ID: 904511542

View in Genome Browser
Species Human (GRCh38)
Location 1:31014107-31014129
Sequence TGGGCTGTCACATGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904511542_904511547 25 Left 904511542 1:31014107-31014129 CCTGGAAAACATGTGACAGCCCA 0: 1
1: 0
2: 0
3: 24
4: 344
Right 904511547 1:31014155-31014177 AGTGTGGTAGCACATGCCTGTGG 0: 2
1: 65
2: 525
3: 1617
4: 4089
904511542_904511545 9 Left 904511542 1:31014107-31014129 CCTGGAAAACATGTGACAGCCCA 0: 1
1: 0
2: 0
3: 24
4: 344
Right 904511545 1:31014139-31014161 AAACTTAAAAAAGCCAAGTGTGG 0: 1
1: 0
2: 9
3: 148
4: 1343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904511542 Original CRISPR TGGGCTGTCACATGTTTTCC AGG (reversed) Intronic
900291322 1:1924764-1924786 TGGGGTGTCACCTGTCCTCCAGG + Intronic
902136280 1:14308858-14308880 TGGTCTGTCAGATTATTTCCAGG + Intergenic
903300068 1:22372441-22372463 TGGGCTTTAACAAGTCTTCCAGG + Intergenic
903595083 1:24487855-24487877 TGGGGTTTCACATGTTGGCCAGG - Intergenic
903819527 1:26091359-26091381 TGGGGTTTCACATGTTGGCCAGG - Intergenic
904511542 1:31014107-31014129 TGGGCTGTCACATGTTTTCCAGG - Intronic
906691269 1:47794304-47794326 TGGGCTCTCACATGGCTGCCTGG + Intronic
907131985 1:52105250-52105272 TGGGGTTTCACATGTTGGCCAGG - Intergenic
907364625 1:53947610-53947632 TGGGTTGGCAGATGTTCTCCTGG + Intronic
907862704 1:58368834-58368856 TGGGGTTTCCCATGTTGTCCAGG - Intronic
908812852 1:68001684-68001706 TGGGGTTTCACATGTTAGCCAGG + Intergenic
911092266 1:94027224-94027246 TTGGCTGTTACATTTTGTCCAGG + Intronic
911404176 1:97415511-97415533 TGGGGTTTCACATGTTGGCCAGG + Intronic
913165019 1:116177202-116177224 TGGGCTTTTACAAGTTCTCCAGG + Intergenic
914680164 1:149933484-149933506 TGGGCATTCAGATGTTGTCCTGG - Exonic
914841601 1:151253602-151253624 TGAGTTGTCAAATCTTTTCCGGG + Intergenic
914856847 1:151358520-151358542 TGGGGTTTCACATGTTGACCAGG + Intergenic
917214899 1:172668255-172668277 TTGGTTGTCACATGTTTTGCGGG - Intergenic
918928917 1:190827262-190827284 TTGGCTGTGACAGGTTCTCCAGG - Intergenic
919320076 1:196025248-196025270 TTGGCTGGCACATTTTTTTCTGG + Intergenic
920039026 1:203084109-203084131 TGGGGTGACAGAGGTTTTCCAGG + Intronic
922285585 1:224167961-224167983 TGGGGTTTCACATGTTGGCCAGG - Intergenic
922543994 1:226441554-226441576 TGGGGTTTCACATGTTGGCCAGG + Intergenic
923587190 1:235284167-235284189 TGGGGTTTCACATGTTGGCCAGG - Intronic
923608265 1:235465267-235465289 TTTGCTGTAACATGTGTTCCAGG - Intronic
1063605975 10:7523326-7523348 TGAGTTGCCACATGTTTTCCAGG + Intergenic
1064180176 10:13107906-13107928 TGTGCTGAAACATGTTTGCCTGG + Intronic
1064535453 10:16353223-16353245 TGGGATTTCACATGTTGGCCAGG - Intergenic
1064617880 10:17181342-17181364 TCTGCTGTCACATTTTTCCCAGG + Intronic
