ID: 904502145

View in Genome Browser
Species Human (GRCh38)
Location 1:30919660-30919682
Sequence GTGGGCTTGCTCAGTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904502138_904502145 9 Left 904502138 1:30919628-30919650 CCAAAATTGCATAGTCACTATAG No data
Right 904502145 1:30919660-30919682 GTGGGCTTGCTCAGTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904502145 Original CRISPR GTGGGCTTGCTCAGTTCTCC AGG Intergenic
No off target data available for this crispr