ID: 904497504

View in Genome Browser
Species Human (GRCh38)
Location 1:30895472-30895494
Sequence GAAGTGGAACAGCTTCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904497504_904497511 19 Left 904497504 1:30895472-30895494 CCCCGGGGAAGCTGTTCCACTTC 0: 1
1: 0
2: 0
3: 15
4: 113
Right 904497511 1:30895514-30895536 AACAGCCACACTTCATCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 189
904497504_904497510 18 Left 904497504 1:30895472-30895494 CCCCGGGGAAGCTGTTCCACTTC 0: 1
1: 0
2: 0
3: 15
4: 113
Right 904497510 1:30895513-30895535 CAACAGCCACACTTCATCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904497504 Original CRISPR GAAGTGGAACAGCTTCCCCG GGG (reversed) Intronic
902566459 1:17314760-17314782 GGAGTGGTTCAGCTGCCCCGGGG - Intronic
903301210 1:22379937-22379959 GAAGAGGAGCAGATTCCCGGGGG - Intergenic
903779819 1:25814124-25814146 GGAGAAGTACAGCTTCCCCGTGG + Exonic
903866108 1:26399234-26399256 GCACTGGAACAGCTTGCCTGAGG - Intergenic
904497504 1:30895472-30895494 GAAGTGGAACAGCTTCCCCGGGG - Intronic
906147674 1:43569586-43569608 GCAGAGGAACAGCTGCCCCCTGG + Exonic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
907373257 1:54016466-54016488 GAAGTGCAACAGCTTCACCTGGG - Intronic
907489545 1:54800393-54800415 GGAGTGGAACCGCTTCCTAGTGG - Intronic
907787186 1:57624046-57624068 GAGGTGAAACAGCTTGCCTGGGG - Intronic
912749124 1:112270868-112270890 GAAGAGGGACAGCTTGCCCCTGG - Intergenic
915041196 1:152969549-152969571 GAGGTGGACCAGCTTCCCAGAGG + Intergenic
915296281 1:154924022-154924044 GAAGTGAAACAACTTCTCCAGGG - Intergenic
916938124 1:169652040-169652062 GAGGTTTAATAGCTTCCCCGAGG + Intergenic
1070499758 10:77061396-77061418 GATGTTGAACACCTTCCCAGTGG - Intronic
1073835481 10:107436281-107436303 GAAGTGGAACAGATTCTCAGAGG + Intergenic
1075166152 10:120070057-120070079 GAAGGTGAAGAGCTTCCCCAAGG - Intergenic
1076320848 10:129580396-129580418 GAGGTGCAACAGTTTCCCTGAGG + Intronic
1077988230 11:7376877-7376899 GAGGTTGAACAGCTTGCCCATGG - Intronic
1080667646 11:34349869-34349891 GAAGTGAAACAACTTGCCCAGGG + Intronic
1084013833 11:66367384-66367406 CAGATGGAACAGCTTCCCAGGGG + Intronic
1084901596 11:72314194-72314216 GAGGTGGCAGAGCTTCCCCAGGG + Intronic
1085306167 11:75487259-75487281 GAGGTGGAACGACTTCCCCAAGG - Intronic
1087538954 11:99490758-99490780 GAAGTGGAACAGTTTATCCATGG + Intronic
1088969397 11:114759326-114759348 GACATGAAACAGCTTCCCCACGG - Intergenic
1092089832 12:5795272-5795294 GATATGGAACAGCTTCCACGAGG - Intronic
1094608094 12:31966881-31966903 GTAGGTGAACAGCTTCACCGTGG + Intronic
1100005457 12:89890072-89890094 GAAGTCCAAGAGCTTCCCCTAGG - Intergenic
1100178069 12:92053232-92053254 CAACTGGAACAGTTTCCCCAGGG - Intronic
1102172560 12:110853275-110853297 GAAGTGGAAGACCTTCCCTTGGG - Intronic
1102873569 12:116432575-116432597 GAAGTGGAAGAACTGCCCAGTGG + Intergenic
1105534865 13:21256483-21256505 GAAGTTGAACATCGTCCCAGAGG - Intergenic
1110552251 13:76823017-76823039 GCAGTGGAGCAGCTTCTCCAGGG + Intergenic
1115664660 14:35534160-35534182 GAACTAGAAGAGCTTCGCCGCGG - Exonic
1119729368 14:76941320-76941342 GAAGTGGAATTGCTTACCAGTGG - Intergenic