1064758535 10:18594640-18594662 TGGGGTTTCACATGTTGGCCTGG + Intronic
1065038932 10:21671206-21671228 TGGGATTTCACATGTTGGCCAGG + Intronic
1065432628 10:25674713-25674735 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1065995767 10:31057824-31057846 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1066143291 10:32529211-32529233 TGGGGTTTCACATGTTGGCCAGG + Intronic
1066683987 10:37963311-37963333 TGGGATTTCACATGTTGGCCAGG + Intronic
1067848563 10:49740876-49740898 TGGGCTGGCACCTGTTCACCTGG + Intronic
1068755454 10:60648036-60648058 TGGGGTTTCACATGTTGGCCAGG + Intronic
1069105437 10:64378164-64378186 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1069334271 10:67329178-67329200 TGGGTTTTCCCATGTTGTCCGGG - Intronic
1070100808 10:73384590-73384612 TGGGGTTTCACATGTTGGCCAGG + Intronic
1070552102 10:77498018-77498040 TGAGCTGTGGCAGGTTTTCCAGG - Intronic
1071541621 10:86490021-86490043 TGGGGTTTCACCTGTTTGCCAGG - Intronic
1071629695 10:87208380-87208402 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1071687954 10:87781834-87781856 TGGGGTCTTACATGTTGTCCAGG + Intronic
1073189775 10:101643113-101643135 TGGGCGGACACATGCTTTCTTGG - Intronic
1073243093 10:102071009-102071031 TGGGGTTTCACATGTTAGCCAGG + Intergenic
1074638412 10:115348162-115348184 TGGGGTTTCACATGTTGGCCAGG + Intronic
1075937386 10:126354214-126354236 TGGGTTGTCACCTGGTTTCTTGG + Intronic
1076422969 10:130345190-130345212 AGGGCTTTCACTTGCTTTCCAGG + Intergenic
1078157903 11:8814470-8814492 TGAGGTGTCATATTTTTTCCAGG + Intronic
1079006599 11:16795596-16795618 TGGGGTTTCACATGTTGGCCAGG - Intronic
1079273129 11:19007219-19007241 TGGGCTTTGCCATGTTGTCCAGG + Intergenic
1080831629 11:35898682-35898704 TGGGGTTTCACATGTTGCCCAGG + Intergenic
1081165822 11:39808271-39808293 TGGACTGAGACATGTTTTCCTGG + Intergenic
1082761711 11:57133074-57133096 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1083553389 11:63607467-63607489 TGGGGTCTCACATGTTTCCCAGG - Intronic
1083596999 11:63922728-63922750 TGGGCTGTGAGACCTTTTCCTGG - Intergenic
1086034055 11:82395347-82395369 TGGGGTTTCACATATTATCCAGG + Intergenic
1086796712 11:91113859-91113881 TGGGCTGTTCCTTTTTTTCCAGG + Intergenic
1086955809 11:92933718-92933740 TGGGGTTGCACATGCTTTCCTGG + Intergenic
1087492565 11:98846747-98846769 TGGGTTTTCCCATGTTTCCCAGG + Intergenic
1087656958 11:100935938-100935960 TGGGGTCTTACATGTTTCCCAGG - Intronic
1088282468 11:108149587-108149609 TGTCCTGTCACTTGTTTTCTTGG - Intergenic
1089039002 11:115427813-115427835 TGGGCTTTCACGTGTTAGCCAGG - Intronic
1089192587 11:116663988-116664010 TGGGGTCTCTCATGTTTTCCAGG - Intergenic
1089314974 11:117585438-117585460 TAGGCTTTCACATGTTGGCCTGG + Intronic
