGGCAGAAGG + Intronic
1163054215 19:14706185-14706207 CCCTGGACACAGAGGCCAGAGGG + Intronic
1163303722 19:16463973-16463995 CCAGGGGGCCACAGAGCAGAGGG + Intronic
1163374704 19:16923017-16923039 GCCTGGGGACAGAGGGCTGTGGG - Intronic
1163389523 19:17021906-17021928 CCCTGGGGATTTAGGGCAGAAGG + Intronic
1163429733 19:17260067-17260089 CCTTGGGGAGAGAGGGCTGGTGG - Intronic
1163845443 19:19635806-19635828 CCAAGGGGTCAGAGGTCAGGAGG + Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165479883 19:36056360-36056382 CCTTGGTGACAGAGAGCACATGG - Intronic
1165825752 19:38704901-38704923 GGAAGGGGGCAGAGGGCAGAAGG - Intronic
1166110962 19:40622680-40622702 TGATGGGGACACAGGGCTGAGGG + Intronic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1166765685 19:45251350-45251372 CCATGGGGGCGGCGGGCAGGCGG - Exonic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167291462 19:48627472-48627494 ACATGGGGACAAAGGGCATTTGG + Intronic
1167368532 19:49066946-49066968 GCAAGGGGGAAGAGGGCAGATGG - Intergenic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1167842783 19:52135608-52135630 CCACGGGGAGAGTGGGCAGCTGG - Intronic
1202706525 1_KI270713v1_random:28508-28530 CCATGAGGACAGACAGCAGAAGG - Intergenic
925263515 2:2548023-2548045 ACAGGGGGACAGAGAGAAGATGG - Intergenic
925348648 2:3187108-3187130 ACATGGGGACAGATGCCACAGGG - Intergenic
925457067 2:4024788-4024810 GCATGGGGGCAGAGGGCAGTGGG - Intergenic
926041429 2:9676305-9676327 CCATTGAGGCAGAGGGCAGGTGG - Intergenic
926060450 2:9801558-9801580 ACATGGGGATCTAGGGCAGAGGG + Intergenic
926895379 2:17681604-17681626 CCAAGGGGACAGAGAGATGAGGG + Intronic
927721744 2:25387569-25387591 CCCTAGGTAGAGAGGGCAGAGGG - Intronic
927934056 2:27065313-27065335 CCAGGGGGACAGATGGTAAATGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929498768 2:42471452-42471474 CCATGGAGATAGATAGCAGATGG + Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930086868 2:47503827-47503849 CCATGGGGAGAGAGGGCTCCTGG - Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930564472 2:53002167-53002189 TCATGGAGACAGAGAGTAGAAGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931765864 2:65455972-65455994 CCATGTAGACAGACCGCAGAGGG - Intergenic
932054951 2:68433784-68433806 TCTTGGGGACACAGGGCACAAGG + Intergenic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932469674 2:71945598-71945620 CCATGAGGACAGAGAGCAGGAGG + Intergenic
933811846 2:86037442-86037464 CCATAAGGTGAGAGGGCAGAGGG + Intronic
933846881 2:86333988-86334010 CCCTGGGGACGGAGGTCAGCAGG - Intronic
934969132 2:98748936-98748958 TCATGGAGAAAGAGGGCACAGGG - Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935442542 2:103118390-103118412 TCATGGAGATAGAGAGCAGAAGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936121822 2:109752904-109752926 TCATGGAGACAGAGAGCAGAAGG - Intergenic
936222873 2:110618568-110618590 TCATGGAGACAGAGAGCAGAAGG + Intergenic
936235977 2:110743092-110743114 CCATGGAGACAGAAAGTAGATGG - Intronic
936555475 2:113494234-113494256 ACTTGGGAACAGAGAGCAGAAGG - Intronic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
938252700 2:129827874-129827896 CCCTGAGGACAGAGCGCTGAGGG + Intergenic
939086417 2:137724176-137724198 CCATGGAGATAGAGAGTAGAAGG + Intergenic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940104971 2:150089164-150089186 CCATGGGGACAGAGAGCTTGGGG + Intergenic
