ID: 904511107

View in Genome Browser
Species Human (GRCh38)
Location 1:31008883-31008905
Sequence CACCGCGCCCGGCCTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 2, 1: 6, 2: 39, 3: 207, 4: 895}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904511107_904511117 15 Left 904511107 1:31008883-31008905 CCCCTGCAAGGCCGGGCGCGGTG 0: 2
1: 6
2: 39
3: 207
4: 895
Right 904511117 1:31008921-31008943 CCTAGCACTTTGGGAGGCCAAGG 0: 6817
1: 95257
2: 215319
3: 232657
4: 146568
904511107_904511118 19 Left 904511107 1:31008883-31008905 CCCCTGCAAGGCCGGGCGCGGTG 0: 2
1: 6
2: 39
3: 207
4: 895
Right 904511118 1:31008925-31008947 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
904511107_904511113 6 Left 904511107 1:31008883-31008905 CCCCTGCAAGGCCGGGCGCGGTG 0: 2
1: 6
2: 39
3: 207
4: 895
Right 904511113 1:31008912-31008934 ACCTATAATCCTAGCACTTTGGG 0: 665
1: 15941
2: 127811
3: 334780
4: 219867
904511107_904511112 5 Left 904511107 1:31008883-31008905 CCCCTGCAAGGCCGGGCGCGGTG 0: 2
1: 6
2: 39
3: 207
4: 895
Right 904511112 1:31008911-31008933 CACCTATAATCCTAGCACTTTGG 0: 634
1: 14037
2: 104796
3: 239076
4: 254496
904511107_904511115 9 Left 904511107 1:31008883-31008905 CCCCTGCAAGGCCGGGCGCGGTG 0: 2
1: 6
2: 39
3: 207
4: 895
Right 904511115 1:31008915-31008937 TATAATCCTAGCACTTTGGGAGG 0: 2529
1: 52066
2: 341755
3: 245650
4: 128975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904511107 Original CRISPR CACCGCGCCCGGCCTTGCAG GGG (reversed) Intronic
900663661 1:3799266-3799288 CACCGCGCCCGGCCTGTAAATGG - Intergenic
900963966 1:5944679-5944701 CACCGCGCCCGGCCAGTCATTGG - Intronic
901025209 1:6275442-6275464 TACCGCGCCTGGCCTAGCTGTGG - Intronic
901046739 1:6400903-6400925 CACCGCGCCCGGCCGAGAAGGGG - Intergenic
901069561 1:6510302-6510324 CACTGTGCCCGGCCGGGCAGAGG - Intronic
901377955 1:8853291-8853313 CACAGCGCCCGGCCGTGAAGTGG - Intergenic
901504322 1:9675095-9675117 CACCGCGCCCGGCCTCAAACAGG - Intronic
901606329 1:10462144-10462166 CACCGCGCCCAGCCTGCCATGGG + Intronic
901687695 1:10952798-10952820 CACCGCGTCTGGCCTTTCTGTGG + Intronic
901726222 1:11244342-11244364 CACCGCGCCCGACCCTGTACTGG - Intronic
901939628 1:12652109-12652131 CACCACGCCCAGCCTTCCAGAGG + Intronic
902049779 1:13554053-13554075 CACCGTGCCTGGCCGTGCTGAGG - Intergenic
902415405 1:16235961-16235983 CACTGCGCCCAGCCTTCTAGAGG + Intronic
902749617 1:18498668-18498690 CACCATGCCCAGCCTTGGAGTGG + Intergenic
902828093 1:18991155-18991177 CACCGCGCCCGGCCGCACATAGG - Intergenic
903583602 1:24391108-24391130 CACCGTGCCCGGCCCTCCAAAGG + Intronic
903746414 1:25589812-25589834 CACCGCGCCCGGCCCGTAAGAGG - Intergenic
903799768 1:25957922-25957944 CACCGCGCCCGGCCTGTCTTGGG - Intergenic
903844498 1:26270062-26270084 CACCGCGCCCGGCCAGGAAGCGG + Intronic
904135979 1:28312886-28312908 CATCGCGCCCGGCCTGGAATGGG + Intergenic
904139334 1:28339714-28339736 CACCGCGCCCAGTCATCCAGGGG - Intergenic
904168811 1:28576603-28576625 CACCGCGCCCGGCCGAGACGGGG + Intronic
904256506 1:29258251-29258273 CACCGCGCCCAGCCTTTAAATGG + Intronic
904511107 1:31008883-31008905 CACCGCGCCCGGCCTTGCAGGGG - Intronic
904663602 1:32103228-32103250 CACTGTGCCCGGCCTTTCAGAGG - Intergenic
904664641 1:32110351-32110373 CACCGCGCCTGGCCTGGAATTGG + Intronic
904812072 1:33170033-33170055 CACTGTGCCCGGCCTAGTAGGGG - Intronic
905015078 1:34772350-34772372 CAACATGCCCGGCCTTCCAGAGG + Intronic
905066336 1:35187440-35187462 CACTGCTCCCGGCCTTGAATAGG - Intronic
905077283 1:35283623-35283645 CACTGCACCCGGCCTTGAAGTGG + Intronic
905190572 1:36230549-36230571 CACCGCGCCCGGCCTAGAAAAGG + Intronic
905708361 1:40079682-40079704 CACCACGCCCGGCCTTCTATAGG + Intronic
906040933 1:42787310-42787332 CACCGCGCCCGGCCAGGCAAGGG - Intronic
906065459 1:42977373-42977395 CACCGTGCCCGGCTTTGGTGAGG + Intergenic
906210357 1:44009509-44009531 CACCGCGCCCGGCCAAGATGGGG + Intronic
906213134 1:44023352-44023374 CACCGCACCCGGCCTGGGTGAGG - Intronic
906505454 1:46375816-46375838 CACCGCGCCCAGCCACGCACTGG - Intergenic
906543706 1:46607081-46607103 CACCACGCCTGGCCTGGCATTGG - Intronic
907437226 1:54457707-54457729 CACCGCGCCCAGCCCAGCTGAGG - Intergenic
907509482 1:54947555-54947577 CACCGCGCCCGGCTGAGAAGAGG + Intergenic
908293700 1:62692331-62692353 CACTGCGCCCGGCCAGGCATGGG + Intergenic
908632832 1:66129367-66129389 CACCGCGCCCGGCCACAGAGAGG - Intronic
908707919 1:66980050-66980072 CACCACACCCGGCCTTGCTTTGG + Intronic
908857584 1:68447571-68447593 CACCGCGCCCGGCCCTACCTGGG - Intronic
909581920 1:77246440-77246462 CACCGTGCCCGGCCTCACATTGG - Intergenic
910128361 1:83871605-83871627 CACCGCGCCCGGCCTATCCCTGG - Intronic
910418886 1:87033830-87033852 CACCGCCCCCGGCCTTAAAGTGG + Intronic
911548839 1:99255080-99255102 CACCGCGCCCGGCCTGGGCTGGG - Intergenic
912277395 1:108273503-108273525 CACCGCGCCCGGCCGGAAAGTGG - Intergenic
912290833 1:108420853-108420875 CACCGCGCCCGGCCGGAAAGTGG + Intronic
912903678 1:113680467-113680489 CACCGCGCCCGGCCCTGTGTAGG - Intronic
912950938 1:114119781-114119803 CACCGTGCCCGGCCTGAGAGAGG - Intronic
913140116 1:115932766-115932788 CACCATGCCCGGCCTTTCATAGG - Intergenic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
914247109 1:145894396-145894418 CACCGCGCCCGGCCATGTAGTGG + Intronic
914434143 1:147645375-147645397 CACCGCGCCCGGCCTCAAACTGG + Exonic
914875192 1:151508296-151508318 CACCGTGCCCGGCCTTAAACGGG + Intergenic
915197117 1:154197762-154197784 CACCACGCCCAGCCTAGAAGAGG + Intergenic
915393498 1:155564203-155564225 CACCGCGCCCGGCCTTGCATGGG - Intergenic
915463696 1:156083512-156083534 CACCGCGCCCGGCCCTGAATAGG - Intronic
915694626 1:157726905-157726927 CACCGCGCCCGGCCGATTAGAGG + Intergenic
915779348 1:158529180-158529202 CACCGTGCCCAGCCCTGTAGAGG - Intergenic
915807639 1:158871155-158871177 CACCGCGCCCGGCCTCTTACTGG + Intergenic
915971668 1:160359473-160359495 CACCGCGCCCGGCCATGAACAGG + Intergenic
916096489 1:161356248-161356270 CACTGCACCCGGCCTTGAAAAGG - Intronic
916184890 1:162121405-162121427 CACCGTGCCCGGCCTTGGAGAGG + Intronic
916231325 1:162544167-162544189 CACCGCACCCGGCCTTTCATTGG + Intergenic
916928874 1:169553418-169553440 CACCGCGCCCGGCCTCATTGTGG - Intronic
917049614 1:170905397-170905419 CACCGTGCCCGGCCTTGCTTAGG - Intergenic
917150807 1:171942821-171942843 CACTGCACCCAGCCTTGCACTGG - Intronic
917382511 1:174429451-174429473 CACCGTGCCCGGCCCTCCATTGG - Intronic
917392240 1:174550729-174550751 CACCGCGCCCAGCTTGGTAGCGG - Intronic
917973891 1:180226533-180226555 CACCACGCCCGGCCATTCTGAGG - Intergenic
918058058 1:181039575-181039597 CACCGCGCCCGGCCTCATGGGGG - Intronic
918070013 1:181127883-181127905 CACCGCGCCTGGCCTGCCTGTGG + Intergenic
918243531 1:182640400-182640422 CACCCTGCCCGTCCTTCCAGGGG - Intergenic
918629491 1:186699257-186699279 CACCGCGCCCGGCCGGGCCCAGG - Intergenic
918870652 1:189969447-189969469 CACCGCGCCCGGCCATCCCCAGG + Intergenic
919202116 1:194368557-194368579 CACCACGCCCGGCCTAGGACAGG + Intergenic
919908273 1:202093406-202093428 CACCACGCCCGGCCAAGTAGTGG + Intergenic
920082613 1:203386192-203386214 CACCGCGCCCGGCCAGGGAAAGG + Intergenic
920315007 1:205070706-205070728 CACCGCGCCTGGCCTGCCATGGG - Intronic
921025490 1:211276797-211276819 CACCGCGCCCGGCCTAATATGGG - Intronic
921155097 1:212433044-212433066 CACCGCGCCCTGCCGAGCGGGGG + Exonic
921729571 1:218562311-218562333 CACCGCGCCCGGCCTGGGAAGGG - Intergenic
922385105 1:225074285-225074307 CACCGCGCCCGGCCTGTCTTAGG + Intronic
922472226 1:225883412-225883434 CACCGCGCCCGGCCATAAGGAGG - Intergenic
922527604 1:226317926-226317948 CACCGCGCCCGGCCGGCCATGGG + Intergenic
922936720 1:229428410-229428432 CACTGTGCTGGGCCTTGCAGAGG - Intergenic
922939551 1:229449657-229449679 CACCTCGCCCGGCCTGAGAGGGG + Intronic
923322432 1:232847906-232847928 CACCGCGCCCGGCCGCAGAGAGG - Intergenic
923429676 1:233908012-233908034 CACCACGCCCGGCCCAGAAGAGG + Intronic
923716756 1:236431631-236431653 CACCGCGCCCGGCCCTGCCTGGG - Intronic
923922783 1:238587506-238587528 CACCATGCCCGGCCGTGCAAAGG + Intergenic
924110761 1:240697195-240697217 CACCGCGCCCGGCCTGGTAAGGG + Intergenic
924122767 1:240819450-240819472 CACCACGCCCGGCCTCGTATCGG - Intronic
924370839 1:243348336-243348358 CACCGCGCCCGGCCTGGGGCGGG + Intronic
924379296 1:243446961-243446983 CACCGTGCCCGGCCAAGCATGGG - Intronic
924443714 1:244108469-244108491 CACCGCGCCCGGCCGCGACGTGG + Intergenic
924530712 1:244891538-244891560 CACCATGCCCGGCCTTGCAATGG + Intergenic
924763621 1:247011340-247011362 CACCGCACCCGGCCGTACGGAGG - Intergenic
924791872 1:247258177-247258199 CACCACGCCTGGCCTTCCATAGG + Intergenic
1062770755 10:98754-98776 CACCGCGCCTGGCCCCACAGTGG + Intergenic
1062847882 10:721830-721852 CACCGCGCCCGGCCCAGGACAGG + Intergenic
1063165078 10:3454337-3454359 CACAGCACCAGGCCTTCCAGCGG + Intergenic
1063271366 10:4513632-4513654 CACCGCGCCTGACCTTGATGAGG + Intergenic
1063347113 10:5322417-5322439 CACTGCGCCCGGCCATCCATGGG - Intergenic
1064081486 10:12311419-12311441 CACCGCGCCCGGCCTCAAACAGG - Intergenic
1064349076 10:14559855-14559877 CACCGCGCCCGGCCTCTCAGAGG + Intronic
1064505613 10:16026997-16027019 CACCGCGCCCGGCCTGGAGATGG - Intergenic
1064672636 10:17732155-17732177 CACCGCGCCCGGCCTAGATCTGG - Intergenic
1064786512 10:18903138-18903160 CACCGCGCCCGGCCTGGCATGGG + Intergenic
1064825445 10:19393741-19393763 CACCGCGCCCGGCCCTGATGGGG + Intronic
1065002353 10:21348454-21348476 CACCGCGCCCGGCCCAGAAAAGG + Intergenic
1065029220 10:21568104-21568126 CACCGCACCCGGCCTTGTTGGGG + Intronic
1065338953 10:24684925-24684947 CACCGCGCCCGGCCTAGGAATGG + Intronic
1065346191 10:24750045-24750067 CACCGCGCCCGGCCAACCTGAGG - Intergenic
1065531597 10:26675703-26675725 CACCGCGCCCGGCCTTAACTAGG - Intergenic
1065588257 10:27240906-27240928 GACCGCGCGCGTCCTTGCCGCGG - Intronic
1065751043 10:28887742-28887764 CACCACGCCCAGCCTTGTATAGG - Intergenic
1065991318 10:31013029-31013051 CACCGCGCCCGGCCCAGTTGGGG - Intronic
1066245427 10:33578713-33578735 CACCGCACCCGGCCCTGAAATGG + Intergenic
1066997386 10:42576842-42576864 CACGGCGCCCGGCCCTGGACTGG - Intronic
1067026481 10:42847500-42847522 CAGGGCGGCCGGCCTGGCAGGGG - Intergenic
1068703547 10:60047093-60047115 CACCGCGCCCGGCCTCAATGAGG + Intronic
1068843134 10:61638443-61638465 CACCGCGTCCGGCCTCACTGTGG + Intergenic