1089825518 11:121272526-121272548 TGGGGTTTCAAATGTTGTCCAGG - Intergenic
1090048193 11:123354752-123354774 TGGGCAGTCACATGGGTTGCTGG + Intergenic
1090644394 11:128755974-128755996 TGGGCTGTCTCTTGTCTCCCAGG - Intronic
1092130127 12:6105417-6105439 TGGGGTTTCACATGTTGGCCAGG + Intronic
1093073583 12:14733563-14733585 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1093624616 12:21330299-21330321 TGGAGTGTCACATGTTGCCCAGG - Intronic
1093650160 12:21634130-21634152 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1096284673 12:50288362-50288384 TGGGGTGTCACATGTTGCCTAGG + Intergenic
1096408078 12:51358193-51358215 TGCACTGTCACAACTTTTCCTGG - Exonic
1097099250 12:56575235-56575257 TGGGGTTTCACATGTTGCCCAGG - Intronic
1098234046 12:68401554-68401576 TGGGATTTCACATGTTGCCCAGG - Intergenic
1100342236 12:93690341-93690363 AGGGCTATCATTTGTTTTCCAGG - Intronic
1100374513 12:94001443-94001465 TGGGCTTTCACATGTTGGCCAGG + Intergenic
1100640959 12:96481957-96481979 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1100968463 12:100040488-100040510 TGGGGTTTCACATGTTGGCCAGG - Intronic
1101373783 12:104153386-104153408 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1102694163 12:114785252-114785274 TGGGGTCTCATATGTTGTCCAGG + Intergenic
1103264088 12:119614214-119614236 TGGGCTTTCACATGTTGGCCAGG - Intronic
1103744322 12:123111757-123111779 TGGGCTGTTTCATCTGTTCCGGG - Intronic
1104867095 12:131962330-131962352 TGGGCTTTCACACGTTTGGCTGG - Intronic
1105479626 13:20762378-20762400 TGGGGTTTCACATGTTGGCCAGG + Intronic
1106252822 13:27995872-27995894 TGGGGTTTCACATGTTCCCCAGG - Intergenic
1106911504 13:34468040-34468062 TGGGGTCTCACATGTTGCCCAGG - Intergenic
1107322519 13:39204546-39204568 TGGGTTGTCACAAGTTTTCTTGG - Intergenic
1111267053 13:85830354-85830376 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1112141095 13:96643691-96643713 TGGTCTGTCTAATGTTTCCCTGG - Intronic
1112497380 13:99915828-99915850 TGGGCTTTGCCATGTTTGCCAGG - Intergenic
1113120501 13:106919240-106919262 TGGGGTGTCACATCACTTCCTGG + Intergenic
1113520949 13:110940544-110940566 TGTGCTGCCACAAGTTTTCACGG + Intergenic
1117356659 14:54930401-54930423 TGGGGTCTCATATGTTGTCCAGG + Intergenic
1118784080 14:69031123-69031145 TGAGGTTTCACATGTTATCCAGG - Intergenic
1120713956 14:87820627-87820649 TGAGCTGTCACTTGTTCTTCAGG + Intergenic
1121078602 14:91089628-91089650 TGGGATTTCACATGTTGGCCAGG - Intronic
1121252678 14:92511601-92511623 AGGGCTGTAACATGTTTCCAAGG - Intergenic
1121727872 14:96166235-96166257 TGGGCTGTCACTTCCCTTCCAGG + Intergenic
1124059892 15:26281327-26281349 TGGGGTTTGCCATGTTTTCCAGG + Intergenic
1124954663 15:34352315-34352337 TGGGATCTCACATTGTTTCCTGG + Intronic