1122605401 14:102944672-102944694 GATGTGGGGCAGCTTCTCCGGGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1129895649 15:79103919-79103941 GAAGTGGAGCAACTTGCCCAAGG - Intergenic
1131045490 15:89311536-89311558 GAAGTGAACCATCTTCCCAGAGG - Intronic
1132232080 15:100191830-100191852 GCAGAGCAACAGCTGCCCCGTGG + Intronic
1132805095 16:1771628-1771650 CAAGTGAAGCAGCCTCCCCGCGG - Exonic
1133692715 16:8232055-8232077 GAAGTAGGACACCTTCCCCTAGG + Intergenic
1142504333 17:353221-353243 TAAATGGAACAGCTTCCCGGAGG + Intronic
1142850668 17:2703286-2703308 GAAGTTGGACAGCCTGCCCGGGG - Intronic
1143714373 17:8756466-8756488 GAAGTGGAACAGGGTTGCCGTGG + Intronic
1146728680 17:35175685-35175707 GAAGTTGAAAAGCTTCTCCTGGG + Intronic
1147039086 17:37703508-37703530 TAAGTGGAATATCTTCCCCACGG + Intronic
1148753510 17:49959833-49959855 GGAGTGGAGAAGCTTCCCAGGGG - Intergenic
1151222354 17:72622512-72622534 GAGGTTGAACAGCTTGCCCTGGG - Intergenic
1151349019 17:73520564-73520586 GAGGTGCAGCAGCTTCCCTGAGG + Intronic
1153585368 18:6615156-6615178 GAAGTGGGAAAGCTTGCCTGGGG + Intergenic
1156452935 18:37276783-37276805 GAACTGGAACAGAGTCCCAGGGG + Intronic
1156860177 18:41826969-41826991 GAATTGGAAAAGCTTCCCAGTGG - Intergenic
1157745279 18:50129660-50129682 GAAGTGGAATAACTTGCCCGAGG + Intronic
1158245363 18:55426327-55426349 GAAGTGGAACAGATTTTCTGTGG - Intronic
1158392968 18:57058589-57058611 GGAGTGGACCAGCTCCCCCGGGG - Intergenic
1160410591 18:78673184-78673206 GAAGTGGGAGTGCTTTCCCGAGG - Intergenic
929053375 2:37856386-37856408 GAAGCAGAGCAGCTTCCCCAAGG - Intergenic
929531662 2:42756556-42756578 GAGGTGGAGGAGCTGCCCCGTGG + Exonic
933726122 2:85428360-85428382 GAAGTTGAATAGCTTTCCTGAGG - Intronic
934572176 2:95379686-95379708 GAAGGAGAACAGCTCCCCCTGGG - Intronic
935569388 2:104642836-104642858 GAGGTGGGGCAGCTTCACCGAGG - Intergenic
938099537 2:128489431-128489453 GAAGTGGAACTGCCTCCCAGGGG - Intergenic
938773414 2:134520445-134520467 GAAGTGACACAGCTTACCTGAGG - Intronic
942302039 2:174571952-174571974 GAGGGGGAACCGCTTCCCTGTGG + Exonic
947343139 2:229160962-229160984 GTAGTGGAGAAGCTTCCCCAAGG - Intronic
948886731 2:240888523-240888545 GAAGTGGGGCAGCTTCCGCGTGG + Exonic
1173180681 20:40804283-40804305 GCATGGGAACAGCTTCCCCCGGG - Intergenic
1173297712 20:41774050-41774072 GAAGTGAAGCAACTTCCCCAGGG + Intergenic
1176184102 20:63768767-63768789 GCAGTGGAACGGCTTCCACCAGG + Intronic
1177300973 21:19245257-19245279 GAAGTAGACGACCTTCCCCGTGG - Intergenic
1180570907 22:16718011-16718033 GCAGCGGAACAGCTCCCCCCCGG + Intergenic
1181803688 22:25362625-25362647 GGGGAGGAACAGCTTCCCTGAGG - Intronic
949941890 3:9161474-9161496 GAAGTGAAACAACTTGCCCAAGG + Intronic
951040576 3:17984584-17984606 TAAGTGGACCTGCTTCCCTGGGG + Intronic
954539171 3:51382406-51382428 GAAGGGGACCAGCTCCCCCTAGG - Exonic
955350247 3:58188342-58188364 GAAGTTAAACAACTTGCCCGAGG - Intergenic
955986636 3:64580583-64580605 GAAATGGATCAGTTTCCCCCTGG - Intronic
956507103 3:69953463-69953485 GAAGAGGAACAGCTTGACCAAGG - Intronic
959392527 3:105793758-105793780 AAAGTGGAACAGCTACACCTCGG - Intronic
960225134 3:115159246-115159268 GAGGTGGAACAGCTTCATCCTGG + Intergenic
961349719 3:126292134-126292156 GATGTGGAGCAGATTCCCTGTGG + Intergenic
966939620 3:184737326-184737348 AAAGTGGAAAAGATCCCCCGAGG - Intergenic