1069209508 10:65738604-65738626 CACCGTGCCCAGCATTGCATGGG - Intergenic
1069452387 10:68527724-68527746 CACCGCGCCCGGCCAGGTTGTGG - Intergenic
1070155217 10:73829586-73829608 CACCGCACACAGCCTTACAGTGG + Intronic
1070257589 10:74825406-74825428 CAGCCCGCCCGGCCTGGCCGGGG - Intergenic
1070898689 10:80008520-80008542 CACTGCGCCTGGCCTAGCTGTGG - Intergenic
1070989814 10:80721674-80721696 CACCGTGCCCAGCCTTGGATGGG + Intergenic
1071692936 10:87841905-87841927 CACCGCACCCGGCCTATCAGTGG - Intergenic
1071955929 10:90759365-90759387 CACCGCGCCCGGCCTTTCCCTGG - Intronic
1072571673 10:96663339-96663361 CACCGCGCCCAGCCTGCCATTGG - Intronic
1072656882 10:97335502-97335524 CGCCGCGCCCGGCCTAAGAGGGG + Intergenic
1072805017 10:98418712-98418734 CACCGTGGCCTGCCCTGCAGGGG + Intronic
1073157867 10:101362243-101362265 CACCGTGCCCGGCCTTGAGTTGG + Intronic
1073397537 10:103230425-103230447 CACTGCGCCCGGCCAGGAAGAGG + Intergenic
1073554776 10:104438661-104438683 CACCGCGCCCGGCCCATCAATGG + Intronic
1073792882 10:106957458-106957480 CACCGCACCTGGCCTAGCATAGG + Intronic
1074095601 10:110309147-110309169 CACCGCGCCTGGCCTTGAAATGG + Intergenic
1074473565 10:113749365-113749387 CACCGCGCCCGGCCAAGCATAGG - Intergenic
1074526674 10:114268998-114269020 CACCGCGCCCGGCCAAGCGGAGG + Intronic
1075089025 10:119432780-119432802 CACCGTGCCCGGCCCTGTAGTGG - Intronic
1075343298 10:121664125-121664147 CACCGCACCTGGCCCTGAAGAGG - Intergenic
1075422780 10:122315976-122315998 CACCGTGCCCGGCCTATGAGTGG - Intronic
1075790113 10:125077990-125078012 CACCGCGCCCGGCCTGAGAAAGG - Intronic
1075860210 10:125668868-125668890 CACCGTGCCCGGCCAAGCAGAGG - Intronic
1076064381 10:127437765-127437787 CACCATGCCCGGCCCTGCAATGG + Intronic
1076932595 10:133543111-133543133 CACCGCGCCCGGCCTACTACTGG + Intronic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077267426 11:1658541-1658563 CACCGCGCCCAGCCTAACATGGG - Intergenic
1077300930 11:1846586-1846608 CGCCGAGCCAGGCCTTGCTGGGG - Intergenic
1077369575 11:2175279-2175301 CACTGCGCCCGGCCTGACACTGG + Intergenic
1077473581 11:2776189-2776211 CACCACCCCCAGCCCTGCAGAGG + Intronic
1077627619 11:3787290-3787312 CACCGTGCCCGGCCTTAGAGAGG - Intronic
1077678308 11:4216655-4216677 CACCGCGCCCGGCCAGGCTCAGG + Intergenic
1077810323 11:5629992-5630014 CACCGCGCCCGGCCTCAGTGAGG + Intronic
1078164527 11:8870963-8870985 CGCCGCGCCCGGCCCGGCTGGGG - Intronic
1078985751 11:16594978-16595000 CACCGCGCCCGGCCTGGTTTTGG + Intronic
1079142803 11:17824011-17824033 CACCGCGCCCGGCCAAAAAGAGG - Intronic
1079248345 11:18769690-18769712 CACCGCGCCCGGCCAGGGACTGG + Intronic
1079250851 11:18786488-18786510 CACCGCACCCGGCCTAGAATAGG + Intronic
1079251768 11:18792160-18792182 CAGCGCGCACGGCCCTGCCGGGG - Intronic
1079626781 11:22625700-22625722 CCGTGCGCCGGGCCTTGCAGTGG - Exonic
1080696615 11:34608305-34608327 CACTGCGCCCAGCCTTGCTGAGG + Intergenic
1081117558 11:39222835-39222857 CACCGCGCCCGGCCGAGAAGAGG + Intergenic
1081199500 11:40199357-40199379 CACTGCGCCCAGCCTGGCAAAGG + Intronic
1081471647 11:43378189-43378211 CACCGCGCCCAGCCTTGGTTAGG + Intronic
1081645698 11:44788733-44788755 CACCGCACCCGGCCTGGAGGAGG + Intronic
1081861829 11:46337582-46337604 CACCGCGCCCAGCCTTAAAATGG + Intronic
1081882378 11:46464756-46464778 CACTGCGCCCGGCCTTGTCTCGG - Intronic
1082068701 11:47921250-47921272 CACCACGCCCGGCCTGCCACTGG + Intergenic
1082982656 11:59137443-59137465 CACCGCGCCCATCCTAGCTGTGG - Intergenic
1083237695 11:61362157-61362179 CACTGCGCACGGCCTTGCTGAGG - Exonic
1083274595 11:61589504-61589526 CACCTCGCCCGGCCTCCCTGTGG + Intergenic
1083419800 11:62546356-62546378 CGGGGCGCCCTGCCTTGCAGTGG + Intronic
1083605364 11:63975463-63975485 CACTGCGCCCGGCCTGGGAGGGG + Intronic
1083676214 11:64326597-64326619 CACCGCGCCTGGCCTATCGGGGG + Intergenic
1083689289 11:64397042-64397064 CACCGCGCCTGGCCTTATATGGG - Intergenic
1083715731 11:64575765-64575787 CAGCGCACCCGGCCTTGTTGTGG - Intergenic
1083830851 11:65232581-65232603 CACCGTGCCCAGCCTAGGAGTGG + Intergenic
1083917304 11:65756509-65756531 CACCGCGCCCGGCCAAGTACGGG + Intergenic
1084152702 11:67298348-67298370 CACCGCGCCCGGACTTATTGAGG + Intronic
1084184312 11:67463678-67463700 CACCGTGCCCGGCCATCCTGGGG + Exonic
1084408396 11:68992059-68992081 CACCGTGCCCGGCCTTGATGGGG + Intergenic
1084912898 11:72405638-72405660 CACCGTGCCCGGCCTTGAAGAGG - Intronic
1084988255 11:72897119-72897141 CACCACGCCCGGCCGTCCTGTGG + Intronic
1085281507 11:75334041-75334063 CACCGCGCCCGGCCTGGGATGGG - Intronic
1086187274 11:84033748-84033770 CACCGCGCCCGGCCCGGCTGTGG - Intronic
1086459804 11:86995225-86995247 CACTGCGCCCGGCCCAGCTGGGG + Intergenic
1086474642 11:87158750-87158772 CACCGCGCCCGGCCTAACCTTGG + Intronic
1087556387 11:99727016-99727038 CACCGCGCCCGGCCATGCCCTGG - Intronic
1087565103 11:99845658-99845680 CACCGCGCCCGGCCCTTCTTGGG + Intronic
1088075674 11:105845592-105845614 CACCGTGCCCGGCCTGGGATAGG - Intronic
1088556838 11:111070617-111070639 CACTGCTCCCGGCCTGGCATGGG - Intergenic
1088967097 11:114734818-114734840 CACTGCGCCCTGCCGTGCAATGG - Intergenic
1089342713 11:117770233-117770255 CACAGTGCCAGGCCTTGCAGAGG - Intronic
1090279385 11:125443022-125443044 CACCACGCCCGGCCCTGTGGTGG + Intergenic
1090813354 11:130267773-130267795 CACTGCGCCCGGCCTTCACGAGG - Intronic
1091432491 12:448331-448353 CACCGCGCCCGGCCAAAGAGGGG + Intergenic
1091436852 12:480201-480223 CACCGCGCCCGGCCAGGATGGGG + Intronic
1091455479 12:604347-604369 CACCGCACCCGGCCAGGCTGTGG - Intronic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1091872558 12:3906599-3906621 CACCGCGCCCGGCCATGTTTGGG + Intergenic
1091872813 12:3909196-3909218 CACCGCGCCCGGCCTTCTTCAGG - Intergenic
1092133560 12:6130035-6130057 CACCGCGCCCGGCCTTGTTCTGG - Intergenic
1092252572 12:6908306-6908328 CACCGCGCCCGGCCTGATTGTGG - Intronic
1092254463 12:6918691-6918713 CACCGCGCCCGGCCTTCCAGTGG - Intronic
1092338436 12:7654918-7654940 CACCGCACCCGGCCTCTAAGAGG - Intronic
1092892064 12:12978489-12978511 CACCACGCCCGGCCTGGAAAGGG + Intronic
1093499729 12:19798314-19798336 CACCGCGCCCGGCCAAGAAGGGG - Intergenic
1095249369 12:39960665-39960687 CACCGCGCCCGGCCTAATATTGG + Intronic
1095745965 12:45659370-45659392 CACCGCGCCCAGCCTGACAAAGG - Intergenic
1096066175 12:48742593-48742615 CACTGCGCCTGGCCTGGCAGTGG - Intergenic
1096365735 12:51026886-51026908 CACCGCGCCCGGCCTTTGCTTGG - Intronic
1097246915 12:57611847-57611869 CACCCGGGCCGGCCATGCAGGGG - Intronic
1097858510 12:64493180-64493202 CACTGCGCCCGGCTTCGTAGTGG + Intronic
1098898646 12:76090143-76090165 CACCGCGCCCAGCCTAACAATGG - Intergenic
1099218510 12:79882848-79882870 CACCGCGCCTGGCCTAGTGGAGG - Intronic
1099962517 12:89410389-89410411 CACCGCGCCCGACCTTGTGCCGG - Intergenic
1100877726 12:98980492-98980514 CACCGCGCCCGGCCGCACATAGG + Intronic
1101151394 12:101885814-101885836 CACCGCGTCCGGCCTCCCAGTGG + Intronic
1101895192 12:108751179-108751201 CACCGTGCCCGGCCTAGAAATGG - Intergenic
1101982320 12:109418102-109418124 CACCGCGCCCGGCCTAAGATTGG + Intronic
1102050259 12:109856769-109856791 CACCGTGCCCGGCCGTGAGGAGG - Intronic
1102311041 12:111844477-111844499 CACCGCGCCCAGCCTTGGTTTGG + Intronic
1102359209 12:112269159-112269181 CACCGCGCCCGGCCCTGAAAAGG + Intronic
1102976247 12:117209009-117209031 CACCACGCCTGGCCTGGGAGGGG + Exonic
1103109566 12:118263775-118263797 CACCGTGCCCGGCCTCTCATGGG - Intronic
1103369646 12:120409068-120409090 CACCGCGCCCGGCCCTAATGGGG - Intergenic
1103388394 12:120552104-120552126 CACCTCGCCCGGCCAGGAAGAGG - Intronic
1103552931 12:121749391-121749413 CACCGCGCCCGGCCTTGAGTTGG - Intronic
1103593007 12:122005577-122005599 CACCCAGCCCAGCCTGGCAGGGG + Intergenic
1103706613 12:122878070-122878092 CACCGCACCCGGTCTAGCAGTGG - Intronic
1103756970 12:123215947-123215969 CACCGCGCCCGGCCTTCTCTTGG - Intronic
1103762805 12:123263814-123263836 CACCGTGCCCGGCCTGGGAGAGG - Intronic
1103774150 12:123353084-123353106 CACCGCGCCCAGCCTCCCAAAGG + Intronic
1103816881 12:123665380-123665402 CACTGCGCCCGGCCATTAAGAGG - Intergenic
1104045717 12:125161129-125161151 CACCATGCCCAGCCTTGCAAAGG - Intergenic
1104101810 12:125619651-125619673 CACCATGCCCGGCCCTGCTGTGG + Intronic
1104873429 12:132016658-132016680 CACCGCACCCGGCCTTGGTTGGG + Intronic
1104944740 12:132410530-132410552 CAAAGCACCCGGCCCTGCAGAGG - Intergenic
1105071587 12:133236849-133236871 CACCGTGCCCGGCCTTGAGTTGG + Intergenic
1105518822 13:21113682-21113704 CACCATGCCCGGCCTTGCCCTGG + Intergenic
1106234038 13:27846379-27846401 CACTGCGCCCGGCCCCTCAGTGG - Intergenic
1106251408 13:27984688-27984710 CACCGCGCCCAGCCTTAAAATGG - Intronic
1106480078 13:30130838-30130860 CACCGCGCCCGGCCCAGGTGTGG - Intergenic
1106874826 13:34060148-34060170 CACTGCGCCCGGCCATACATGGG + Intergenic
1107413195 13:40176625-40176647 CACCGCACCCGACCTGGCAAAGG - Intergenic
1107461330 13:40606599-40606621 CACCGCGCCCGGCCATGAAAAGG + Intronic
1107833495 13:44395314-44395336 CACCGTGCCCGGCCTTGGGTGGG - Intronic
1107876972 13:44799615-44799637 CACTGCGCCCGGCCAGGCATAGG + Intergenic
1109231050 13:59757686-59757708 CACCGCGCCCGGCCTATTATGGG + Intronic
1109430670 13:62229943-62229965 CACTGCACCCAGCCTTGCCGAGG + Intergenic
1109586672 13:64413086-64413108 CACCGCGCTCGGCCAAGTAGAGG + Intergenic
1110070740 13:71174075-71174097 CGCCACGCCCGGCCCTCCAGTGG - Intergenic
1110259967 13:73474039-73474061 CACCGTGTCCGGCCTTAGAGTGG + Intergenic
1110417742 13:75270432-75270454 CACCGCGCCCGGCCAGAGAGTGG + Intergenic
1111120933 13:83847974-83847996 CACCGCGCCAGGCCTTGACCGGG - Intergenic
1111122121 13:83866496-83866518 CACCGCGCCCGGCCTGGTGGGGG + Intergenic
1111421128 13:88012588-88012610 CACCGCGCCCGGCCTTTTAGTGG - Intergenic
1111772467 13:92615764-92615786 CACCGCGCCCAGCCTGGTAGGGG - Intronic
1112292347 13:98155805-98155827 CACTGCGCCTGGCCCTGCTGTGG + Intronic
1112470645 13:99685671-99685693 CACCGTGCCCGGCCTCTAAGAGG - Intronic
1112580736 13:100674705-100674727 CGGCGCGCTCGGCCCTGCAGGGG + Intronic
1112892838 13:104260035-104260057 CACCGCGCCCGGCCGTAAAAGGG - Intergenic
1112908799 13:104456405-104456427 CACCGCGCCCGGCCCTTTAGGGG + Intergenic
1113233635 13:108243021-108243043 CACCGTGCCCGGCCTAGCAAGGG + Intergenic
1113289195 13:108886273-108886295 CACCGCGCCCGGCCCTCCTTTGG + Intronic