1125005190 15:34808837-34808859 TGGGTTTCCACATGTTTCCCAGG - Intergenic
1125357283 15:38829805-38829827 TGGGCTTTCTCATGTTTACAGGG - Intergenic
1125836243 15:42754270-42754292 TGGGGTGTCACCTGTTGCCCAGG + Intronic
1126374985 15:47988615-47988637 TGTGATGTCACAAGTTCTCCAGG + Intergenic
1126957575 15:53951403-53951425 TGGGCTGACCCAGGTTTGCCAGG + Intergenic
1128302711 15:66576895-66576917 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1129107756 15:73320958-73320980 TGGGCTCTCACATAGTTTGCTGG + Exonic
1130658217 15:85808213-85808235 TGGGATTTCACATGTTGGCCAGG + Intergenic
1130752787 15:86730592-86730614 TGGGCTGCCATTTGCTTTCCTGG + Intronic
1131702471 15:94953870-94953892 TGGGGTTTCACATGTTAGCCAGG + Intergenic
1133312699 16:4860548-4860570 TGGACTGTGACAGGTTCTCCTGG + Intronic
1134313219 16:13095068-13095090 TGGTCTGTCAAATGGTTTACAGG + Intronic
1134642726 16:15842193-15842215 TGGGGTTTCACATGTTGGCCAGG - Intronic
1135774775 16:25247452-25247474 TCTGCTGTCACATGCTCTCCTGG + Intronic
1137948690 16:52761201-52761223 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1138610818 16:58122387-58122409 TGGGGTTTCACATGTTGCCCAGG - Intronic
1138930879 16:61654523-61654545 TGGGCTTTCACAGTTTTTCAAGG + Intronic
1139124815 16:64065475-64065497 TACTCTGTCACATCTTTTCCAGG + Intergenic
1139606195 16:68020438-68020460 TGGGGTTTCGCATGTTTACCAGG + Intronic
1140172626 16:72622662-72622684 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1140435220 16:74941500-74941522 TGGGGTTTCACATGTTGGCCAGG - Intronic
1140544458 16:75792848-75792870 TGGACTCTTCCATGTTTTCCTGG + Intergenic
1140738438 16:77919894-77919916 TGGGGTTTCACATGTTAGCCAGG - Intronic
1144118063 17:12120267-12120289 TGGGGTTTCACATGTTGGCCAGG - Intronic
1144147858 17:12415505-12415527 TGGCCATTCAAATGTTTTCCTGG + Intergenic
1144253856 17:13446033-13446055 TGGGGTTTCACATGTTTCTCAGG + Intergenic
1144725646 17:17500881-17500903 TGGGGTTTCACATGTTGACCAGG + Intergenic
1146112257 17:30100574-30100596 TGGGGTTTCACATGTTAGCCAGG - Intronic
1150385346 17:64754979-64755001 TGGGTTTTCACATGTTGGCCAGG + Intergenic
1150712852 17:67546506-67546528 TGGGATCTCAGAGGTTTTCCAGG + Intronic
1150752795 17:67881692-67881714 TGGGGTTTCACATGTTGGCCAGG + Intronic
1151733408 17:75924019-75924041 TGGGGTTTCACATGTTGGCCAGG - Intronic
1152593477 17:81225365-81225387 TGGGGTCTCACATGTTGCCCAGG + Intergenic
1153705070 18:7736993-7737015 TGGGGTTTTACATGTTTGCCAGG + Intronic
1154950818 18:21207812-21207834 TGGGGTTTCACATGTTAGCCAGG + Intergenic
1155464213 18:26117526-26117548 AGGGCTGTCAGATGATATCCAGG - Intergenic
1157011261 18:43651931-43651953 AGGTCTGTCCCATGTTTTTCTGG - Intergenic
1157120819 18:44909378-44909400 TCGGCTGTCATTTGTTCTCCTGG + Intronic