967936121 3:194729120-194729142 GTGGTGGAACAGCTTGCCCAAGG + Intergenic
969707818 4:8821356-8821378 AAGGTGGAATAGCCTCCCCGGGG - Intergenic
970481505 4:16480349-16480371 GAAGTGGAACAGCTTTATGGAGG + Intergenic
970880052 4:20918260-20918282 GATGTTGAACAGCTTCCCAGTGG - Intronic
979449421 4:120852848-120852870 GAAGTGGAACAGCATCTTCATGG + Intronic
980138317 4:128883325-128883347 GAAGTGGAAGAGCTTCCCTTGGG - Intronic
980210695 4:129783925-129783947 GATCTGGAAAAGCTTCCCTGAGG + Intergenic
982355292 4:154460334-154460356 GAAGTGGAACATCTTCCTAAGGG + Intronic
985324893 4:188755900-188755922 GAATTGTAACAGCTGCCGCGAGG + Intergenic
985857002 5:2436219-2436241 AAACTGCAACAGCTTCCCCATGG + Intergenic
989094593 5:37770102-37770124 GCAGTGGAACAACTTGCCCAAGG - Intergenic
991966302 5:72094783-72094805 GAAGTGGCACAGATTCCATGTGG - Intergenic
994713611 5:103296043-103296065 GGAGTGGAGCAGCTGCCCCCTGG + Intergenic
1000273510 5:159710405-159710427 GAAGAGGAACAGCTTGCTCATGG + Intergenic
1003544988 6:7051776-7051798 GAAGTGGCACAGCCTCTCGGGGG - Intergenic
1003780902 6:9425162-9425184 GAAGTGCACCTGTTTCCCCGAGG + Intergenic
1012642704 6:101639826-101639848 GAAGTGGAACAGTATCCACTAGG + Intronic
1013463372 6:110397053-110397075 GAAGTGGAATAACTTGGCCGAGG - Intronic
1014935077 6:127377243-127377265 GAAATGGAAAAGCTTCCACTGGG + Intergenic
1016874363 6:148850221-148850243 GAAGTTGAGTAGCTTCCCCAGGG + Intronic
1017767399 6:157617855-157617877 GAGGTGGTACAGATTCCCAGAGG - Intronic
1019907999 7:4079296-4079318 GAAGCAGCACAGCTTCCCCAGGG - Intronic
1023033301 7:36109440-36109462 GAAGTTGAAGAACCTCCCCGTGG + Intergenic
1023037689 7:36147587-36147609 GAAGGTGAAGAACTTCCCCGTGG - Intergenic
1023577523 7:41645026-41645048 GAAGTCACACAGCTTCCCAGTGG + Intergenic
1027138395 7:75639878-75639900 GAAGTGGAACAGGTATCCCCAGG + Intronic
1027744090 7:82051516-82051538 GAATTGGAAAAGCTTCCACGAGG + Intronic
1028134021 7:87207872-87207894 CATGTGGAACAGCTTCCCAGGGG - Intronic
1030385646 7:108864666-108864688 GAAGTTGAAAAGCTTCCCTGGGG - Intergenic
1033494252 7:141877607-141877629 CAGGTGGAACAGCTGCCACGAGG - Intergenic
1034976897 7:155454181-155454203 GGAGAGCAACACCTTCCCCGGGG - Intergenic
1036422883 8:8614278-8614300 GGAGTGGAAGAGCTTCACAGTGG + Intergenic
1044868688 8:96597292-96597314 GAATTGGTCCAGCTTCCCAGAGG - Intronic
1057691703 9:97291805-97291827 GAAGTGGAATAACTTACCCCAGG - Intergenic
1057858484 9:98621223-98621245 GAGGTTGAACAGCTTGGCCGAGG + Intronic
1059344742 9:113620532-113620554 GAAGTGGAATAACTTGCCCAGGG + Intergenic
1060523533 9:124307943-124307965 GTGGTGGACCTGCTTCCCCGGGG - Intronic
1061258724 9:129467551-129467573 GAAGTGGAACAGCAGTCCTGGGG + Intergenic
1061553319 9:131350340-131350362 GAATTGGAACATCTCCCCCAGGG - Intergenic
1061822744 9:133237619-133237641 CAAGTTGAAGAGCCTCCCCGAGG - Intergenic
1185634600 X:1542442-1542464 GAAGTGAAACAGCTGTCCCAAGG + Intergenic
1187127518 X:16468081-16468103 GAAGTTTAACAACTTCCCCTTGG + Intergenic
1187647780 X:21367885-21367907 GTAGGGGAACAGCTTTGCCGTGG - Intergenic
1192128314 X:68523406-68523428 GAAGTTGAGCAGCTTGCCCTAGG + Intronic
1195585306 X:106558327-106558349 GATGTGCAACAGCTTTCCCTGGG + Intergenic
1199555914 X:149108448-149108470 GCAGTGGAACAGCTCCACCATGG - Intergenic