940314456 2:152312794-152312816 TCATGGAGATAGAGAGCAGAAGG - Intergenic
940412768 2:153385497-153385519 TCATGGGGATAGAGAGTAGAAGG + Intergenic
940432934 2:153615056-153615078 TCATGGAGATAGAGGGTAGAAGG - Intergenic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
942733532 2:179083986-179084008 CCATGGAGATAGAGAGTAGAAGG - Intergenic
943430057 2:187788591-187788613 TCATGGAGACAGAGAGTAGAGGG + Intergenic
943528083 2:189043195-189043217 CCGAGGTGACAGAGGTCAGAAGG - Exonic
943676615 2:190721824-190721846 CCATGGGGACAAAGTTCAGGGGG + Intergenic
943858391 2:192828317-192828339 CCATGGGCACAGTGGACAGCAGG + Intergenic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
944666920 2:201966561-201966583 CTATGGTGACAGAAGTCAGAAGG - Intergenic
944751098 2:202710743-202710765 TCATGGAGACAGAGAGTAGAAGG - Intronic
946145049 2:217724296-217724318 CCATAGGGACAGAGCTCAGTTGG - Intronic
946403761 2:219482412-219482434 ACATGGAGACAGAGGGGAGCTGG + Intronic
947932209 2:233973439-233973461 CCATGAGGACAGGGATCAGAGGG - Intronic
947996191 2:234529759-234529781 GCAGGAGGACAGAGTGCAGAGGG + Intergenic
948381645 2:237554370-237554392 CCAGTGGGGCAGAGGACAGAGGG + Exonic
948640065 2:239370090-239370112 TCCCGGGGACACAGGGCAGACGG - Intronic
948753700 2:240146574-240146596 GGATGGGGACACAGGGCAGAGGG + Intergenic
948883456 2:240871680-240871702 CCCTGGGGACAGAGGTCAGTGGG - Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169068210 20:2706362-2706384 TGATGGGGACGGAGGGCATAGGG - Intronic
1169203483 20:3727377-3727399 AGATGGGGGCAGTGGGCAGAGGG + Intergenic
1169668237 20:8064184-8064206 GGATTGGGGCAGAGGGCAGAAGG + Intergenic
1170372999 20:15669809-15669831 CCAGGGGCACAAAGGGCAGGTGG + Intronic
1171248501 20:23632122-23632144 CCATGGGGCCACCGGGCGGAGGG + Intronic
1171995915 20:31731218-31731240 TGATGGGGACAGGGAGCAGAAGG + Intergenic
1172117498 20:32581560-32581582 CCCTGGGGACAGAGGCTATATGG + Intronic
1172266048 20:33615205-33615227 CCATGGACACAGAATGCAGATGG - Intronic
1172782921 20:37447821-37447843 ACATGGACACAGAGGGCTGATGG - Intergenic
1173362188 20:42354850-42354872 CCTTGAGGAGAGAGGTCAGACGG + Intronic
1173439937 20:43067276-43067298 CCATAGAGACAGAACGCAGACGG + Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1175259035 20:57663431-57663453 GCAGGGGGACAGTGGGCAGCAGG + Intronic
1175585480 20:60135987-60136009 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1175698988 20:61123753-61123775 CCATGGGCACAGTGTGGAGAAGG + Intergenic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1175869851 20:62203703-62203725 CCCTGGGGACAGAAGGTAGACGG - Intergenic
1176243021 20:64083789-64083811 CGAGGGGGTCGGAGGGCAGAGGG - Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177003567 21:15643165-15643187 CCATGGAGGCAGAGGTCGGAGGG - Intergenic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177105692 21:16952855-16952877 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1177184673 21:17780365-17780387 CCATGGGGGCAGTGGGGAGCAGG - Intergenic
1178244182 21:30935886-30935908 CCTTGGGGACATGGGGCACAGGG - Intergenic
1178286275 21:31328045-31328067 GCATCGAGGCAGAGGGCAGAGGG - Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1180086147 21:45508837-45508859 CCATGTGGACAGGGTGCAGGTGG + Intronic
1180180012 21:46114034-46114056 CCTTGGGGCCAGAGGGCCCAGGG - Exonic
1180616915 22:17134440-17134462 CCCTGGGGAGTGAAGGCAGAGGG + Intergenic
