ID: 904502083

View in Genome Browser
Species Human (GRCh38)
Location 1:30919057-30919079
Sequence ATTTCTAAGGGGATTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904502078_904502083 -3 Left 904502078 1:30919037-30919059 CCGAGGAGTTCTGGGCTGGGATT No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data
904502072_904502083 5 Left 904502072 1:30919029-30919051 CCATCCCTCCGAGGAGTTCTGGG No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data
904502076_904502083 0 Left 904502076 1:30919034-30919056 CCTCCGAGGAGTTCTGGGCTGGG No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data
904502070_904502083 13 Left 904502070 1:30919021-30919043 CCTCAAATCCATCCCTCCGAGGA No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data
904502068_904502083 27 Left 904502068 1:30919007-30919029 CCAAGCGAGGAGATCCTCAAATC No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data
904502074_904502083 1 Left 904502074 1:30919033-30919055 CCCTCCGAGGAGTTCTGGGCTGG No data
Right 904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904502083 Original CRISPR ATTTCTAAGGGGATTGTTGA GGG Intergenic
No off target data available for this crispr