1113379146 13:109786822-109786844 CACCCCGCCCGGCCGGGCCGGGG - Intergenic
1113840482 13:113357021-113357043 CACTGCGCCCGGCCCTTAAGAGG - Intronic
1113846564 13:113394924-113394946 CACTGCGCCCGGCCTTATATTGG + Intergenic
1114059785 14:19008393-19008415 CTCCTGGCCCAGCCTTGCAGAGG + Intergenic
1114060594 14:19013307-19013329 CTCCTGGCCCAGCCTTGCAGAGG + Intergenic
1114101663 14:19386671-19386693 CTCCTGGCCCAGCCTTGCAGAGG - Intergenic
1114102760 14:19393358-19393380 CTCCTGGCCCAGCCTTGCAGAGG - Intergenic
1114324776 14:21577718-21577740 CACCGCGCCCGGCCTCCCTCGGG - Intergenic
1115096958 14:29648940-29648962 CACCATGCCCGGCCTGGCTGGGG + Intronic
1115269350 14:31534510-31534532 CACCGCGCCCAGCCTGAGAGTGG + Intronic
1115964880 14:38877030-38877052 CACCGCGCCCGGCCCTGACTTGG - Intergenic
1116257972 14:42581945-42581967 CACCGCGCCCGGCCTGTAATAGG + Intergenic
1116667176 14:47792337-47792359 CACTGCGCCCGGCCTTTTTGTGG + Intergenic
1116887325 14:50233623-50233645 CACCTCGCCCGGCCCTGAATGGG - Intergenic
1117135038 14:52726928-52726950 CACCGTGCCCAGCCTTGAACCGG + Intronic
1117196997 14:53350205-53350227 CACCACACCCGGCCTGGCACTGG + Intergenic
1117351562 14:54886322-54886344 CACCGCGCCCGGCCTATAACTGG - Intronic
1117542405 14:56761265-56761287 CACCGCGCCCGGCCACCTAGAGG - Intergenic
1118266813 14:64302473-64302495 CACCGCGCCCGGCCTCACCTGGG + Intronic
1118349599 14:64964233-64964255 CACCACGCCCGGCCTAAAAGTGG - Intronic
1118816890 14:69320204-69320226 CACCGCGCCCGGCCATCAAGAGG - Intronic
1119307984 14:73623197-73623219 CACCACGCCTGGCCTTATAGTGG + Intergenic
1119454664 14:74744596-74744618 CACCGCGCCCGGCCTTGAGACGG + Intergenic
1119522312 14:75295078-75295100 CCCCTCGCCCGGCCTGGAAGAGG - Intergenic
1119740947 14:77013418-77013440 CACCGCGCCCGGCCTACCACAGG - Intergenic
1120172435 14:81259115-81259137 CACCACGCCCGGCATTGAAAAGG + Intergenic
1120887619 14:89464070-89464092 CACCGCGCCCGGCCTGGTAGTGG + Intronic
1120977053 14:90257876-90257898 CACCGCGCCCGGCCTCATAGAGG + Intronic
1121044001 14:90774749-90774771 CACCGCGCCCAGCCTAGCGGGGG - Intronic
1121629739 14:95413508-95413530 CATCCTGCCCTGCCTTGCAGGGG - Intronic
1121678367 14:95772602-95772624 CACCGCACCCGGCCACCCAGGGG + Intergenic
1122101904 14:99419485-99419507 CACCGCGCCCGGCCATAAAAAGG - Intronic
1122551538 14:102552759-102552781 CACCGCGCCCGGCCTATGGGAGG + Intergenic
1122687384 14:103516017-103516039 CACCGTGCCCGGCCAGGCTGAGG - Intergenic
1122808080 14:104270832-104270854 CACCGCGCCCGGCCGCACAGGGG - Intergenic
1123486791 15:20747885-20747907 CACCATGCCCGGCCTAGCATGGG + Intergenic
1123543281 15:21316938-21316960 CACCATGCCCGGCCTAGCATGGG + Intergenic
1123698197 15:22894576-22894598 CACCACGCCCGGCCTAGAGGAGG + Intronic
1123781774 15:23635566-23635588 CACCGCGCCCGGCCTCCCTTGGG - Intergenic
1124385266 15:29203112-29203134 CACCGTGCCCGGCCTAGGAACGG - Intronic
1124602482 15:31146696-31146718 CACCGCACCCGGCCTTGAATTGG - Intronic
1124611588 15:31213436-31213458 CACCGCGCCTGGCCTAGGACTGG - Intergenic
1125048443 15:35270085-35270107 CACCGCGCCCGGCCTTGTTAAGG + Intronic
1125625809 15:41108299-41108321 CACCACGCCCGGCCTATCTGTGG - Intronic
1125838907 15:42779689-42779711 CACCGCGCCCAGCCTTGAATTGG - Intronic
1125876020 15:43145491-43145513 CACCGCGCCTGGCCCTGAAATGG + Intronic
1125960989 15:43829792-43829814 CACCGCGCCTGGCCTAGCACGGG + Intronic
1126600592 15:50423895-50423917 CACCGTGCCCAGCCTCGCCGGGG + Intergenic
1126734326 15:51716143-51716165 CACCGCGCCCAGCAAGGCAGTGG + Intronic
1127149366 15:56057637-56057659 CACCGCGCCCGGCCTAACACAGG - Intergenic
1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG + Intergenic
1128327116 15:66731148-66731170 CACCGCGCCCGGCCTCACCAAGG - Intronic
1128634504 15:69294395-69294417 CACCGCACCCGGCCTGGCCATGG - Intergenic
1128734977 15:70048372-70048394 CCACGCGCCCAGCCTTGGAGAGG + Exonic
1128906303 15:71470921-71470943 CACCGCGCCCGGCCTGAGTGAGG + Intronic
1128935851 15:71745931-71745953 CACTGCGCCTGGCCTTGAACTGG + Intronic
1129203048 15:74017083-74017105 CGCCGCGCCCGGCCGGGCAGTGG + Intronic
1129421756 15:75433564-75433586 CACCACGCCCGGCCTATGAGTGG - Intronic
1129436665 15:75547005-75547027 CACCGTGCCTGGCCTGGCACAGG - Intronic
1129543916 15:76374773-76374795 CACTGCGCCCGGCCAAGTAGGGG + Intronic
1129818119 15:78574099-78574121 CACCGTGCCCGGCCTAGAATTGG + Intronic
1130315434 15:82791284-82791306 CACCGCACCCGGCAATTCAGTGG + Intronic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1130565157 15:84987763-84987785 CACCGCGCCCGGCCTTGGATTGG + Intronic
1130722714 15:86405221-86405243 CACCGCGCCCGGCCAGGCATAGG - Intronic
1131243436 15:90769012-90769034 CACCGCACCCGGCCTTATAGAGG + Intronic
1132355059 15:101165080-101165102 CACCGTGCCCGGCCATGAAGTGG + Intergenic
1202951600 15_KI270727v1_random:44067-44089 CACCATGCCCGGCCTAGCATGGG + Intergenic
1132488652 16:212003-212025 CACCGCGCCCGGCCCCTCTGCGG - Intronic
1132718628 16:1304856-1304878 CACCGCGCCCGGCCTTGTTTTGG + Intergenic
1132874342 16:2129414-2129436 CACCGCGCCCGGCTGGACAGTGG + Intronic
1132980185 16:2734631-2734653 CACCGCTCCCGGCCTCACTGTGG - Intergenic
1133118832 16:3594153-3594175 CACCGCGCCCGGCCAAACAATGG + Intronic
1133121170 16:3609113-3609135 CACCGCGCCCGGCCCAGTTGTGG - Exonic
1133800656 16:9082445-9082467 CACCGTGCCCGGCCCAGCTGTGG + Intergenic
1133822808 16:9251624-9251646 CACCGCGCCCGGCCATGGTTTGG + Intergenic
1133927596 16:10205709-10205731 CACCGCGCCCGGCCTTTAACCGG + Intergenic
1134093978 16:11406718-11406740 CACCGTGCCCGGCCTTCCCCCGG + Intronic
1134206051 16:12238610-12238632 CACCGCGTCCGGCCTTGAATAGG + Intronic
1134272748 16:12747704-12747726 CACCGCGCCCGGCCTTAACGAGG + Intronic
1134540940 16:15064876-15064898 CACCGCGCCCGGCCAGGAGGTGG - Intronic
1134553287 16:15148243-15148265 CACCGCGCCCGGCTGGACAGTGG + Intergenic
1134833797 16:17344991-17345013 CACTGCGCCCGGCCTAACACAGG + Intronic
1135122395 16:19777760-19777782 CACCGTGCCCGGCCCTGAACTGG - Intronic
1135302210 16:21340373-21340395 CACCGCGCCCGGCCTCGACCTGG - Intergenic
1135768514 16:25198538-25198560 CACCGCGGCCGGCCTAGCCCTGG - Intergenic
1135794114 16:25424968-25424990 CACCGTGCCCGGCCTGGCATGGG + Intergenic
1136263866 16:29102461-29102483 CACCGCGCCCGGCCAGGAGGTGG + Intergenic
1136387522 16:29938763-29938785 CACCGCACCCGGCCAGGAAGAGG - Intergenic
1136411384 16:30079474-30079496 CACCGCGCCCGGCCTAGCTTCGG + Intronic
1136489799 16:30599562-30599584 CACCGCGCCCGGCCATGTGTGGG + Intergenic
1136851061 16:33612804-33612826 CACCGTGCCCGGCCTCACATGGG - Intergenic
1137609083 16:49807141-49807163 CACCGCCCCCGGCCTGGCTTGGG - Intronic
1137922550 16:52505120-52505142 CACCGCACCCGGCCAAGAAGAGG + Intronic
1138897248 16:61221789-61221811 CACCGTGCCCGGCCATGTATGGG + Intergenic
1139458904 16:67106835-67106857 CACCGCGCCCGGCCGAGCTTGGG - Intergenic
1139571812 16:67817566-67817588 CACCGCGCCCGGCCAAGGACTGG + Intronic
1139930863 16:70524964-70524986 CACCGCGCCCGGCCCAGACGTGG + Intronic
1140281210 16:73556805-73556827 CACCGCGCCCGGCCTCACTGAGG - Intergenic
1140401889 16:74678493-74678515 CACCATGCCCGGCCTTGCCTTGG - Intronic
1140673092 16:77298501-77298523 CATCGTGCCCGGCCTTGATGTGG - Intronic
1141326558 16:83065414-83065436 CACCACGCCCAGCCTGGAAGTGG - Intronic
1141430594 16:83968709-83968731 CCCAGCGCCCGGCCCTGCTGCGG - Exonic
1141621584 16:85239218-85239240 CACCACGCCAGGCCTGGCAGTGG + Intergenic
1141640367 16:85337591-85337613 CACCGCGCCCGGCCAGGCTCAGG + Intergenic
1141675871 16:85517083-85517105 CACCGCGCCCGGCCATGTCTTGG + Intergenic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1142153499 16:88522915-88522937 CACCGCGCCTGGCCTTGGGAGGG - Intronic
1142201769 16:88764462-88764484 CACCGCGCCCGGCCTGGCAGGGG - Intronic
1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG + Intergenic
1142580397 17:938391-938413 CGCCGCGCCCGGCCGGGCTGGGG - Intronic
1142637579 17:1267769-1267791 CACCGCTCCCGGCCCTGAACTGG - Intergenic
1142646151 17:1315170-1315192 CACCGTGCCCGGCCGGGGAGAGG - Intergenic
1142805796 17:2370509-2370531 CACCACTCCCGGCCCCGCAGTGG + Intronic
1143171260 17:4932043-4932065 CCACGCGCCCGGCCCTGGAGAGG + Intergenic
1143197141 17:5084561-5084583 CACCGCGCCCGGCCTGAATGAGG + Intronic
1143220647 17:5258510-5258532 CACCGCGCCTGGCCTGGATGTGG - Intergenic
1143287669 17:5802279-5802301 CACCGCGAGCTGCCTTGCAAGGG + Intronic
1143440605 17:6970186-6970208 CACCACGCCTGGCCCAGCAGGGG - Intronic
1143509136 17:7385851-7385873 CACCGTGCCCGGCCTGGATGAGG + Intronic
1143525480 17:7469472-7469494 CACCGTGCCCGGCCTTAAAGAGG - Intronic
1143527414 17:7480429-7480451 CACCGCGCCCAGCCTCAGAGAGG - Intronic
1143558024 17:7674646-7674668 CACTGCGCCCAGCCAAGCAGGGG + Intronic
1143564671 17:7714477-7714499 CACTGTGCCTGGCCTTGCAGTGG + Intergenic
1143618113 17:8065428-8065450 CACCACGCCCAGCCCAGCAGTGG + Intergenic
1143643518 17:8214149-8214171 CACCGTGCCCGGCCTTATAAAGG + Intergenic
1143878476 17:10011686-10011708 CACCGCACCCGGCCTTGAGATGG - Intronic
1144099835 17:11933666-11933688 CACCGCGCCCGGCCTTCTTCAGG + Intronic
1144179675 17:12740221-12740243 CACTGCGCCCGGCCCTTTAGTGG + Intronic
1144222885 17:13115607-13115629 CACCGCGCCCGGCCCAGAAACGG - Intergenic
1144347297 17:14360609-14360631 CACCGCGCCCGGCCATGGTGAGG + Intergenic
1144417101 17:15059635-15059657 CACCGCGCCCGGCCTATTTGTGG - Intergenic
1144543393 17:16168487-16168509 CACCGCGCCCAGCCAAGAAGTGG + Intronic
1144820839 17:18072929-18072951 CACTGCGCCTGGCCGTGCAGTGG + Intergenic
1145179381 17:20732255-20732277 CACCGCGCCTGGCCAAGTAGGGG + Intergenic
1145228408 17:21151216-21151238 CACCGCACCCAGCCTAGAAGTGG - Intronic
1145950610 17:28813832-28813854 CACCGCGCCCGGCATGGAATAGG + Intronic
1146001873 17:29135388-29135410 CACCGCGCCCGGCCAAGAACTGG + Intronic
1146033063 17:29383067-29383089 CACCGCGCCCGGCCTAGGTCAGG - Intergenic
1146115276 17:30131958-30131980 CACCGCGCCTGGCCTTGCACTGG - Intronic
1146206841 17:30912164-30912186 CACCGCGCCCGGCCAAGCCCAGG + Intronic
1146762000 17:35487227-35487249 CACCGCGCCCGGCCGCCCTGCGG + Intronic
1146801947 17:35831792-35831814 CACCACGCCCGGCCTCTCAGAGG - Intronic
1146852321 17:36233452-36233474 CACTGCGCCCGGCCAAGTAGGGG - Intronic
1146868230 17:36357323-36357345 CACTGCGCCCGGCCAAGTAGGGG - Intronic
1146969067 17:37057695-37057717 CACCACGCCCGGCCTCGTTGTGG + Intergenic