1180919489 22:19513580-19513602 CCATGGGGACAGTGGAAAGCAGG - Intronic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181067946 22:20315480-20315502 CCATGGGGCCAGGGCGCGGAGGG + Intronic
1181459947 22:23079925-23079947 ACATGGAGGCAGAGGGCAGGAGG + Intronic
1181522918 22:23459780-23459802 CCCAGGGGACACAGGGCAGGAGG - Intergenic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181938693 22:26458009-26458031 TCATGGGGTGGGAGGGCAGAAGG - Intronic
1182100365 22:27653531-27653553 CCATGGAGACAGAGAGTAGAAGG + Intergenic
1182455544 22:30448067-30448089 TCATGGGCAGAGAGGGCAGGAGG - Intronic
1183068586 22:35380746-35380768 CCAAGGGGACAGGGAGCAGAAGG + Intronic
1183410992 22:37655097-37655119 CCAAGGGGGCAAAGGGCACAAGG + Intronic
1183418484 22:37696732-37696754 CCAACGGGAAAGAGGTCAGAAGG + Intronic
1183513036 22:38246960-38246982 GGATGGGGACACAGGGCAGCTGG + Intronic
1183547050 22:38460005-38460027 CCCTGGGGACAGAGGACTGTAGG + Intergenic
1183563330 22:38594233-38594255 CCAAGGGGACAAAGGACAGTAGG - Intronic
1184342435 22:43893395-43893417 CCATGGGCACTGGGTGCAGAAGG + Intergenic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1184402954 22:44284554-44284576 CCATGGGCACACAGGGCTCAGGG - Intronic
1184478596 22:44734886-44734908 CCATGGGGACAGAGAGCCTGTGG + Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1185367081 22:50441679-50441701 CCCTGGGGAGAGAGTGGAGAGGG + Intronic
949409593 3:3749262-3749284 CCATGGAGAAAGAGGAAAGAAGG + Intronic
949749086 3:7330391-7330413 CAAGGGGGACAGAGAGAAGAGGG - Intronic
950453086 3:13076470-13076492 CCTTGGGGACAGATGGCCGCAGG - Intergenic
950601257 3:14037477-14037499 CCATGGGGGCAGTGGGCTGGGGG - Intronic
951518985 3:23593683-23593705 CCATGGGGAAACAGGTCAGTTGG + Intergenic
951563410 3:23989564-23989586 CCATGGGGAAATGAGGCAGATGG - Intergenic
951846155 3:27086946-27086968 CCAGCGGGAAAGTGGGCAGAAGG + Intergenic
952160112 3:30684868-30684890 CCATGGGGAATGAGAGAAGATGG - Intronic
952433668 3:33250091-33250113 CCATGGAGATAGAGAGCAGAAGG - Intergenic
952882194 3:37991810-37991832 CCCTGAGGAAAGAGGGCAGGAGG + Intronic
953246339 3:41198000-41198022 CTATGGTGACAGACGGCAGTTGG + Intronic
953470805 3:43164273-43164295 CCATGGGGACAAAGTACAGGAGG - Intergenic
953617284 3:44502725-44502747 TCAAGGGTACAGAGGGCACAGGG + Intronic
954361899 3:50126574-50126596 CCTTGGGGAGGGAGGACAGATGG - Intergenic
954375538 3:50192409-50192431 CCATGGGCACTGAGGAGAGATGG + Intronic
954530051 3:51310435-51310457 CCATGGGAACAGAGAGGAGAGGG + Intronic
954947568 3:54439835-54439857 GGAGGGGGAAAGAGGGCAGACGG - Intronic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
956921852 3:73938127-73938149 CCATAGGGAGACAGGGAAGAAGG + Intergenic
957060959 3:75480982-75481004 TCATGGAGACACAGGGAAGAAGG + Intergenic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
958557672 3:95701424-95701446 TCATGGACACAGAGAGCAGAGGG + Intergenic
959170275 3:102835933-102835955 CCATGAGTACAGAGGGTAGCTGG + Intergenic
960936486 3:122907146-122907168 CCATGAAGACAGAAAGCAGATGG - Intergenic
961008619 3:123421666-123421688 GCATGGGGGCACAGGACAGATGG + Intronic
961292423 3:125858438-125858460 TCATGGAGACACAGGGAAGAAGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961452733 3:127009681-127009703 GCATGGGGGCAGGGGGCGGATGG - Intronic
961483260 3:127197309-127197331 CAATGGGGGAAGGGGGCAGAGGG - Exonic
961630608 3:128295847-128295869 CCATGGGGACTCTGGGCAGGAGG - Intronic