1157409556 18:47452397-47452419 TGGCCTGTCACATCATTTCCTGG + Intergenic
1157476586 18:48027904-48027926 AGAGTTGTCACATGTTCTCCTGG - Exonic
1158622089 18:59041487-59041509 TGGACTGTCACAAGCTCTCCAGG + Intergenic
1162249177 19:9428136-9428158 TGGCCAGTCACTTGTTTTACTGG - Intronic
1162706125 19:12555908-12555930 TGGCCTGGCACATGTGGTCCTGG + Intronic
1165189897 19:34054025-34054047 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1166575799 19:43836530-43836552 TGGGGTTTCACATGTTGGCCAGG + Intronic
1168669767 19:58231588-58231610 TGGGGTCTCACATGTTGCCCAGG + Intronic
926022388 2:9507901-9507923 TGGAGTTTCACATGTTGTCCAGG + Intronic
927406654 2:22777954-22777976 TGGTCTATTACATCTTTTCCAGG - Intergenic
929680362 2:43988047-43988069 TGGGGTTTCACATGTTGGCCGGG - Intronic
929783146 2:44970828-44970850 TGAGCTGTCAGATGATTCCCTGG + Intergenic
930665140 2:54094418-54094440 CGGGGTTTCACATGTTTGCCAGG + Intronic
931107231 2:59069720-59069742 TGGGTTGACACATCATTTCCAGG - Intergenic
932358464 2:71086138-71086160 TGGGCTGTCATTTGTCTACCTGG + Intergenic
932370703 2:71185024-71185046 TGGGCTGTCATTTGTCTACCTGG + Exonic
932862533 2:75309388-75309410 TGGGATTTCACATGTTGGCCAGG + Intergenic
933942603 2:87257051-87257073 TGGGGTTTCACATGTTAACCAGG - Intergenic
935989614 2:108706935-108706957 TGGGGTTTCACTTGTTTCCCAGG - Intergenic
936337619 2:111604517-111604539 TGGGGTTTCACATGTTAACCAGG + Intergenic
936411513 2:112262247-112262269 TAGGCTAACCCATGTTTTCCAGG + Intergenic
938094817 2:128454703-128454725 TGGAGTGTGACATGTTTTCTTGG - Intergenic
938102731 2:128508261-128508283 TGGGGTTTCACATGTTGGCCAGG - Intergenic
938248356 2:129796049-129796071 TGCACTGTCTCATGTTATCCTGG - Intergenic
938822839 2:134976271-134976293 AATGCTGTCACATGGTTTCCAGG + Intronic
940218754 2:151328648-151328670 TGGGTTTTCACATGTTGGCCAGG - Intergenic
941071656 2:160961394-160961416 TGGGGTCTCATATGTTGTCCAGG - Intergenic
942441981 2:176046389-176046411 TGGGGTTTCACATGTTTGTCAGG - Intergenic
942572417 2:177327558-177327580 TGGGATTTCCCATGTTGTCCAGG - Intronic
942724989 2:178996453-178996475 TGGGAAGTTACATGTTTACCTGG - Intronic
942920629 2:181369490-181369512 TGCCCTGTCACATGTGGTCCAGG + Intergenic
945558763 2:211311877-211311899 TGGGATGCCACTTGGTTTCCAGG - Intergenic
947138743 2:227001284-227001306 TGGGGTTTCACATGTTAGCCAGG + Intergenic
947948173 2:234124587-234124609 TGGGCAGTGCCATCTTTTCCTGG + Intergenic
948373768 2:237506881-237506903 TGGGTCGTAACATGTTTTCTAGG + Intronic
1169277589 20:4244058-4244080 TGGGCTGTCACCTGTAAACCTGG - Intronic
1169773360 20:9225438-9225460 TCGACTGTTACATCTTTTCCAGG - Intronic
1170232630 20:14067312-14067334 TGGGGTTTCACATGTTGGCCAGG + Intronic