1147071104 17:37957941-37957963 CACTGCGCCCGGCCAAGTAGGGG - Intergenic
1147082631 17:38037467-38037489 CACTGCGCCCGGCCAAGTAGGGG - Intronic
1147098574 17:38161435-38161457 CACTGCGCCCGGCCAAGTAGGGG - Intergenic
1147284975 17:39395134-39395156 CACCACGCCCGGCCTAGAAGTGG - Intronic
1147385997 17:40082648-40082670 CACCGCGCCCGGCCAAGGGGTGG + Intronic
1147397539 17:40156396-40156418 CACCGCGCCTGGCCGTTCAAAGG - Intronic
1147594195 17:41706156-41706178 CACCACGCCTGGCCTAACAGTGG - Intergenic
1147705856 17:42424235-42424257 CACCGCGCCTGGCCTAAGAGAGG - Intergenic
1147726335 17:42568071-42568093 CACCGCGCCCGGCCACACAATGG - Intronic
1148291857 17:46458827-46458849 CACCGTGCCCGGCCTCCCATGGG + Intergenic
1148451237 17:47778979-47779001 CACCGCGGCCGGTCTTGGGGTGG - Intergenic
1148534237 17:48424969-48424991 CACCCCGCCTGGCCTTACTGAGG - Intronic
1148827188 17:50402495-50402517 CACCGCGCCCAGCCTTACCTAGG + Intergenic
1149130006 17:53287718-53287740 CACCGCGCCCGGCCTTTAGTTGG + Intergenic
1149156255 17:53633137-53633159 CACCGCGCCCGGCCTACCAGTGG + Intergenic
1150080113 17:62230461-62230483 CACCGCGCCCGGCCAAGTAGGGG - Intergenic
1150226854 17:63529121-63529143 CACCACGCCCGGCCAGGCATGGG + Intronic
1150255740 17:63742639-63742661 CACCGCGCCCGGCCTTCCAGGGG - Intronic
1150256305 17:63748399-63748421 CACCGCGCCCGGCCTATCTTAGG + Intronic
1150271093 17:63865676-63865698 CACCGTGCCTGGCCTTCCAAAGG - Intergenic
1150346175 17:64406327-64406349 CACTGCCCCCGGCCTTAGAGTGG + Intronic
1150789423 17:68189610-68189632 CACCGCGCCCGGCCTTGTCCTGG + Intergenic
1151251979 17:72843235-72843257 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1151464090 17:74273461-74273483 CACCGCGCCCGGCAAAGCTGGGG - Intergenic
1151664544 17:75538097-75538119 CACCTCGCCCAGCCTGGAAGGGG + Intronic
1151925120 17:77189914-77189936 CACCGCGCCCGGCCTTAACAGGG + Intronic
1152010942 17:77715912-77715934 CACCGCGACCTGCCTTTTAGTGG + Intergenic
1152024418 17:77799394-77799416 CACCGCGCCCGGCCTTTGCGGGG - Intergenic
1152332735 17:79682609-79682631 CACCCCGCCTGGCCTTGAATAGG - Intergenic
1152394018 17:80020962-80020984 CACCGTGCCCGGCCCTGCCCAGG - Intronic
1152399563 17:80057586-80057608 CACCGCGCCCGGCCATGAGATGG - Intronic
1152547619 17:81009797-81009819 CACCACGCCCGGCCATGAACTGG - Intergenic
1152691620 17:81720709-81720731 CACCGCTGCCTGCCCTGCAGTGG + Exonic
1152695949 17:81795567-81795589 CACCGCACCCGGCCTTTCCTAGG - Intergenic
1152895841 17:82910851-82910873 CACCGCGCCCAGCCTCCTAGTGG + Intronic
1153096174 18:1407039-1407061 CACCGCGCCCGGCCTAATAAAGG - Intergenic
1153272501 18:3336366-3336388 CACCGCGCCCGGCCTATGAATGG + Intergenic
1153351824 18:4089755-4089777 CACCGTGCCCGGCCAGGAAGAGG - Intronic
1153654677 18:7272228-7272250 CACCGGGCCCGGCCTCACAGAGG + Intergenic
1154391588 18:13941229-13941251 CACCGCGCCCGGCCTTTTTAAGG + Intergenic
1155445565 18:25908613-25908635 CACCTCGCCCAGCCTTGCTGAGG + Intergenic
1155516806 18:26631758-26631780 CACCGCGCCCGGCCATGAAATGG - Intronic
1155954706 18:31947198-31947220 CACCGTGCCCGGCCCTGAAGAGG - Intronic
1156233928 18:35183039-35183061 CACCGTGCCCGGCCCTGTATAGG + Intergenic
1156469001 18:37365772-37365794 CACCGCACCCGGCCTGGGATGGG + Intronic
1157233832 18:45944464-45944486 CACCGCGCCCGGCCCATCTGTGG - Intronic
1157375425 18:47159905-47159927 CACCGCGCCCGGCCAAGGATGGG - Intronic
1157832324 18:50867824-50867846 CACCGCGCCCAGCCCTGGAGTGG + Intergenic
1159955845 18:74517984-74518006 CACCGCGCCCGGCCAGAAAGAGG - Intronic
1160349207 18:78160069-78160091 CACCGCGCCCGGGCCAGCAGTGG - Intergenic
1160700773 19:506315-506337 CACCGCGCCCGGCCTACCACAGG + Intergenic
1160705681 19:529082-529104 CACCGCGCCCGGCCTGGGTTGGG - Intergenic
1160758427 19:770551-770573 CACCGCGCCCGGCCCTGTCCAGG - Intergenic
1160787584 19:908316-908338 CACTGCGCCCGGCCAGGCATGGG - Intronic
1160842597 19:1152862-1152884 CACCGCGCCCGGCCCTGCCTGGG - Intronic
1160856384 19:1219831-1219853 TACCACGCCCGGCCTTGTAAAGG + Intronic
1160936897 19:1600499-1600521 CACCGCGCCCGGCCGGGCACAGG + Intronic
1160942313 19:1626160-1626182 CACCGTGCCCGGCCTTAGAACGG - Intronic
1160944287 19:1634012-1634034 CACCACACCAGGCCTTCCAGGGG - Intronic
1160993735 19:1872417-1872439 CACCGCGCCCAGCCTAGTGGTGG + Intergenic
1161013805 19:1973213-1973235 CACCGCGCCTGGCCTTGCTTTGG + Intronic
1161110847 19:2469151-2469173 CACCGCGTCCGGCATTCGAGTGG + Intergenic
1161239304 19:3213177-3213199 CACTGCGCCCGGCCTGGAGGGGG + Intergenic
1161243191 19:3234385-3234407 CACCGCGCCCAGCCATGATGTGG + Intronic
1161279826 19:3439974-3439996 CACCGCGCCCGGCCAAACACTGG + Intronic
1161328489 19:3674787-3674809 CACCGTGCCCGGCCTATCTGTGG + Intronic
1161365263 19:3875575-3875597 CACCGCGCCCGGCCTCTCCTTGG + Intergenic
1161455716 19:4368781-4368803 CACCGCGCCCGGCCAACGAGGGG - Intronic
1161584200 19:5096371-5096393 CACCGCGCCTGGCCATGGCGTGG + Intronic
1161624611 19:5319121-5319143 CACTGCGCCCGGCCTTGGGATGG - Intronic
1161756017 19:6134971-6134993 CACCGCGCCTGGCCTGGGAGTGG - Intronic
1161797544 19:6395917-6395939 CACCGCGCCCGGCCTCTTAGGGG - Intergenic
1161843550 19:6696751-6696773 CACCGCGCCCGGCAATGCTAGGG - Intronic
1162200351 19:9015467-9015489 CACCGCACCCGGCCAGGGAGTGG + Intergenic
1162573090 19:11483616-11483638 CACCACGCCCGGGCTTGCCGGGG - Exonic
1162612326 19:11766523-11766545 CACCACGCCCGGCTTTGTTGGGG + Intergenic
1162630228 19:11921789-11921811 CACTGCGCCCGGCCCTGAAATGG + Intergenic
1162706762 19:12560891-12560913 CACCGCGCCCGGCCTTCTGTAGG + Intronic
1162772255 19:12956307-12956329 CACCGCCCCCGGCCTGGGACAGG + Intronic
1162893778 19:13752317-13752339 CACTGTGCCTGGCCTTGCAATGG - Intronic
1162996675 19:14340184-14340206 CACCGTGCCTGGCTTTGCAGAGG - Intergenic
1162998265 19:14350119-14350141 CACCGCGCCTGGCCAAGCATTGG - Intergenic
1163120087 19:15212187-15212209 CACCTCGCCCGGCCCTGAAGTGG - Intergenic
1163165284 19:15493190-15493212 CACCGCGCCCAGCCTCGGGGTGG + Intronic
1163167565 19:15508473-15508495 AACCCCGCCCGGCCGTGCCGAGG - Exonic
1163313659 19:16528663-16528685 CACCGCACCCGGCCTAGCAAAGG - Intronic
1163315759 19:16539433-16539455 CACCGCGCCCGGCCTAGCAACGG + Intronic
1163390328 19:17026792-17026814 CTCCGCGCCCGGCCAAGCTGGGG + Exonic
1163435597 19:17293383-17293405 CACCGCGCCCGGCCTGGAGGAGG + Intronic
1163495331 19:17643298-17643320 CACCGCGCCCGGCCAGCCATGGG + Intronic
1163536366 19:17879002-17879024 CACCGCGCCCAGCCTTGTTTTGG - Intronic
1163611246 19:18302911-18302933 CACCGCGCCCGGCCCTGTAGGGG + Intergenic
1163614279 19:18317633-18317655 CACCGCACCCGGCCCTGAACTGG + Intronic
1163670731 19:18626870-18626892 CACTGCGGCCGGCCCTGCTGTGG + Intergenic
1163766140 19:19164523-19164545 CACCGCACCCGGCCTGGAACAGG - Intronic
1163818870 19:19484819-19484841 CACCGCGCCCAGCCTGTCATAGG + Intronic
1163856196 19:19704203-19704225 CACTGCACCCGGCCTAGCTGTGG - Intergenic
1163879271 19:19903025-19903047 CACCGCGCCCGGCCTTTGGGAGG + Intronic
1163886021 19:19965734-19965756 CACCACGCCCAGCCTTGGATGGG + Intergenic
1163898328 19:20078832-20078854 CACCGCGCCTGGCCGGGAAGGGG - Intronic
1163933794 19:20423755-20423777 CACCGCGCCCGACCAGGAAGTGG + Intergenic
1163958257 19:20664000-20664022 CACCATGCCCGGCCTTGGATGGG + Intronic
1164228597 19:23268027-23268049 CACCGCACCTGGCCTTACATTGG - Intergenic
1164587727 19:29487119-29487141 CACCGCGCCTGGCCTTGCATGGG - Intergenic
1164753572 19:30673260-30673282 CACAGCGCCTGGCCCTTCAGGGG + Intronic
1165044735 19:33095688-33095710 CACCGCGCCCGGCCTGGTCGGGG + Intronic
1165191707 19:34069095-34069117 CACCGCGCCCGGCCTGTAATTGG + Intergenic
1165243450 19:34484211-34484233 CACCGTGCCCGGCCCTGAACTGG + Intronic
1165453329 19:35897530-35897552 CACCACGCCCGGCCTGGAAAAGG + Intronic
1165460072 19:35939252-35939274 CACCGCGCCTGGCCTTCCTCTGG + Intronic
1165546413 19:36540503-36540525 CACTGCGCCCGGCCTTGTTCAGG - Intronic
1165724743 19:38104857-38104879 CACCGCGCCTGGCCAGGAAGTGG + Intronic
1165752624 19:38269895-38269917 CACCGCGCCCGGCCTGAGATGGG + Intronic
1165759889 19:38314968-38314990 CACCGCACCCGGCATGGAAGAGG - Intronic
1165794487 19:38511005-38511027 CACCACGCCCGGCCTTGAGTTGG - Intronic
1165979534 19:39708096-39708118 CACCGTGCCCAGCCTTTCAGAGG + Intronic
1166208386 19:41288530-41288552 CACCATGCCCGGCCTTGGTGGGG + Intronic
1166223727 19:41382153-41382175 TACCACGCCCGGCCATGCGGGGG + Intronic
1166282882 19:41806973-41806995 CACCGCACCCGGCCTTGTCTTGG + Intronic
1166397682 19:42453908-42453930 CACCGCGCCCGGCCAATCAGGGG + Intergenic
1166793967 19:45415043-45415065 CACCGCGCCCGGCCTAGTATTGG - Intronic
1166855458 19:45780855-45780877 CCCCGCCCCAGGCCTGGCAGGGG + Intronic
1166954737 19:46455832-46455854 CACCGCGCCTGGCCTGGAACGGG - Intergenic
1167440793 19:49507685-49507707 CACCGCGCCCGGCCTTGCCAGGG + Intronic
1167478440 19:49714011-49714033 CACCGCGCCCGGCCTGGAGATGG - Intergenic
1167633768 19:50641455-50641477 CACCGCGCCCGGCCTAGCCCAGG + Intronic
1167733065 19:51273145-51273167 CACCGCGCCCGGCCAAGTTGTGG - Intergenic
1168028137 19:53658591-53658613 CACCGCACCCAGCCATGGAGAGG - Intergenic
1168087639 19:54060138-54060160 CACCGCGCCCGGCCGAGAGGAGG + Intronic
1168099366 19:54133137-54133159 CACCGCGCCCGGCCGAGATGGGG + Intergenic
1168150343 19:54443930-54443952 CACCACGCCTGGCCTAGCAGAGG - Intergenic
1168159152 19:54497288-54497310 CACCGTGCCTGGCCGTGCAAGGG + Intergenic
1168186335 19:54702406-54702428 CACTGCGCCCGGCGTTGTATTGG - Intergenic
1168255340 19:55161684-55161706 CACCGCGCCGGGCGTCGTAGCGG + Exonic
1168419738 19:56193672-56193694 CACCGCGCCCGGCCTCTCATAGG - Intronic
1168558132 19:57360844-57360866 CACTGCGCCCAGCCTGGCTGGGG + Intergenic
1168678906 19:58299479-58299501 CACCGCGCCTGGCCTGACACGGG - Exonic
1168697482 19:58412495-58412517 CACCACGCCCGGCCTGGCCAGGG + Intronic
925625412 2:5837906-5837928 CACCGCGCCCGGCCTAGGCTTGG + Intergenic
926031320 2:9592435-9592457 CACCGCGCCCGGCCCTAAAAAGG - Intronic
926163494 2:10504048-10504070 CACCGTGCCCGGCCCTGTGGCGG - Intergenic
926330444 2:11821226-11821248 CACCGTGCCTGGCCTGCCAGAGG - Intronic
927136036 2:20097185-20097207 CACCGCGCCCAGCCGGGCAGTGG - Intergenic
927193670 2:20533694-20533716 CACCGCGCCCAGCCGAGGAGTGG + Intergenic
927396797 2:22661663-22661685 CACCGCGCCCTGCCTAGTTGAGG - Intergenic
927592327 2:24367107-24367129 CACCGCGCCCGGCCTCCCTGGGG + Intergenic