962425804 3:135268458-135268480 AAATGGGGACAGAGGTCATAAGG - Intergenic
963762807 3:149301293-149301315 TCACAGGGATAGAGGGCAGACGG - Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964759602 3:160122274-160122296 TCATGGGGATAGAGAGTAGAAGG + Intergenic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
965933767 3:174080312-174080334 CCAAGGAGGCATAGGGCAGAAGG + Intronic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
968052615 3:195665708-195665730 CCATGGGGTCACAGCCCAGATGG - Intergenic
968103196 3:195982646-195982668 CCATGGGGTCACAGCCCAGATGG + Intergenic
968301504 3:197620224-197620246 CCATGGGGTCACAGCCCAGATGG + Intergenic
968385967 4:138315-138337 TCATAGAGACAGAGAGCAGAAGG - Intronic
969264897 4:6057860-6057882 CCATGGGGAAAGAAGCCAGGTGG + Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
969359178 4:6650839-6650861 CCATGAAGACAAAGGGAAGAAGG - Intergenic
969623995 4:8293312-8293334 AGATGGGCACAGAGGGCCGAGGG + Intronic
969675633 4:8612877-8612899 GCATGGGAAGAGGGGGCAGAAGG - Intronic
970100934 4:12521746-12521768 ACATGGGGTCTGAGAGCAGAAGG - Intergenic
970451254 4:16168502-16168524 GCATGGGGACACAGGCCTGATGG - Intronic
971156460 4:24088327-24088349 CCTGGGAGACAGAGGACAGAGGG + Intergenic
971236473 4:24846925-24846947 CCACTGGGACAGATGGCAGTTGG - Intronic
971362680 4:25951942-25951964 CCATGGGGACAGCTGGCACCAGG + Intergenic
971797049 4:31241793-31241815 CACTGGGGACAGAGGTCAAATGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
973261220 4:48165964-48165986 GCATGGGAACACAGGTCAGAGGG - Intronic
973757797 4:54092389-54092411 CCCCGGGGACACAGGGCAGGAGG + Intronic
973788476 4:54357234-54357256 CCATTTGGATAAAGGGCAGAGGG + Intergenic
974036443 4:56821909-56821931 CCATGGGGAAGGAGGGGCGAGGG + Intergenic
974337144 4:60563843-60563865 TCATGGACACAGAGAGCAGAAGG - Intergenic
976586935 4:86809095-86809117 CCATGGGGAAAGAGAGGAGGAGG + Intronic
976636619 4:87292677-87292699 CCAGGGGGACAAGCGGCAGAGGG + Intergenic
977371614 4:96144504-96144526 CCATGGGGATATTGGGAAGAGGG - Intergenic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
978026554 4:103882610-103882632 CCATGGAGATAGAGAGTAGAAGG - Intergenic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
979427593 4:120586620-120586642 CCATGGAGATAGAGAGTAGAAGG + Intergenic
982664938 4:158250615-158250637 GCAAGGGGTCAGAGGGTAGAGGG - Intronic
983138978 4:164124738-164124760 CCATGGACACAGAGAGTAGAAGG + Intronic
984284036 4:177706708-177706730 CCTGGGTGACAGAGGACAGAGGG + Intergenic
984496057 4:180498391-180498413 TCATGGAGACAGAGAGTAGAAGG - Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
984586724 4:181572920-181572942 TCATGGGGATAGAGAGTAGAAGG - Intergenic
984880292 4:184404828-184404850 CCAGGGTGACAGAGTGCAGGAGG + Intronic
985309063 4:188577520-188577542 CAATCATGACAGAGGGCAGAGGG + Intergenic
985840940 5:2305304-2305326 CCATGGTCAGAGAAGGCAGAGGG + Intergenic
985950045 5:3216035-3216057 TCATGGAGACAGAGAGTAGAAGG + Intergenic
986317680 5:6601514-6601536 CCATGTGGAGAGAGGACAGGTGG - Intronic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
989111600 5:37912204-37912226 CCATGGAGATAGAGAGTAGAAGG + Intergenic
990626924 5:57624006-57624028 CCATGAGGACACTGAGCAGAAGG + Intergenic
991238416 5:64426795-64426817 TCATAGAGACAGAGAGCAGAAGG + Intergenic
991582407 5:68170040-68170062 CCATGGAGACAGAGGTGGGAAGG - Intergenic
992748663 5:79842492-79842514 CCATGGTGACAGAGAGCTGTTGG - Intergenic