1170850976 20:20004278-20004300 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1171116436 20:22528783-22528805 TGGACTATAACATGTTTTACTGG - Intergenic
1172591198 20:36119409-36119431 TGGGGTTTCACATGTTGGCCAGG - Intronic
1172612437 20:36261911-36261933 AGGGCTGTCACGGGTTTTCTGGG + Intronic
1172918080 20:38459150-38459172 TGGGCCTTCACATGTTGGCCAGG + Intergenic
1173646373 20:44635705-44635727 TGGGGTTTCACATGTTGGCCAGG - Intronic
1173804729 20:45916964-45916986 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1174354432 20:49988604-49988626 TGGGGTGGCACCTGTTTCCCGGG + Exonic
1174430665 20:50466238-50466260 GGGGCTATGACATGTTGTCCAGG - Intergenic
1177045349 21:16161937-16161959 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1178018291 21:28377788-28377810 TGTGGTTTCAGATGTTTTCCAGG - Intergenic
1178097479 21:29231736-29231758 CGGGGTTTCACATGTTATCCAGG + Intronic
1179649083 21:42794915-42794937 TGGCCTGTCTCATCTTCTCCAGG - Intergenic
1179783008 21:43714584-43714606 TGGGGTTTCACATGTTAGCCAGG + Intergenic
1179949728 21:44702974-44702996 AGGGCTGTCTCATGGTTTCCTGG - Intronic
1182073760 22:27480803-27480825 TGGGCTGTCTCAGGTTCTCCGGG + Intergenic
1182396039 22:30036551-30036573 TTGCCAGTCACATGTCTTCCGGG + Intergenic
1182566725 22:31205720-31205742 TTGGCAGTCACATGCTTCCCTGG - Exonic
1182838695 22:33365805-33365827 TGGGGTTTCACATGTTGGCCAGG + Intronic
1183849706 22:40574623-40574645 CGGGGTTTCACATGTTGTCCAGG + Intronic
1184359788 22:44008299-44008321 TGGGGTTTCACATGTTGGCCAGG + Intronic
949217144 3:1583561-1583583 TGGGCTGTTCCAGGTGTTCCAGG - Intergenic
949859342 3:8491488-8491510 TGGGCTGACATCTGCTTTCCTGG - Intergenic
950324540 3:12094044-12094066 TGGGATTTCACATGTTGGCCAGG + Intronic
950484221 3:13263632-13263654 TGGGATTTCACATGTTGGCCAGG + Intergenic
951911565 3:27755578-27755600 TGGGGTCTCACATGTTGCCCAGG + Intergenic
953538729 3:43795713-43795735 TGGGCTGCCCCAGGGTTTCCAGG + Intergenic
954068832 3:48128164-48128186 TGGGGTTTCACATGTTGGCCAGG - Intergenic
954830326 3:53415994-53416016 TGGGGTTTCACATGTTGCCCAGG + Intergenic
955269736 3:57485590-57485612 TGGGGTTTCACATGTTGGCCAGG + Intronic
955366942 3:58318806-58318828 TGGGGTTTCACATGTTGGCCAGG - Intergenic
956125109 3:66003658-66003680 TGGGGTTTCACATGTTAGCCAGG + Intronic
957196712 3:77078298-77078320 TTAGTTGACACATGTTTTCCTGG + Intronic
958184350 3:90101078-90101100 TAGTCATTCACATGTTTTCCAGG - Intergenic
958549089 3:95592141-95592163 TAGGCTGTCCCAGGATTTCCTGG + Intergenic
958740655 3:98066608-98066630 TGAGCTGTAACATGTTTTGCTGG + Intergenic
959521141 3:107324272-107324294 AGGGGTGTCACATGTGTCCCTGG - Intergenic
960192024 3:114718031-114718053 TGGACTGTCAGATGTTTTGATGG + Intronic
960404073 3:117238355-117238377 TGGCCTGGCTCATGTTTCCCTGG - Intergenic