927637906 2:24829303-24829325 CACCGCGCCCGGCCCCCCACTGG + Intronic
927900930 2:26817726-26817748 CACCGCGCCCGGCCTTACGGAGG + Intergenic
927995701 2:27484301-27484323 CACCACGCCCGGCCTGGAAGTGG - Intronic
928426677 2:31184169-31184191 CACCGCGCCCGGCCCTCCTCAGG + Intronic
928544047 2:32312702-32312724 CACCGCGCCCGGCCTATTGGGGG - Exonic
928636146 2:33248873-33248895 CACCGCGCCCAGCCATGAAATGG + Intronic
928998581 2:37324321-37324343 CACCGCGCCCGGCCCATCGGAGG - Intronic
929136017 2:38624573-38624595 CACCGCGCCCGGCCTAGTCTCGG + Intergenic
929465461 2:42139995-42140017 CACCGCACCCGGCCTAGCAGTGG + Intergenic
929746534 2:44665357-44665379 CACCGTGCCCGGCCTCAGAGAGG + Intronic
929784393 2:44978743-44978765 CACTGCGCCTGGCCTGACAGTGG - Intergenic
929848869 2:45562518-45562540 CACCGCGCCCGGCCTGTCACTGG + Intronic
930045108 2:47163947-47163969 CACCGCGCCCGGCCTGAGACGGG - Intronic
930141347 2:47954117-47954139 CACCGCGCCCGGCCTGGAGGAGG - Intergenic
930204730 2:48576765-48576787 CACCGCGCCCGGCCTGCAAACGG - Intronic
930592218 2:53341631-53341653 CACCACGCCCGGCCTAGCCAAGG - Intergenic
931500556 2:62861414-62861436 CACCGCGCCCAGCCCTTGAGTGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932467176 2:71931414-71931436 CACCGCGCCTGGCCTGCCACTGG + Intergenic
932760105 2:74433779-74433801 CACCGCGCCCGGCCTCATTGTGG + Intronic
933662162 2:84936701-84936723 CACCACGCCCGGCCTAGCCCAGG - Intergenic
933707338 2:85301835-85301857 CACTGCGCCCGGCCCTGAAAAGG - Intronic
933755377 2:85634123-85634145 CACCACGCCCGGCCGAGTAGTGG + Intronic
933785801 2:85840655-85840677 CACCGCACCTGGCCTAGAAGGGG - Intronic
933872492 2:86582345-86582367 CACCGCGCCTGGCCTTCTTGTGG - Intronic
935052296 2:99534209-99534231 CACCGCACCTGGCCTTGCTGTGG - Intergenic
936079735 2:109424002-109424024 CACTGCAACCGGCCCTGCAGCGG - Intronic
936407554 2:112220531-112220553 CACCGCGCCCAGCCCTACAAAGG - Intronic
936456336 2:112677337-112677359 CACCGCACCCGGCCTAGCTCTGG - Intergenic
936463761 2:112729408-112729430 CACCGCGCCTGGCCTTGGCCTGG + Intronic
936547369 2:113404267-113404289 CACCGCGCCCGGCCATTCCCAGG - Intergenic
936659069 2:114522270-114522292 CACCGCGCCCGGCCTATCCAAGG + Intronic
936789984 2:116140133-116140155 CACCGCGCCTGGCCTAGATGGGG - Intergenic
937158727 2:119740326-119740348 CACCGCGCCCGGCCTTCCTGTGG - Intergenic
937269516 2:120639602-120639624 CACCGCGCCCGGCCTTTTGCTGG - Intergenic
937482706 2:122278835-122278857 CACCGCGCCCGGCCGTGTCTTGG + Intergenic
937981336 2:127617788-127617810 CACCGCGCCCGGCCTTGTAACGG + Intronic
938020296 2:127900931-127900953 CACCGCGCCCGGCCTGTCCAGGG + Intergenic
938410556 2:131060310-131060332 CACCGCGCCCGGCCGTGAGTAGG + Intronic
938589581 2:132723448-132723470 CACCGCGCCCGGCCATTAGGTGG + Intronic
938641357 2:133283897-133283919 CACCGTGCCCGGCCTTGAAAAGG + Intronic
939202587 2:139056920-139056942 CACCGCGCCTGGCCTAGGTGAGG + Intergenic
939275735 2:139993725-139993747 CACCGTGCCCGGCCTAGCACAGG - Intergenic
939867926 2:147495570-147495592 CACCACGCCCGGCCTCGCTGTGG - Intergenic
939939569 2:148333551-148333573 CACCGTGCCCAGCCTTGAACTGG - Intronic
941147235 2:161863911-161863933 CACTGCGCCCGGCCTAGAACTGG - Intronic
941259150 2:163274369-163274391 CACTGCGCCCGGCCTAGCAGTGG + Intergenic
941878686 2:170460199-170460221 CACCACGCCCGGCCTAGAATAGG - Intronic
943925964 2:193780215-193780237 CACCGCGCCCGGCCTTAAAGGGG + Intergenic
944472877 2:200073871-200073893 CACCTCGCCCAGCCTAGCAAGGG - Intergenic
944649203 2:201811882-201811904 CACCAAGCCCAGCCTTGTAGTGG - Intronic
945097283 2:206231605-206231627 CACCGCGCCCGGCCCTGGTCAGG + Intergenic
945099422 2:206250657-206250679 CACCGCGCCCGGCCTGTCTTGGG + Intergenic
945225878 2:207530486-207530508 CTCCGCGCCCGGCCCGGCGGCGG - Intronic
945299962 2:208206940-208206962 CACCGCGCCCGGCCTTTTTTTGG - Intergenic
945452927 2:210014375-210014397 CACCGCGCCCGGCCTGGAGTAGG + Intronic
945735038 2:213588512-213588534 CACCGCGCCCGGCCATGGATAGG - Intronic
945863943 2:215155803-215155825 CACCGCACCCGGCCTATCAGGGG - Intergenic
945885769 2:215373968-215373990 CACCGCGCCTGGCCTTTCCAGGG + Intronic
947253460 2:228134984-228135006 CACTGCACCCGGCCTTGAAGTGG - Intronic
947294376 2:228614651-228614673 CACCGCGCCCGGCCCAGCCTAGG + Intergenic
947649438 2:231772947-231772969 CACCACGCCCGGCCTTACTTAGG - Intronic
947707334 2:232286931-232286953 CACCGCGCCTGGCCTGTCATTGG + Intronic
947797321 2:232902710-232902732 CACCGCACCCGGCCTCGTTGTGG - Intronic
947986239 2:234450011-234450033 CACCATGCCTGGCCTTGCAATGG + Intergenic
948035848 2:234857781-234857803 CACGGCACCCGGCCTTGAGGAGG - Intergenic
948174666 2:235933817-235933839 CACCGCGCCCGGCCTTTCTAAGG + Intronic
1168898466 20:1340038-1340060 CACCGCGCCTGGCCAGGTAGGGG + Intronic
1168936291 20:1668568-1668590 CACCGCACCCAGCCTTTCACAGG + Intergenic
1169078615 20:2779432-2779454 CACCGCGCCCGGCCTGGACAAGG - Intergenic
1169122986 20:3108394-3108416 CACCATGCCCGGCCATGCTGGGG + Exonic
1169224650 20:3848385-3848407 CACCGCGCCCGGCCGAGAAAGGG + Intronic
1169568272 20:6879623-6879645 CACCACGCCCGGCCTCTCAATGG - Intergenic
1170609266 20:17898872-17898894 CACTGCGCCTGGCCTTGGATGGG - Intergenic
1170637717 20:18122955-18122977 CACCGTGCCCGGCCCTGAATGGG - Intergenic
1170879609 20:20284571-20284593 CACCGCGCCCGGCCTTCAATTGG + Intronic
1170943659 20:20870077-20870099 CACCGCGCCCGGCCGGGAGGTGG + Intergenic
1171942346 20:31343407-31343429 CACCGCGCCCGGCCCAGTTGTGG - Intergenic
1172219982 20:33267290-33267312 CACCGCGCCTGGCCTTAGGGCGG - Intergenic
1172305341 20:33876520-33876542 CACCGCGCCCGGCCGAGTTGGGG + Intergenic
1173137144 20:40448327-40448349 CACTGCGCCCGGCCAAGCAGAGG - Intergenic
1173248086 20:41349914-41349936 CCCCAGGCCCGGCCTTTCAGGGG + Intronic
1173251587 20:41366648-41366670 CACCGCGCGGGGCCGGGCAGAGG - Exonic
1173471786 20:43329657-43329679 CACCGCGCCCGGCCTTTTCTTGG - Intergenic
1173600820 20:44293929-44293951 CAGCGCGCCCAGCCAAGCAGAGG + Intergenic
1173922021 20:46753416-46753438 CACCGCGCCCGGCCAAGCTTGGG - Intergenic
1174226629 20:49006005-49006027 CACCGCGCCCGGCCAAACACAGG - Intronic
1174591915 20:51652818-51652840 CACTGCGACTGGCCTTGCTGTGG - Intronic
1174607394 20:51770659-51770681 CACTGCGCCCGGCCGTGCCCGGG - Intergenic
1174634184 20:51984706-51984728 CACCGCGCCCGGCCGCGTTGGGG + Intergenic
1174768049 20:53272296-53272318 CACCGTGCCCGGCCGAGAAGTGG + Intronic
1175764404 20:61582614-61582636 CACCGCACCAGGCCCTGCAGGGG - Intronic
1175817004 20:61888375-61888397 CACCCGGCCCTCCCTTGCAGCGG - Intronic
1175864413 20:62167329-62167351 CACCGCGCCCGGCCGAGCTCAGG + Intronic
1176525169 21:7860819-7860841 CACCGCGCCCAGCCGTTTAGGGG - Intergenic
1176611729 21:8990206-8990228 CATCGCGCGCAGCCTAGCAGTGG - Intergenic
1177232871 21:18345451-18345473 CACCGCTCCCAGCCATTCAGTGG - Intronic
1177484737 21:21742716-21742738 CACCGCGCCCGGCCAGGCAGAGG + Intergenic
1177672534 21:24251797-24251819 CACTGCGCCCGACCTTTCTGCGG - Intergenic
1177718909 21:24879017-24879039 CACCGCGCCCGGACTTAGATTGG + Intergenic
1177727667 21:24990366-24990388 CACCGCACCTGGCCTAGCAAGGG - Intergenic
1177894564 21:26844513-26844535 CGCCGCGCACGCCCTCGCAGAGG + Exonic
1178236165 21:30844319-30844341 CACCGCGTCCAGCCTAGCGGGGG - Intergenic
1178317590 21:31579515-31579537 CACTGTGCCCGGCCGTGAAGAGG - Intergenic
1178325381 21:31641414-31641436 CACCGCGCCCGGCCGTGGAGTGG + Intergenic
1178350706 21:31871623-31871645 CACCGCGCCCGGCCTCAGAGTGG + Intergenic
1178361866 21:31955301-31955323 CACCGCGCCCGGCCCTGCTTTGG - Intronic
1178659189 21:34490832-34490854 CACCGCGCCCAGCCGTTTAGGGG - Intergenic
1178858857 21:36272694-36272716 CACCGCGCCCGGCCTGAGATGGG - Intronic
1178975511 21:37217859-37217881 CACTGCGCCCAGCCATGTAGGGG + Intergenic
1179449261 21:41457046-41457068 CACCACGCCCGGCCTTGTTGGGG + Intronic
1179540747 21:42082089-42082111 CCTGGCGCCCGGCCTTGCTGTGG - Intronic
1179668221 21:42927042-42927064 CACCGCGCCCGGCCAACAAGTGG + Intergenic
1179719271 21:43306210-43306232 CCCCACTCCTGGCCTTGCAGTGG - Intergenic
1179840911 21:44072750-44072772 CACCGCGCCCGGCCTCTCCTAGG + Intronic
1180206273 21:46263039-46263061 CACCGCACCTGGCCTTGTTGAGG - Intronic
1180478264 22:15731005-15731027 CTCCTGGCCCAGCCTTGCAGAGG + Intergenic
1180479076 22:15735919-15735941 CTCCTGGCCCAGCCTTGCAGAGG + Intergenic
1180735944 22:18017501-18017523 CACCGTGCCTGGCCTAACAGAGG + Intronic
1180756160 22:18163353-18163375 CACCGCGCCCAGCCTGGGAGAGG - Intronic
1181312235 22:21951633-21951655 CACCGCGCCCGGCCTTCAGGGGG + Intronic
1181549610 22:23629903-23629925 CACCGTGCCCGGCCATGGATTGG + Intronic
1181781748 22:25198725-25198747 CACCGCGCCCGGCCTGTAACTGG + Intergenic
1181798345 22:25326918-25326940 CACCGTGCCCGGCCGTGCCAGGG + Intergenic
1181799016 22:25332071-25332093 CACCGTGCCCGGCCATGGATTGG - Intergenic
1182226209 22:28800579-28800601 CGCCGCGCCCGGCCTTTCTACGG + Exonic
1182381389 22:29891864-29891886 CACCGCGCCCAGCCTAGCATGGG - Intronic
1182687914 22:32135027-32135049 TACCACGCCCGGCCTTGAATGGG - Intergenic
1182761354 22:32724830-32724852 CACCGCGCTCGGCCCAGAAGAGG - Intronic
1182881605 22:33738569-33738591 CACCGCGCCCGGCCCTGGCATGG - Intronic
1182888323 22:33794906-33794928 CACCGTGCCCGGCCTTAAAATGG + Intronic
1183232425 22:36591315-36591337 CACCGCGCCCGGCCTAAGGGGGG + Intronic
1183393865 22:37560731-37560753 GGCCGCGCCCGGCCTTCCTGTGG - Intronic
1183764220 22:39855983-39856005 CACCGCGCCCGGCCACGAGGGGG - Intronic
1184035157 22:41914694-41914716 CGCGGCGCCCGGCCATGCACCGG - Intergenic
1184111075 22:42395592-42395614 CACCGCGCCTGGCCTTCCTTTGG - Intronic
1184120870 22:42449368-42449390 CACCGCGCCCAGCCCAGCAGAGG + Intergenic
1184132681 22:42526864-42526886 CACCGCGCCCGGCCCAGCAGAGG + Intergenic
1184220357 22:43096027-43096049 CACCGCACCCGGCCCGGCTGGGG - Intergenic
1184346112 22:43914179-43914201 CACCGCGCCTGGCCTGGAAAGGG + Intergenic
1184717799 22:46291664-46291686 CACCGTGCCCGGCCTGTCTGTGG - Intronic
1185095199 22:48802666-48802688 CACCGCAGCCGGCCTTGCAGGGG + Intronic
1185236189 22:49714766-49714788 CCACGCGCCCGGCCGTGTAGGGG - Intergenic
1185374799 22:50477482-50477504 CACCACGCCCGGCCTTTGGGGGG - Intergenic
949552099 3:5120017-5120039 CACCGCGCCCGGCCTATCCTAGG + Intergenic
949644374 3:6076378-6076400 CACCGCGCCCGGCCGGCAAGAGG - Intergenic
950075689 3:10185267-10185289 CACCGCGCCGGGCCGAGCAGTGG - Intronic