993225912 5:85167146-85167168 CCATGGCTTCAGAGGGCACAAGG + Intergenic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994265433 5:97710599-97710621 CCATGGAGATAGAGAGTAGAAGG + Intergenic
996192165 5:120558328-120558350 TCATGGAGACAGAGTGTAGAAGG - Intronic
996385057 5:122902129-122902151 CCATGAGTACACAGGGAAGATGG - Intronic
996387501 5:122924984-122925006 CGAAGGGGAAAGAGGGGAGAAGG - Intronic
996590416 5:125140550-125140572 CCATGAGGACAGAGGCCTCATGG + Intergenic
996688280 5:126309362-126309384 TCATGGAGATAGAGAGCAGAAGG + Intergenic
997842671 5:137256477-137256499 ACATGGTGACAGAGGGCAAGAGG + Intronic
997870972 5:137504998-137505020 ACATGGGGACACAGGAAAGAGGG - Intronic
997975766 5:138440513-138440535 CCTAGGGAACAGAGGGCACAGGG - Intronic
998159564 5:139805796-139805818 GCATGGGGACATGGGGTAGAGGG + Intronic
999120737 5:149207371-149207393 GCATGGGGACCGAGACCAGAAGG - Intronic
999363661 5:151006971-151006993 CCATGGGAACAGGGGGTGGAGGG + Intergenic
1000487081 5:161860440-161860462 CCATGGAGACAGAGAGTAGAAGG + Intronic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1001527273 5:172437775-172437797 CCCTGTGGACAGAGTGCAGTAGG - Intronic
1001948702 5:175800992-175801014 GCATGGGGACAGATGGGAGGTGG + Intronic
1002191448 5:177479920-177479942 CCATGGGAACCGAGGACGGACGG + Intergenic
1002985911 6:2190859-2190881 CCTTGGGGACACGGGGCACAGGG - Intronic
1003122898 6:3332849-3332871 CCATGGGGAAAGAGGGTCGGGGG - Intronic
1003149772 6:3538646-3538668 CCATGGACACAGAGCCCAGATGG + Intergenic
1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG + Intergenic
1004024369 6:11804883-11804905 CCTTGTGGACAAAGGACAGACGG + Intronic
1004959763 6:20773901-20773923 TGATGGGGGCAGAGGGCAGAGGG - Intronic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1006791510 6:36704203-36704225 CCCTGGGGACAGAGGAGTGAGGG - Exonic
1007203429 6:40130442-40130464 CCATGGGGTCTGAGGGCTTAGGG - Intergenic
1007232578 6:40358737-40358759 CCATGGGGCCAAAGTGCAGAGGG - Intergenic
1007385061 6:41514909-41514931 CCAAGGGCACGCAGGGCAGATGG + Intergenic
1007738462 6:43996744-43996766 ACATGGAGACACAGAGCAGAAGG - Intergenic
1009447966 6:63765826-63765848 TCATGGAGATAGAGAGCAGAAGG - Intronic
1010315542 6:74444976-74444998 CAAAAGGCACAGAGGGCAGAGGG + Intergenic
1010536346 6:77036396-77036418 CCATGGCGGCTGAGGGGAGAGGG + Intergenic
1010839352 6:80629958-80629980 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1011297605 6:85840753-85840775 CCAAGCTGACTGAGGGCAGAAGG + Intergenic
1011341999 6:86326483-86326505 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1012028857 6:94032361-94032383 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1012447774 6:99324029-99324051 CCATGGGGGCACAGGGCAGGAGG + Intronic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1012813774 6:103995552-103995574 GCTTAGGGACAGAGGGTAGAGGG - Intergenic
1013032383 6:106346588-106346610 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1013723578 6:113063372-113063394 TCATGGAGAAAGAGGGCAGAAGG - Intergenic
1014081870 6:117296614-117296636 CCATGGAGACAGAGAGTAGAAGG + Intronic
1014541854 6:122685836-122685858 TCACGGAGACAGAGAGCAGATGG - Intronic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016133023 6:140500978-140501000 CCATGGGGACAGGGAGTATATGG - Intergenic
1016294112 6:142555500-142555522 ACAATGGGACAGAGGGCACATGG + Intergenic
1016605490 6:145918616-145918638 CCAGGGGGACAGAGGAAAGAAGG - Intronic
1017628369 6:156370976-156370998 CTATGGATACAGAGGGCTGATGG - Intergenic
1018349150 6:162938056-162938078 CCTTGGGGACACAGGGGAAAAGG - Intronic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019443471 7:1059300-1059322 CCCAGGGGACAGAGGGCTGGAGG + Intronic
1019522140 7:1465869-1465891 CCTTGGGGACACAGGGCCCAGGG - Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1019788787 7:2996982-2997004 CCATGGGGAGGCTGGGCAGATGG - Intronic
1019996019 7:4725021-4725043 TGCTGGGGACAGAGGGCAGCAGG - Intronic
1020001244 7:4757166-4757188 CCTTGAGGACAGAGGCCCGAAGG - Exonic
1020118984 7:5492230-5492252 CCATGCAGACAGAAAGCAGAAGG + Intronic
1020262001 7:6536065-6536087 CCATCTGGAGAGAGGTCAGAGGG - Intronic
1020865104 7:13550324-13550346 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1021143550 7:17057015-17057037 CCATGGGGTCAGAGCAAAGAAGG + Intergenic
1021262670 7:18477834-18477856 CCATTGGCAGAAAGGGCAGATGG - Intronic
1021492717 7:21236885-21236907 ACATGGGGAGAGAGGCCATAAGG + Intergenic
1021804763 7:24343771-24343793 CCAGGAGGACAGAGAGCATATGG + Intergenic
1022093867 7:27125879-27125901 ACAGGGGGACAGAGGAAAGATGG + Intronic
1022179024 7:27899972-27899994 ACATGGGGGCAGTGGGCAGCTGG + Intronic
1022227182 7:28375323-28375345 CCATGGAGACAGAGAGTAGAAGG + Intronic
1022236882 7:28470252-28470274 CCATGGAGATAGAGGGTAGAAGG - Intronic
1023016398 7:35971772-35971794 TCACGGGGACAAAGGGCAGGCGG - Intergenic
1023265262 7:38398504-38398526 TCATGGAGACAGAGAGTAGAAGG + Intronic
1023861631 7:44220498-44220520 CCCTGGGCACAGAGGGGACAGGG + Intronic
1026019173 7:66694731-66694753 CCAATGGGACAGAGGGTGGAGGG + Intronic
1026297888 7:69071397-69071419 CCATGGACACAGATGGAAGAGGG - Intergenic
1026319324 7:69255249-69255271 CCATTGGAACAGAGGAGAGATGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026854282 7:73742923-73742945 CCGTGGGGACCAAGGGCCGAAGG + Intergenic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1028512013 7:91635629-91635651 TCATGGGGATAGAGAGTAGAAGG + Intergenic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029642393 7:101829377-101829399 TCATGGGAACAGATGGCGGACGG + Intronic
1030876550 7:114820290-114820312 CCCTGAGGACAGAGAGCTGAGGG - Intergenic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1031484762 7:122312863-122312885 CCCTTGGGACACAGGGCAAAAGG + Intergenic
1031836231 7:126685041-126685063 CCTTGGGGACGCAGGGCACAGGG - Intronic
1032372675 7:131374458-131374480 GCAAGGGGACGGAGGGCAGAAGG - Intronic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1033970569 7:147034388-147034410 CCATAGGGAGAGCGTGCAGATGG + Intronic
1034368200 7:150570150-150570172 CCATGGGCAGAAAGTGCAGAGGG - Intronic
1034431235 7:151042183-151042205 CCAGTGGGACTGAGGGCAGCAGG + Intronic
1035013654 7:155743875-155743897 CCAGGGGGATAGTGGGCACAAGG - Intronic
1035763048 8:2084009-2084031 CCAAGGGGACAGAAGGAACAAGG - Intronic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1037150032 8:15626109-15626131 CCTTGGGGACACAGGGCACAGGG - Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1037346572 8:17907456-17907478 CCATGGGGAGAGGTGGCAGAGGG + Intronic
1037347585 8:17916081-17916103 CCATGGGGAGAGGTGGCAGAGGG + Intergenic
1037599145 8:20379257-20379279 GCATGTGGACATAGGGCAGTGGG - Intergenic
1037770559 8:21796697-21796719 GCATGGGGACAGTGGGGGGAAGG - Intronic