950344728 3:12282670-12282692 CACTGCGCCTGGCCTCTCAGTGG + Intergenic
951170942 3:19541014-19541036 CACCGCACCCGGCCTTGTTCAGG - Intergenic
951696520 3:25450795-25450817 CACCGCACCCGGCCGGGTAGGGG - Intronic
954221999 3:49160624-49160646 CACCGCGCCCGGCCAGACAGGGG + Intergenic
954246734 3:49338369-49338391 TACTGCGCCCGGCCTAGCAGAGG - Intronic
954404636 3:50338566-50338588 CACCGCACCCGGCCCTTCACTGG + Intronic
954566617 3:51605375-51605397 CACTGCACCTGGCCTTCCAGTGG + Intronic
954666388 3:52255228-52255250 CACCGCGCCCAGCCTTGAGGTGG + Exonic
954773845 3:52998833-52998855 CACCCCGCAGGCCCTTGCAGTGG - Intronic
954870227 3:53762139-53762161 CTCCGCTCCCTGCCCTGCAGTGG + Intronic
955188904 3:56741789-56741811 CACCGCGCCCAGCTTTGCATTGG + Intronic
955775313 3:62426435-62426457 CACCGCGCCCGGCCGTGTGTTGG + Intronic
956590910 3:70913735-70913757 CACTGCGCCTGGCCTTGAAGTGG + Intergenic
956651136 3:71505711-71505733 CACTGCGCCCAGCCCTGAAGAGG + Intronic
956827134 3:73007775-73007797 CACCGCGCCCGGCCTCTATGGGG + Intronic
957098480 3:75800294-75800316 CACCGCGCCCGGCCTGTAAAGGG + Intergenic
957170963 3:76735993-76736015 CACCGCGCCCGGCCTTTGTAGGG - Intronic
957286478 3:78223337-78223359 CACTGCGCCCGGCCTGGTTGGGG - Intergenic
957350613 3:79018835-79018857 CGCCGCGCCTGCCCTCGCAGCGG - Intronic
957383316 3:79463083-79463105 CACCTCGCCCGGCCTTGAAAAGG - Intronic
957716921 3:83939600-83939622 CACCGTGCCTGGCCTTGCGTGGG + Intergenic
958556243 3:95681001-95681023 CACCGCTCCTGGCCTGACAGAGG - Intergenic
959190805 3:103108446-103108468 CACCGCGCCCGGCAGTGAATAGG + Intergenic
959548571 3:107626938-107626960 CACCGCACCTGGCCTTCCATAGG + Intronic
959664090 3:108902301-108902323 CACCGCGCCCGGCCCTACCTTGG + Intergenic
961250979 3:125505256-125505278 CACTGCACCCAGCCTTCCAGAGG + Intronic
961267888 3:125661440-125661462 CACTGTGCCCAGCCTTGCAAAGG + Intergenic
961540603 3:127596826-127596848 CACCACGCCCGGCCAGGAAGTGG - Intronic
961715222 3:128853291-128853313 CACCGCGCCCGGCCGAACTGTGG + Intergenic
962556995 3:136563730-136563752 CACCGTGCCCGGCCTTTCTCTGG - Intronic
962594079 3:136922069-136922091 CACCGCGCCCGGCCACTGAGTGG + Intronic
963466306 3:145686662-145686684 CACTGGGCCCGGCCTTGCTTGGG - Intergenic
963806635 3:149729132-149729154 CACCGCACCCAGCCTGGAAGGGG + Intronic
963865040 3:150351256-150351278 CACCACACCTGGCATTGCAGAGG + Intergenic
963925984 3:150951624-150951646 CACCGCGCCCGGCCTGAGACTGG + Intronic
964172527 3:153787884-153787906 CACCGCGCCCAGCCTGTCAGTGG + Intergenic
965570624 3:170168475-170168497 CACCGTGCCCGGCCGTGGAGTGG - Intronic
966004079 3:174987279-174987301 CACCGCGCCCGGCCGAGTATTGG - Intronic
966866151 3:184260112-184260134 CTCCGGGCCCAGCCTCGCAGCGG - Exonic
967032219 3:185618588-185618610 CACCGCGCCCGGCCGAGTGGTGG - Intronic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
967247831 3:187505795-187505817 CACTGCGCCCGGCCAAGAAGAGG + Intergenic
967276870 3:187784624-187784646 CACCGCGCCCGGCCAGGCTTGGG + Intergenic
967400635 3:189056382-189056404 CACCATGCCCAGCCTAGCAGAGG + Intronic
967641847 3:191874869-191874891 CACTGCGCCCAGCCTTGAAATGG + Intergenic
967659230 3:192085221-192085243 CACCGCGCCCGGCCAAGCTCTGG - Intergenic
968115575 3:196086808-196086830 CACCGCGCCCGGCCCTTCAACGG + Intergenic
968163211 3:196443913-196443935 CACCACGCCCGGCCTGGGACGGG + Intergenic
968179658 3:196583217-196583239 CATCGCGCCCGGCCGTACAATGG - Intronic
968185397 3:196630316-196630338 CACTGCGCCCAGCTATGCAGTGG - Intergenic
968261073 3:197324629-197324651 CACCGCGCCCGGCCTTGTAGTGG + Intergenic
968390633 4:190140-190162 CACCGCACCCGGCCTAGAACAGG - Intergenic
968676418 4:1883341-1883363 CACTGCGCCCAGCCCTGCAGAGG - Intronic
968681269 4:1921858-1921880 CACCGCGCCCGGCCTAATATTGG - Intronic
968694908 4:2019412-2019434 CACCGCGCCCGGCCCCGAAGTGG - Intronic
968695358 4:2022728-2022750 CACCACGCCCGGCCAGTCAGCGG + Intronic
968715306 4:2153907-2153929 CACCGCGCCTGGCCTTAAAATGG - Intronic
968835034 4:2957286-2957308 CACCGCGCCCGGCCTCATGGAGG + Intronic
968926953 4:3553977-3553999 CACCGCGCCCGGCCCTTTACTGG + Intergenic
969243097 4:5914490-5914512 CACCGCGCCTGGCCTTTTATGGG + Intronic
969422662 4:7106393-7106415 CACCTCGCCCGGCCAAGAAGGGG - Intergenic
969600114 4:8171249-8171271 CACCACGCCCGGCCTGCAAGTGG + Intergenic
969613212 4:8238348-8238370 CTCTGCGCCCAGCCCTGCAGGGG + Intronic
969619065 4:8269881-8269903 CCCGGCGCCCGGCCCCGCAGCGG + Exonic
969641152 4:8399486-8399508 CACAGAGCCAGGCCCTGCAGAGG + Intronic
969914378 4:10475461-10475483 CACCGCGCCCGGCCTCTTAAAGG + Intergenic
969919655 4:10525351-10525373 CACCGCGCCCGGCCAAGCCTTGG + Intronic
970194983 4:13544054-13544076 CAGCGGGGCCGGCCTTGCGGGGG - Exonic
970630709 4:17941086-17941108 CACAGCGCCCGGCCCTGATGGGG - Intronic
971128801 4:23783058-23783080 GACAGGGCCCGGCCATGCAGAGG + Intronic
971586817 4:28414920-28414942 CACCGCGCCCGGCCTACCAGTGG + Intergenic
972590553 4:40481972-40481994 CACTGCGCCCGGCCATGATGTGG + Intronic
972643436 4:40945942-40945964 CACCACGCCCGGCCTTCCTTGGG - Intronic
972873474 4:43329180-43329202 CACCGCGCCCGGCCTCACTTGGG + Intergenic
972919540 4:43921285-43921307 CACCGCGCCTGGCCTTGTAATGG - Intergenic
972970859 4:44574656-44574678 CACCGCGCCCGGCCTGGAATTGG + Intergenic
973198050 4:47467929-47467951 CACCGCACCCGGCCTGGAACTGG - Intergenic
974069404 4:57110343-57110365 CACCGCACCCCGCCATGGAGCGG - Exonic
974755622 4:66203297-66203319 CACCGCGCCTGGCCAAGAAGTGG - Intergenic
974785827 4:66618869-66618891 CACCGTGCCTGGCCATGCAGTGG - Intergenic
974928123 4:68326877-68326899 CACTGCGCCCAGCCATGCAGAGG + Intronic
976417995 4:84801697-84801719 CACTGCACCCGCCCCTGCAGCGG - Exonic
976568152 4:86576484-86576506 CACCGCGCCCGGCCTACTATAGG - Intronic
976888173 4:90011331-90011353 CATCACGCTCGGCCTTGCTGAGG - Intergenic
977514205 4:97999412-97999434 CACTGCGCCTGGCCTTGCCCTGG - Intronic
977636501 4:99304377-99304399 CACCGCGCCCGGCCTTGAATGGG - Intergenic
978251502 4:106636755-106636777 CACTGCACCCGGCCTTGCTTTGG - Intergenic
979313075 4:119227348-119227370 CACAGCGCCCGGCCCTGTAGAGG - Intronic
979382323 4:120021715-120021737 CACCGCGCCCGGCCTAACAAAGG - Intergenic
980314410 4:131178246-131178268 CACCGCGCCCAGCCTTTCCATGG - Intergenic
980329385 4:131390564-131390586 CACCGCGCCTGGCCTAGCATAGG + Intergenic
980329439 4:131390893-131390915 CACCACGCCTGGCCTAGCATAGG + Intergenic
980572405 4:134637742-134637764 CACCGCGCCCGGCCCTGGATAGG + Intergenic
980789460 4:137601319-137601341 CACCGTGCCCAGCCTAACAGTGG - Intergenic
982004042 4:151047853-151047875 CACCGCACCCGGCCATGCAGTGG + Intergenic
982253998 4:153434855-153434877 CACCGTGCCCGGCCGTGCTGTGG - Intergenic
982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG + Intergenic
982462459 4:155687933-155687955 CACCGCACCCGGCCCTGTAATGG - Intronic
982539117 4:156645213-156645235 CACCCCGCCCGGCCTTACCCTGG + Intergenic
982988595 4:162242607-162242629 CACCGCGCCCGGCCTGTGACTGG - Intergenic
983070687 4:163264536-163264558 CACCTCGCCCGGCCTCTAAGGGG + Intergenic
983235252 4:165171949-165171971 CACCGCGCCCAGCCTTTCCCAGG - Intronic
983242735 4:165251895-165251917 CACCGCGCCCGGCCCCAAAGTGG + Intronic
983254899 4:165387520-165387542 CACCACGCCCGGCCAGGAAGAGG - Intronic
984082285 4:175262214-175262236 CACCGTGCCCGGCCTAGCATTGG + Intergenic
984274450 4:177593095-177593117 CACCGCGCCCGGCCTTGTTTAGG - Intergenic
984281442 4:177675347-177675369 CACCGCGCCCGGCCTCCTTGAGG + Intergenic
984853444 4:184173191-184173213 CACCGCGCCCGGCCTATCGAGGG + Intronic
984982171 4:185292689-185292711 CACCGCACCCGGCCATGGACAGG + Intronic
985061154 4:186080878-186080900 CACCGCGCCCAGCCTGGAGGGGG + Intronic
985102312 4:186470713-186470735 CACCGCGCCTGGCCTGACGGAGG + Intronic
985219933 4:187693403-187693425 CACCGCGCCCGGCCGAGAGGTGG + Intergenic
985790140 5:1922196-1922218 CACCGCGTCTGGCCTTCCAGTGG - Intergenic
986719352 5:10550047-10550069 CACTGCGCCCCGCCTTGCTTCGG + Intergenic
987178921 5:15346133-15346155 CACCGCGCCCGGCCTCCGATAGG - Intergenic
987318328 5:16745049-16745071 TACCGCGCCCGGCCTGGGAAAGG - Intronic
987726541 5:21708175-21708197 CACCACGCCCAGCCTATCAGAGG - Intergenic
987763187 5:22191850-22191872 CACCGCGCCCGGCCCACCAATGG + Intronic
988531285 5:32029528-32029550 CACCGCCACAGGACTTGCAGGGG - Intronic
989275199 5:39580574-39580596 CACCGCACCCGGCCTGGAACGGG + Intergenic
989294877 5:39813968-39813990 CACCGCGCCCGGCCATGGTGGGG - Intergenic
991362514 5:65835780-65835802 CACCGCACCTGGCCTTGCATTGG - Intronic
991953480 5:71969813-71969835 CACCACGCCCAGCCTGGCACAGG - Intergenic
992040154 5:72822879-72822901 CACTGCGCCCGGCCTGGCCTGGG + Intronic
992205637 5:74427898-74427920 CACCGCGCCCGGCCGCAAAGGGG - Intergenic
993716476 5:91280016-91280038 CACCGCGCCCGGCCTGTCTCAGG + Intergenic
994188445 5:96840990-96841012 CACTGCGCCCGGCCAGGCATTGG + Intronic
994205175 5:97027063-97027085 CACCGCGCCCGGCCATACAGAGG - Intronic
994674319 5:102802069-102802091 CACCGCGCCCGGCCGGGAAAAGG + Intronic
994714653 5:103306966-103306988 CACGGCGCCCGGCCTTGCAATGG + Intergenic
994834747 5:104835266-104835288 CACCGCGCCCGGCCCTGTTGAGG - Intergenic
994979831 5:106859863-106859885 CACCGCGCCCAGCCATGTAAAGG - Intergenic
995019929 5:107354707-107354729 CACCGTGCCCAGCCTTCTAGGGG + Intergenic
995076790 5:107994549-107994571 CACCGTGCCCAGCCTTGTATAGG - Intronic
995156412 5:108918773-108918795 CACCGCGCCCCGCCTTGGACTGG + Intronic
996269630 5:121587655-121587677 CACCGCGCCCGGCCTGTCACAGG - Intergenic
996302223 5:122001847-122001869 CACCGCGCCCGGCCATCCTTTGG + Intronic
996359092 5:122625826-122625848 CACTGTGCCCAGCCTTGCTGTGG - Intergenic
997132869 5:131294701-131294723 CACCACGCCCGGCCATGTACTGG - Intronic
997342343 5:133154469-133154491 CACCGCGCCCGGCCTGGGAGAGG - Intergenic
997552980 5:134769833-134769855 CACCGCGCCCGGCCGAGTTGGGG + Intronic
997884239 5:137616107-137616129 GGCCTCGCCCGGCCTTGGAGAGG - Intergenic
998056534 5:139083008-139083030 CACTGGGCCAGGCCCTGCAGGGG + Intronic
998076300 5:139239469-139239491 CACCGCGCCCGGCCGGGGCGAGG - Intronic
998084982 5:139312938-139312960 CACCGCACCTGGCCTTTCACAGG + Intronic
998143780 5:139714105-139714127 CACCGCGCCCGGCCTGGCATGGG + Intergenic
998410587 5:141907756-141907778 CACCACGCTCGGCCTGGCAATGG + Intergenic
998419188 5:141968391-141968413 CACCGCACCCGGCCTTCTAAGGG + Intronic