1038179779 8:25215284-25215306 CCATGGGAACAGAGGGCCTTTGG + Intronic
1039001741 8:32988794-32988816 CCATGGAGACAGACAGTAGAAGG - Intergenic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039236446 8:35507563-35507585 TCATGGAGATAGAGAGCAGAAGG + Intronic
1039476913 8:37843647-37843669 CCAAGGTGACAGAGGACACAGGG + Exonic
1039647031 8:39297813-39297835 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041219439 8:55634026-55634048 CCATGGGGCCAAAGGGAGGATGG - Intergenic
1042189055 8:66167122-66167144 CCAAAGGGAAAGAGGGCAGCTGG - Intronic
1042855341 8:73261390-73261412 ACACGGGGAGAGAGGGCAAACGG + Intergenic
1043172929 8:76987700-76987722 CAATGGGGACAGAGAGAAAAGGG + Intronic
1043557614 8:81450641-81450663 CCATGGAGACAGAGAGTAGAAGG - Intergenic
1046709416 8:117493039-117493061 ACTTGAGGACAGAGGGTAGAAGG - Intergenic
1047183767 8:122613980-122614002 CCACGGGGAAAGGCGGCAGAAGG - Intergenic
1048316883 8:133369441-133369463 CCATGGACACAGAGAGCAGGGGG - Intergenic
1048508839 8:135044216-135044238 CTATCCAGACAGAGGGCAGAGGG + Intergenic
1048844392 8:138593228-138593250 TCAAGGGGACAGAGGGCATTAGG + Intronic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049044554 8:140139150-140139172 CAATGGGCACAGAAGGCTGAGGG + Intronic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049472311 8:142781969-142781991 CCCTGGAGGCACAGGGCAGAGGG + Intergenic
1049745087 8:144259864-144259886 CCCTGGGGTCAGCGGGGAGAGGG + Intronic
1049897519 9:122955-122977 ACTTGGGAACAGAGAGCAGAAGG + Intronic
1050121134 9:2308375-2308397 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1052133413 9:24879942-24879964 CCATGGGGAAAAAGGTCATAGGG - Intergenic
1053254191 9:36601756-36601778 TCATAGAGACAGAAGGCAGAAGG - Intronic
1053682956 9:40497675-40497697 CCCTGGGGACAAAGGTCTGATGG - Intergenic
1053740613 9:41133243-41133265 ACTTGGGAACAGAGAGCAGAAGG + Intronic
1054280758 9:63127253-63127275 CCCTGGGGACAAAGGTCTGATGG + Intergenic
1054296056 9:63333175-63333197 CCCTGGGGACAAAGGTCTGATGG - Intergenic
1054443602 9:65289396-65289418 ACTTGGGAACAGAGAGCAGAAGG + Intergenic
1054486672 9:65732107-65732129 ACTTGGGAACAGAGAGCAGAAGG - Intronic
1054687737 9:68298057-68298079 ACTTGGGAACAGAGAGCAGAAGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1057139343 9:92717290-92717312 ATATGGAGACTGAGGGCAGAAGG - Intronic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057771156 9:97969276-97969298 CCAGAGGGGCAGAGGACAGATGG - Intergenic
1057885935 9:98829649-98829671 TCATGGAGACAGAGAGCAGAAGG - Intronic
1057985600 9:99710561-99710583 CCACTGGGATAGAGTGCAGATGG - Intergenic
1058113445 9:101056986-101057008 GGCTGGGGACACAGGGCAGAGGG - Intronic
1058750478 9:108034260-108034282 GGATGGGGGCAGAGGGTAGAAGG - Intergenic
1059343671 9:113613822-113613844 CCATGGGGAGAGAAGGTAGATGG - Intergenic
1059383919 9:113949594-113949616 CCCTGGGGACAGAAATCAGAAGG - Intronic
1059540528 9:115125904-115125926 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1059960894 9:119563543-119563565 CTATGGGGACTGAGGGGAGCTGG - Intergenic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1060189364 9:121582341-121582363 GCATGGGGACAGAAGGAAGGGGG - Intronic