998831823 5:146167815-146167837 CACCGCGCCCGGCCTACGACCGG + Intronic
999330026 5:150667045-150667067 CACTGCGCCCGGCCTATAAGTGG + Intronic
999625791 5:153518974-153518996 CACCGTGCCTGGCCTTGAACTGG - Intronic
1000328780 5:160191671-160191693 CACCGCGCCCGGCCGAGCCCAGG - Intronic
1000843996 5:166256740-166256762 CACCGTGCCCGGCCTCGGGGCGG - Intergenic
1000866984 5:166525860-166525882 CACCGCGCCCAGCCAAGCACTGG + Intergenic
1001029629 5:168252553-168252575 CACCGCGCCTGGCCAAGAAGTGG - Intronic
1001100978 5:168814105-168814127 CACCGCACCCGGCCCTGTGGTGG - Intronic
1001290096 5:170450854-170450876 CAAAGCCCCTGGCCTTGCAGGGG - Intronic
1001646755 5:173287841-173287863 CACTGCGCCCGGCCTGGGAATGG + Intergenic
1001805984 5:174586927-174586949 CACCGAGCCCGACCTTGAATTGG - Intergenic
1002045481 5:176539399-176539421 CACCGTGCCCGGCCATGGGGAGG - Intergenic
1002462706 5:179383531-179383553 CACCGCGCCCGGCCGGGCTGTGG + Intergenic
1002556304 5:180044543-180044565 CACCGCGCCCGGCCATGTGGAGG - Intronic
1002709736 5:181188085-181188107 CACCGCGCGCGGCCCCGAAGCGG - Intergenic
1002860199 6:1073391-1073413 CACCGCTCCCGGCCTAAAAGAGG + Intergenic
1002928747 6:1619674-1619696 CCCCGCGCCCGGCGCTGCCGGGG + Intergenic
1003052425 6:2792233-2792255 CACCGTGCCCGGCCTAGAACTGG + Intergenic
1003152520 6:3564550-3564572 CACCGCGCCCGGCCTCATGGGGG + Intergenic
1003671706 6:8165365-8165387 CACCGCGCCCGGCCGTGTCATGG - Intergenic
1004554512 6:16682483-16682505 CACCGCGCCTGGCCTCTCTGGGG + Intronic
1004620792 6:17328591-17328613 CACTGTGCCCGGCCCAGCAGTGG - Intergenic
1005262452 6:24075764-24075786 CACCGCACCCGGCCTTGTTGAGG + Intergenic
1005565381 6:27087720-27087742 CACCGCGCCCGGCCCACAAGAGG - Intergenic
1005624090 6:27647103-27647125 CACCGCGCCGGACCGAGCAGAGG + Intergenic
1006009451 6:31030227-31030249 CACCGCGCCCAGCCTAGAAGAGG - Intronic
1006189363 6:32198107-32198129 CACCACGCCCGGCCTAGCAGTGG + Intronic
1006230176 6:32579813-32579835 CACCGCGCCCGGCCTACAAGAGG - Intronic
1006354202 6:33544506-33544528 CACCACGCCTGGCCTTGGATGGG - Intergenic
1006504725 6:34481392-34481414 CACCGCACCCGGCCAAGCAAGGG - Intronic
1006537332 6:34710435-34710457 CACCGCGCCCGGCCAAGAATGGG - Intergenic
1006599028 6:35213745-35213767 CACCGCGCCCGGGCGCGCAGGGG + Intergenic
1006671755 6:35733786-35733808 CACCGCGCCCAGCCCTGAACTGG + Intergenic
1006774021 6:36577950-36577972 CACCGTGCCCGGCCTGGCAACGG + Intergenic
1006908254 6:37547277-37547299 CCCCGCGCCCGGCCCAGCTGTGG - Intergenic
1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG + Intronic
1007673757 6:43578096-43578118 CATCGCGCTCGGCCTAGCATGGG - Intronic
1008373880 6:50769180-50769202 CACTGCGCCCAGCCCTGAAGTGG + Intronic
1008766816 6:54927019-54927041 CACCGTGCCCGGCCTTCATGAGG + Intronic
1008903724 6:56653395-56653417 CACCGCACCCAGCTTTGTAGTGG - Intronic
1009952110 6:70410156-70410178 CACTGCGCCCGGCCTTCATGAGG + Intergenic
1010876048 6:81106808-81106830 CACCGCGCCCGGCCTATTAGCGG + Intergenic
1010917739 6:81641648-81641670 CACCGCGCCCGGCCGTGTTTTGG - Intronic
1011051273 6:83152904-83152926 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1011593162 6:88990674-88990696 CACCACGCCTGGCCAAGCAGTGG - Intergenic
1011754507 6:90485101-90485123 CACTTCTCCCGGCCCTGCAGCGG + Intergenic
1012153125 6:95781186-95781208 CACCACGCCCGGCCCTGAACAGG - Intergenic
1012605058 6:101147930-101147952 CACCGCGCCCGGCCTAATTGTGG - Intergenic
1013011928 6:106128552-106128574 CACCGTGCCCAGCCGTGCAGAGG - Intergenic
1013100438 6:106981848-106981870 CACCGCGCCCAGCCTCACAATGG + Intergenic
1013217885 6:108046631-108046653 CACCGCGCCCGGCCTGTCTCTGG + Intronic
1013501856 6:110760105-110760127 CACCGCGCCTGGCCTAGTTGAGG - Intronic
1013504588 6:110787081-110787103 CACCGCGCCTGGCCCTGAATAGG - Intronic
1013550534 6:111203443-111203465 CACCACGCCTGGCCTAGAAGGGG - Intronic
1014597232 6:123359981-123360003 CACTGCGCCTGGCCGTGAAGGGG + Intronic
1015524993 6:134167663-134167685 CACCGTGCCTGGCCTTGCTTTGG + Intergenic
1015809410 6:137146702-137146724 CACCAGGCCTGGCCTTGCAGTGG - Intronic
1016001928 6:139050345-139050367 CACCGCACCTGGCCTAGCAAAGG + Intergenic
1016761550 6:147743217-147743239 CACTGCGCCCGGCCTAGTTGAGG - Intergenic
1017015202 6:150094322-150094344 CACCGCGCCCGGCCACAGAGGGG - Intergenic
1017086476 6:150717466-150717488 CACCACGCCCGGCCTGGGAAGGG + Intronic
1017094461 6:150792383-150792405 CACCGCGCCCAGCCAGGAAGTGG - Intronic
1017109952 6:150922930-150922952 GACCACGCCTGGCCTGGCAGTGG + Intronic
1017112133 6:150941968-150941990 CACCGTGCCCGGCCTGATAGTGG - Intronic
1017417224 6:154233918-154233940 CACGGCGTCCGGCCTAGCTGGGG - Intronic
1017449762 6:154544064-154544086 CACCGCGCCTGGCCACGAAGGGG - Intergenic
1017761482 6:157573234-157573256 GACCGCGCTCTGACTTGCAGAGG - Intronic
1018183727 6:161246651-161246673 CACCGCACCCAGCCTAGCACAGG + Intronic
1018677408 6:166235190-166235212 CACCGCGCCCGGCCTTGAAATGG + Intergenic
1018679107 6:166248973-166248995 CACCGTGCCCGGCCTTCACGCGG + Intergenic
1018812441 6:167307764-167307786 CACCGCGCCTGGGGGTGCAGAGG - Exonic
1019189321 6:170241962-170241984 CACCGCGCCCGGCCTGAGACCGG - Intergenic
1019310495 7:358205-358227 CACCGTGCCTGGCCTTGCAATGG - Intergenic
1019320438 7:412920-412942 CACCGCGCCCGGCCTGGCTGTGG - Intergenic
1019377849 7:705001-705023 CACTGCGCCCGGCCCTAAAGTGG - Intronic
1019553206 7:1614191-1614213 CACCGCGCCTGGCCCTGAACTGG - Intergenic
1019597245 7:1863798-1863820 CACCGCGCCTGGCCTTCCTCGGG - Intronic
1019726416 7:2605330-2605352 CACCGCGCCCGGCCTACTATAGG - Intronic
1019747293 7:2708109-2708131 CACTGTGCCCGGCCTTACCGAGG + Intronic
1019909976 7:4094348-4094370 CACCGCGCCCGGCCCAGCCGGGG + Intronic
1020102770 7:5404082-5404104 CACCGCCCCCGGCCCTGCCTGGG - Intronic
1020109639 7:5440800-5440822 CACCGCGCCCGGCCCAGTTGTGG + Intronic
1020275132 7:6619556-6619578 CACCGCGCCCGGCCATCCCTTGG + Intronic
1020432015 7:8124405-8124427 CACCGCGCCCAGCCGTGTATAGG + Intronic
1020780644 7:12513710-12513732 CACCGCGCCCGGCCCAGAATAGG - Intergenic
1020886144 7:13821062-13821084 CACCGCGCCCGGCCCTACAAAGG + Intergenic
1021259193 7:18432657-18432679 CACAGCGCCCGGCCTTCCACTGG - Intronic
1021395062 7:20137862-20137884 CACTGCTCCCAGCCTTCCAGAGG - Exonic
1021565455 7:22012152-22012174 CACCGCGCCCGGCCGGCCTGGGG + Intergenic
1021614870 7:22492031-22492053 CACCGCGCCCGGCCTACCTATGG - Intronic
1022241239 7:28514680-28514702 CACCGCGCCTGGCCTATCACAGG + Intronic
1022460652 7:30602363-30602385 CACTGCGCCCGGCCTGAAAGAGG + Intronic
1022474321 7:30700103-30700125 CACCCCACCCGGCCCTGGAGGGG + Exonic
1022673028 7:32473717-32473739 CACCGCGCCCGGCCTAACCACGG + Intergenic
1023352202 7:39331797-39331819 CACCGCGCCCGGCCTCGCTGTGG + Intronic
1024236739 7:47404596-47404618 CACCGCGCCCGGCCGGGCACAGG - Intronic
1025067058 7:55866288-55866310 CACCGCGCCCGGCCAGGCATTGG - Intergenic
1025595914 7:62925720-62925742 CACCGCACCTGGCCATGAAGTGG - Intergenic
1025723526 7:64037400-64037422 CACCGCGCCTGGCCTGGGAGTGG - Intronic
1025899074 7:65729289-65729311 CACCGTGCCTGGCCTTCCATCGG - Intergenic
1025900768 7:65742729-65742751 CACCGCGCCCAGCCTCCCATGGG + Intergenic
1026918831 7:74140116-74140138 CACCGCACCCAGCCTACCAGAGG - Intergenic
1027155535 7:75764856-75764878 CACGGCGCCCGGCCGAGCAAGGG - Intergenic
1027213978 7:76172466-76172488 CACCAAGCCCGGCCTGGCATGGG - Intergenic
1028417949 7:90598990-90599012 CACCGCGCCCGGCCTATCTAAGG + Intronic
1028518102 7:91699542-91699564 CACCGCGCCCGGCCTGGATGAGG - Intronic
1028976392 7:96919054-96919076 CACCGCGCCCGGCCCTACTTGGG + Intergenic
1029019766 7:97352292-97352314 CACCGCGCCCGGCCAAGAAAAGG - Intergenic
1029250819 7:99234885-99234907 CACCGCGCCCGGCCAGGCACTGG + Intergenic
1029258007 7:99282312-99282334 CACCACACCCGGCCTCACAGTGG + Intergenic
1029276154 7:99405648-99405670 CACCGCGCCCAGCCAGCCAGGGG + Intronic
1029427200 7:100503218-100503240 CACCGCGCCCGGCGGGTCAGTGG - Intergenic
1029543777 7:101199803-101199825 CACCGCGCCCGGCCTGGGAGTGG - Intronic
1029591532 7:101510312-101510334 CACTGCACCCGGCCTCTCAGAGG + Intronic
1029671182 7:102032215-102032237 CACCACGCCTGGCCTGGAAGTGG + Intronic
1029935568 7:104420848-104420870 CACCGCGCCCGGCCCCCCAAAGG + Intronic
1029936523 7:104430754-104430776 CACTGCGCCCGGCCCTTCTGTGG + Intronic
1030001771 7:105072021-105072043 CACCGCGCCCGGCCTCCTAATGG - Intronic
1030105309 7:105982178-105982200 CACCGCGCCCGGCCTTTAATTGG - Intronic
1030312265 7:108080833-108080855 CACCGCACCCAGCCTTACAAGGG - Intronic
1030944324 7:115697157-115697179 CACCGTGCCCAGCCATTCAGAGG + Intergenic
1031054413 7:116977839-116977861 CACCGCGCCCGGCCGAGTGGTGG + Intronic
1031935333 7:127730253-127730275 CACCGCGCCCAGCCTGACATTGG + Intronic
1032209686 7:129902208-129902230 CACCGTGCCCGGCCATGTAATGG - Intronic
1032219509 7:129983366-129983388 CACCGTGCCCGGCCATGTTGGGG + Intergenic
1032244172 7:130193908-130193930 CACCGCACCCGGCCTCACAGTGG - Intronic
1032342870 7:131091981-131092003 CACCACGCCCGGCCTAGAATGGG + Intergenic
1032377240 7:131432732-131432754 CACCGCGCCTGGCCCTCAAGTGG + Intronic
1032551152 7:132785887-132785909 TACTGCGCCCGGCCTTGTTGGGG - Intronic
1033168286 7:139060550-139060572 CACCGTGCCTGGCTTTGCTGTGG - Intronic
1033186957 7:139235693-139235715 CACTGCGCCTGGCCTTTCATTGG + Intronic
1033219492 7:139518928-139518950 CACCGCGCCCGGCCTAGGGCGGG + Intergenic
1033525326 7:142207715-142207737 CACCGCGCCCAGCCCAGCAAAGG + Intronic
1033934691 7:146569305-146569327 CGCCGCGCCCGGCCTCTCTGTGG + Intronic
1034045831 7:147925747-147925769 CACCACGCCCGGCCATTCTGTGG + Intronic
1034135346 7:148762856-148762878 CACCGCGCCCGGCCTAGGCCTGG - Intronic
1034766525 7:153727340-153727362 CACCGCGCCTGGCCACGAAGTGG + Intergenic
1034911626 7:155002825-155002847 TACCGCGCCCGCCCCTGCCGCGG - Intronic
1034940624 7:155228107-155228129 TCCAGCGCCCAGCCTTGCAGAGG - Intergenic
1034941707 7:155234839-155234861 CACCGCGCCCAGCCATCCAAGGG + Intergenic
1035004293 7:155644071-155644093 CTCCGCGCCCGGCTGGGCAGCGG - Intronic
1035656374 8:1309804-1309826 CACGGCGCCCGGCCTGTCACAGG - Intergenic
1035875363 8:3183044-3183066 CACCGCACCCGGCCTAGAAGAGG + Intronic
1036184412 8:6611904-6611926 CACCGCGCCCGGCCTGACGTCGG + Intronic
1036507458 8:9368494-9368516 CACCACGCCCGGCCTTGGAAGGG - Intergenic
1037325785 8:17688921-17688943 CACCGCACCCGGCCTGGCTTGGG - Intronic
1037859810 8:22397288-22397310 CACCGCGCCCGGCCAGGAGGAGG - Intronic
1038326028 8:26573378-26573400 CACCGCGCCCGGCCACGCCCAGG - Intronic
1038534149 8:28342054-28342076 TACCGCGCCCGGCCCTGAATAGG - Intronic
1038956142 8:32470490-32470512 CACCGCGCCCGACCATGAAAAGG + Intronic
1039321893 8:36441213-36441235 CACTGCGCCCGGCCTCGAACTGG - Intergenic
1039408818 8:37334985-37335007 CACTGCACCAGGCCTTGGAGAGG + Intergenic
1039480001 8:37865606-37865628 CACTGAGCCCGGCCTTCCTGGGG + Intronic
1039993346 8:42508677-42508699 CACCACACCCGGCCTGGGAGTGG + Intronic
1040422041 8:47250004-47250026 CACCGCGCCCGGCCGAGGACAGG - Intergenic
1041245417 8:55884391-55884413 CACTGCGCCTGGCCTTTCTGGGG + Intronic
1041492938 8:58454759-58454781 CACCGCGCCCGGCCTATAACAGG - Intergenic
1041660839 8:60399485-60399507 TACCGGGCTCAGCCTTGCAGTGG - Intergenic
1041937602 8:63351231-63351253 CACCGCGCCCGGCCTGACTGAGG - Intergenic
1042051654 8:64716416-64716438 CACCGTGCCCGGCTCTGAAGTGG - Intronic
1042118702 8:65460733-65460755 CACCACGCCAGGCCCTGTAGTGG - Intergenic
1042244518 8:66697314-66697336 CACCGCGCCCGGCCTTGCAGGGG - Intronic
1042245865 8:66708304-66708326 CACCTCGCCCAGCCTCGCAAAGG - Intronic
1042311472 8:67382997-67383019 CACCGCGCCCAGCCTACAAGTGG - Intergenic
1043432654 8:80209900-80209922 CACTGCGCCTGGCCTTGAAATGG - Intronic
1043475561 8:80602233-80602255 CACTGCACCCGGCCATGCTGTGG + Intergenic
1043578582 8:81686417-81686439 GACCCGGCCCGGCCTGGCAGAGG - Intronic
1044128940 8:88496145-88496167 CACCGTGCCCGGCCTGGAAAGGG - Intergenic
1044266855 8:90191890-90191912 CACTGCGCCCGGCCTCCCACTGG - Intergenic
1044295014 8:90517875-90517897 CACAGCGCCCGGCCTTCAGGTGG + Intergenic
1044574874 8:93757347-93757369 CACCGCGCCCGGCCTAGTAAAGG - Intronic
1044586489 8:93873571-93873593 CACTGCGCCTGGCCTTGTATTGG + Intronic
1044882131 8:96734421-96734443 CACCGCGCCCAGCCTGTCAGAGG - Intronic
1044987736 8:97769892-97769914 CACCGTGCCCGGCCTTGATCAGG + Intergenic
1045104583 8:98879050-98879072 CACCGCGCCCGGCCATAAATTGG + Intronic
1045140322 8:99273452-99273474 CACCGCGCCCAGCCTTGCTTGGG + Intronic
1045630310 8:104111692-104111714 CACCGCACCCGGCCTCCCATTGG + Intronic
1046443847 8:114289336-114289358 CACCGCTCCCGGCCTAAGAGAGG + Intergenic
1047431854 8:124799691-124799713 CACCACGCCAGGACTTTCAGTGG - Intergenic
1048814157 8:138316216-138316238 CACCGCGCCCGGCCTCATTGTGG - Intronic
1049237350 8:141518843-141518865 CACCGGGCCAGGCCGGGCAGCGG + Intergenic
1049446711 8:142634651-142634673 CACTGCACCCAGCCTTCCAGAGG + Intergenic
1049544558 8:143223878-143223900 CACCGCACCCTGCCACGCAGGGG - Intergenic
1049695433 8:143982179-143982201 CACCGCGCCCGGCCTTGCACGGG - Intronic
1049706002 8:144042608-144042630 CACCGCGCCCGGCCCCGAAAGGG + Intronic
1049796501 8:144499565-144499587 CACCCCACCCGGCCTCACAGGGG - Intronic
1049902930 9:187829-187851 CACCGTACCCGGCCTACCAGTGG - Intergenic
1050347846 9:4710505-4710527 CACCGCGCCCGGCCTCTCATTGG + Intronic
1051233442 9:14976012-14976034 CACCGTGCCTGGCCTTGCTCAGG - Intergenic
1052195799 9:25713472-25713494 CACCGCGCCCGGCCCTCCATGGG - Intergenic
1052443235 9:28525765-28525787 CACTGCGCCCGGCCCTTCAATGG - Intronic
1052526410 9:29625001-29625023 CACCGCGCCCGGCCAAGCCTGGG + Intergenic
1053008983 9:34622858-34622880 CACCGCGCCCGGCCAGGAAAAGG - Intronic
1053187291 9:36027369-36027391 CACCGTGCCCGGCCTAGAATGGG + Intergenic
1053251001 9:36573793-36573815 CACCACGCCCGGCCTAAAAGGGG + Intronic
1053251160 9:36574846-36574868 CACCGCGCCCGGCCTATAATTGG - Intronic
1053391022 9:37736287-37736309 CACCGCGCCCGGCCCACCAGAGG + Intronic
1053745949 9:41198111-41198133 CACCGTACCCGGCCTACCAGTGG - Intronic
1054682394 9:68233169-68233191 CACCGTACCCGGCCTACCAGTGG + Intronic
1055297606 9:74850429-74850451 CACCGCGCCCGGCCTTACGTTGG - Intronic
1055569657 9:77603675-77603697 CACTGTGCCCGGCCTCTCAGAGG - Intronic
1055618671 9:78100031-78100053 CTCCGCGCCCAGCCTTGGACTGG + Intergenic
1055809300 9:80133744-80133766 CACCACGCCCAGCCTTAAAGTGG - Intergenic
1055954558 9:81762043-81762065 CACTGCGCCCGGCCTTTTATAGG - Intergenic
1056090411 9:83200090-83200112 CACCGCGCCCGGCCTTTAGAAGG - Intergenic
1056880962 9:90393335-90393357 CACCATGCCCGGCCTTAAAGAGG + Intergenic
1057168082 9:92943937-92943959 CACCACGCCTGTCCTTGCTGAGG + Intergenic
1057177848 9:93012494-93012516 CACCACGCCTGGCCTTGCTGAGG - Intronic
1057471301 9:95359303-95359325 CACCGCGCCCGGCCTCATTGTGG - Intergenic
1057753791 9:97813712-97813734 CACTGCACCCGGCCTGGCAATGG - Intergenic
1058220982 9:102302002-102302024 CACCATGCCCGGCCTTGGAAAGG + Intergenic
1058479099 9:105372660-105372682 CACCGCGCCCGGCCTACCTGTGG - Intronic
1059015946 9:110515586-110515608 CACCGCGCCCGGCCTATGTGGGG + Intronic
1060489160 9:124069426-124069448 CACCGCGCCCGGCCAGGAAAGGG - Intergenic
1060495072 9:124112490-124112512 CGCCGTGCTTGGCCTTGCAGAGG - Intergenic
1060631732 9:125165023-125165045 CACCGCGCCCGGCTGGGAAGTGG + Intronic
1060802966 9:126556484-126556506 CACCGCGCCCGGCCTATAATAGG + Intergenic
1060974599 9:127757207-127757229 CACCGTGCCCAGCCTAGGAGGGG + Intronic
1061042429 9:128147988-128148010 CACCGCACCCGGCCTGGCAGAGG + Intergenic
1061056097 9:128223758-128223780 CACCGCGCCCGGCCCTAATGAGG - Intronic
1061184733 9:129046139-129046161 CACTGCGCCCGGCCTAGAATTGG + Intronic
1061282475 9:129605366-129605388 CACAGCGCCCGGCAGTGTAGGGG + Intergenic
1061340830 9:129979929-129979951 CACGGTGCCCGGCTGTGCAGTGG + Intronic
1061662290 9:132138204-132138226 CACCGCGCCCGGCCTCGTGCAGG + Intergenic
1061674428 9:132207813-132207835 CACCGTGCCTGGCCTTGCCCTGG - Intronic
1062127324 9:134870622-134870644 CACAGAGCCCGGCCCTGCGGGGG + Intergenic
1062263329 9:135674541-135674563 CACCACGCCCGGCCCTCGAGGGG - Intergenic
1062343994 9:136106493-136106515 CACCGTGCCCAGCCTGGGAGTGG + Intergenic
1062442093 9:136575351-136575373 CACCGCGCCCGGCCCTGATAAGG + Intergenic
1062493249 9:136819032-136819054 CACCGCGCCCGGCCTGGACAAGG - Intronic
1062561539 9:137144364-137144386 CACCGCGCCCGGCCAACCTGGGG - Intronic
1062662243 9:137643634-137643656 CACCGCGCCCGGCCGTATAAAGG + Intronic
1202782081 9_KI270718v1_random:8884-8906 CACCGTACCCGGCCTACCAGTGG - Intergenic
1185476406 X:418184-418206 CACCGCGCCCGGCCGAGAATTGG + Intergenic
1185574547 X:1159451-1159473 CACCGCGCCCAGCCAGGAAGGGG + Intergenic
1185586518 X:1245338-1245360 CACCGCGCCCGGCCTATAAACGG + Intergenic
1185668120 X:1784549-1784571 CACCGCGCCCGGCCGAGGAGAGG - Intergenic
1185758431 X:2670859-2670881 CACCGTGCCCGTCCTTGCCTTGG + Intergenic
1185998936 X:4986968-4986990 CACCGCGCCCGGCCTTGGTGGGG + Intergenic
1186971724 X:14852453-14852475 CACCACGCCCGGCCCTGAGGAGG + Intronic
1187225997 X:17375811-17375833 CCCTGCGCCCGGCCCAGCAGTGG + Exonic
1187907375 X:24079999-24080021 CACCGTGCCCGGCCCAGCAGAGG - Intergenic
1187973530 X:24682430-24682452 CACTGCGCCTGGTCTAGCAGTGG + Intergenic
1187974726 X:24693796-24693818 CTCCGCCCCCGGCCTTCCCGCGG - Intergenic
1188389065 X:29597439-29597461 CACCACGCCCGGCCTTGTTGAGG + Intronic
1188473998 X:30570890-30570912 CACTGCACCCGGCCTTGAATGGG - Intronic
1188479378 X:30621694-30621716 CACCGCGCCCGGCCGCAAAGGGG - Intergenic
1188489866 X:30725939-30725961 CACCGCGCCTGGCCTTAAAATGG + Intronic
1189391751 X:40582137-40582159 CACCGCGCCCGGCCTCCCATAGG - Intronic
1189472740 X:41326942-41326964 CACCGCGCCCAGCCATGTAAAGG - Intergenic
1189491879 X:41476416-41476438 CACCGCGCCTGGCCTTCATGTGG - Intergenic
1189731834 X:44029112-44029134 CACCGCGCCCGGCCCCGCGTGGG + Intergenic
1189949811 X:46217116-46217138 CACCGTGCCCGGCCATTAAGTGG + Intergenic
1190011408 X:46788378-46788400 CACCATGCCCCGCCATGCAGAGG - Intergenic
1190143990 X:47873954-47873976 CACCATGCCTGGCCTTACAGTGG + Intronic
1190224558 X:48535085-48535107 CACTGTGCCCGGCCTTACAGAGG - Intergenic
1190762926 X:53451462-53451484 CACCGCGCCCAGCCTATCTGGGG + Intergenic
1190770365 X:53509061-53509083 CACAGCGCCCGGCCTTTAAGAGG - Intergenic
1190837398 X:54113621-54113643 CACCGCGCCCGGCCTGGTGCAGG - Intronic
1191695868 X:63989632-63989654 CACTGCGCCTGGCCTTGAAATGG + Intergenic
1191868174 X:65722705-65722727 CACTGCGCCCGGCCATGCTCTGG + Intronic
1192414392 X:70965413-70965435 CACCGTGCCCGGCTTTGGATAGG - Intergenic
1192472428 X:71410743-71410765 CACTGCACCCGGCCTTTTAGGGG + Intronic
1192630219 X:72771690-72771712 CACCGCGCCCGGCCTAAGAGTGG - Intergenic
1192651491 X:72949114-72949136 CACCGCGCCCGGCCTAAGAGTGG + Intergenic
1192773428 X:74217047-74217069 CACCGCGCCCGGCCTTAGTTTGG + Intergenic
1193379769 X:80805645-80805667 CACCGCGCCCGGCCTGGGGTAGG - Intronic
1193668744 X:84356907-84356929 CACCGCGCCCGGCCCTCCTGTGG + Intronic
1194442186 X:93946455-93946477 CACCGCGCCCGGCCTTATTGTGG - Intergenic
1194666061 X:96678778-96678800 CACCGCGCCCGGCCGAGTACAGG - Intergenic
1195324028 X:103743591-103743613 CACCGCGCCCGGCCTCACCCAGG + Intergenic
1195488824 X:105442350-105442372 CACCGTGCCCGGCCATGAATTGG + Intronic
1195689958 X:107616364-107616386 CACCGCGCCCGGCCTTCTGCAGG - Intergenic
1196272772 X:113731885-113731907 CACCGCGCCCGGCCTGACAATGG + Intergenic
1196646953 X:118128248-118128270 CACCGCACCCGGCCTTTCTATGG - Intergenic
1196724706 X:118885732-118885754 CACCGTGCCCGGCCTAGAATGGG - Intergenic
1196786609 X:119426532-119426554 CGCCGCGCCCGGCCTTGGACTGG - Intronic
1196797370 X:119513145-119513167 CACCGCGCCCGGCCGAGAAAAGG + Intergenic
1196920527 X:120580872-120580894 CACCGCACCCGGCCGAGGAGAGG - Intergenic
1197734174 X:129838381-129838403 CACTGCGCCCGGCCTGTTAGAGG - Intronic
1198049173 X:132931896-132931918 CACCTCGCCTGGCCTTGCTGGGG - Intronic
1198379444 X:136070216-136070238 CACCGCGCCCGGCCGAGCCATGG - Intergenic
1199053213 X:143261973-143261995 CACCGCGCCCGGCCATGAATAGG - Intergenic
1199779118 X:151042202-151042224 CACCGCGCCCGGCCGAGTTGTGG - Intergenic
1200125024 X:153809296-153809318 CACCGCACCCGGCCTAGTGGTGG - Intronic
1200183859 X:154169145-154169167 CACCGCGCCTGGCCTTTTTGAGG - Intergenic
1200189513 X:154206273-154206295 CACCGCGCCTGGCCTTTTTGAGG - Intergenic
1200195266 X:154244082-154244104 CACCGCGCCTGGCCTTTTTGAGG - Intergenic
1200200918 X:154281203-154281225 CACCGCGCCTGGCCTTTTTGAGG - Intronic
1200228084 X:154430405-154430427 CACCGCGCCCGGCCTGTGAGGGG + Intronic
1200748504 Y:6923353-6923375 CACCGCGCCCGGCTGTGAATGGG + Intronic