1060495533 9:124115744-124115766 CCATGGAGACAGAAAGTAGAGGG + Intergenic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1060764403 9:126283050-126283072 CAATGGGGGAAGAGGTCAGAGGG + Intergenic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061138600 9:128751010-128751032 CCCTGGGGACAGGGTGCAGAAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061482444 9:130903675-130903697 TTATGGGGACAGAGAGCAGGGGG - Exonic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061789007 9:133048803-133048825 CCTTGGGGCCCGAGGGCAGCTGG - Intronic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1062107253 9:134762458-134762480 CCATGGGGCCAGAGCACAGGAGG + Intronic
1185804939 X:3048355-3048377 CCTTGTGGACAAAGGACAGACGG + Intronic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1185940188 X:4309342-4309364 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1185967344 X:4622468-4622490 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1186226952 X:7409468-7409490 TCATGGAGACAGAGAGTAGATGG - Intergenic
1187102106 X:16204192-16204214 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1187105988 X:16242339-16242361 TCATGGAGATAGAGGGTAGAGGG - Intergenic
1187845402 X:23531383-23531405 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1188372742 X:29388733-29388755 CCATAGAGACAGAAAGCAGATGG + Intronic
1188923979 X:36016334-36016356 TCATGGAGACAGAGAGCAGAAGG - Intergenic
1189750634 X:44217654-44217676 CCATGGAGATAGAGAGTAGAAGG + Intronic
1190497518 X:51040811-51040833 CCAGAGGGAGAAAGGGCAGAGGG + Intergenic
1190526020 X:51330804-51330826 CAATGGTGGCAGAAGGCAGAGGG + Intergenic
1190558308 X:51660681-51660703 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1191189025 X:57646153-57646175 TCATGGAGATAGAGAGCAGAGGG + Intergenic
1191902556 X:66054950-66054972 CCATGGGGACTAAGGGGAAAGGG + Intergenic
1193049864 X:77088413-77088435 GCCTGGGGACAGAGGACAGGAGG + Intergenic
1193579173 X:83241813-83241835 TCATGGACACAGAGGGTAGAAGG + Intergenic
1193680422 X:84512357-84512379 TCATGGACACAGAGAGCAGAAGG + Intergenic
1193707275 X:84837128-84837150 CCATGGAGATAGAGAGCAGAAGG + Intergenic
1194562899 X:95445554-95445576 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1194869376 X:99109265-99109287 CCATAGGGAAAGTGGGCAAAAGG + Intergenic
1195238379 X:102925400-102925422 CCATGGAGATAGAGGGTAGAAGG - Intergenic
1195324192 X:103744647-103744669 CAAAGGGGAAAGAGGACAGATGG + Intergenic
1195819791 X:108931382-108931404 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1195986274 X:110634126-110634148 TCATGGAGACAGAGTGTAGAAGG + Intergenic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1196986617 X:121280848-121280870 CCATGGAGATAGAGCGTAGAAGG + Intergenic
1197032423 X:121833539-121833561 CCATGGAGTGAGAGGGTAGAAGG + Intergenic
1197370108 X:125615300-125615322 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197440481 X:126482446-126482468 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197623043 X:128772750-128772772 GCATGGAGATAGAGAGCAGAAGG - Intergenic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199370031 X:147036433-147036455 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1199589888 X:149457546-149457568 GAATGGAGACAGAGGGGAGATGG + Intergenic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1200795252 Y:7335220-7335242 TCATAGGGACAGAAGGTAGATGG + Intergenic
1201188976 Y:11430361-11430383 CCACGGGGACTGGGGGGAGAGGG - Intergenic
1201276318 Y:12302250-12302272 CCTTGTGGACAAAGGACAGATGG - Intergenic
1201988585 Y:19997205-19997227 GCATGGAGACAGAAAGCAGATGG + Intergenic