960552075 3:118987069-118987091 TGAGCTTCCACACGTTTTCCTGG - Intronic
961634295 3:128323203-128323225 AGGGCTGACAAGTGTTTTCCTGG - Intronic
962391768 3:134978245-134978267 TGGGCTCTCTCTTGTCTTCCGGG + Intronic
962697406 3:137963688-137963710 TGGGTTGTCACATCATTGCCAGG + Intergenic
964175010 3:153817169-153817191 TGGGTTTTCACATGTTAGCCAGG - Intergenic
965867613 3:173224827-173224849 TGGGATCTGACATGATTTCCAGG - Intergenic
966099334 3:176247330-176247352 TGGGCTTTCAGATATTCTCCAGG + Intergenic
966409852 3:179636686-179636708 TGGGGTTTCACATGTTGGCCAGG + Intergenic
967861896 3:194158802-194158824 TGGGCTGTCACAAGTGTCTCCGG + Intergenic
968933677 4:3597881-3597903 TGGTCTGTGGCATGTTTTCCTGG - Intergenic
969140969 4:5071233-5071255 TGTGGAGTAACATGTTTTCCTGG - Intronic
971304614 4:25468806-25468828 TGGGGTTTCACATGTTGGCCAGG + Intergenic
971455356 4:26839113-26839135 AGGGCTGTCAAATAGTTTCCTGG + Intergenic
971746022 4:30582213-30582235 TTGACTTTCTCATGTTTTCCAGG + Intergenic
971841699 4:31861464-31861486 TGAGCTGTAACATGTCTTCTTGG - Intergenic
972614428 4:40684589-40684611 TGGGCAGACACATGTTCCCCAGG - Intergenic
972653006 4:41037824-41037846 TGGGGTTTCACATGTTGGCCAGG - Intronic
974129909 4:57741766-57741788 TGGGCTGTGTCATATTTTCATGG + Intergenic
974399334 4:61381744-61381766 TTGGCTGTCACTTTTTTCCCTGG - Intronic
974659634 4:64870446-64870468 TGAGCTGTTATATGTTTTCCTGG - Intergenic
974937852 4:68429696-68429718 TGGGGTTTCACATGTTAGCCAGG + Intergenic
975990162 4:80250916-80250938 TGGGTTTTCACCTGTTGTCCAGG - Intergenic
977920843 4:102640966-102640988 TGGGCTGTATCATTTTTTTCTGG - Intronic
978718300 4:111873391-111873413 TGGGGTTTCACATGTTGGCCAGG - Intergenic
979138107 4:117136052-117136074 TGGGCTTTCCCATGTAGTCCAGG - Intergenic
979558436 4:122076678-122076700 TTGGCAGTCACATGCTTCCCTGG + Intergenic
979731162 4:124024169-124024191 TGGGGTTTCACATGTTGGCCAGG - Intergenic
979842008 4:125453513-125453535 TGGGTTTTCACATGTTGGCCAGG - Intronic
980303622 4:131026863-131026885 TGGGGTTTCACATGTTGCCCAGG + Intergenic
982558408 4:156898846-156898868 TGGGGTTTCACATGTTTTCTAGG + Intronic
983597297 4:169484237-169484259 TGGGATTTCACATGTTGGCCAGG + Intronic
983652854 4:170050984-170051006 TGGGGTTTCACATGTTGGCCAGG + Intergenic
984618336 4:181924002-181924024 TGGGCTCTTACATGTCTTACTGG + Intergenic
985482142 5:120053-120075 TGTGCTCTCACATGTTGCCCAGG - Intergenic
987221229 5:15792437-15792459 TGAGCTTTCAAACGTTTTCCAGG - Intronic
988371023 5:30367221-30367243 CGGGGTTTCACATGTTATCCAGG + Intergenic
989638539 5:43560796-43560818 CGGGGTTTCACATGTTGTCCAGG - Intergenic
990007075 5:50956039-50956061 TGGCATGTCATATGGTTTCCAGG - Intergenic
992431293 5:76714295-76714317 TGGTATGTCACATTTTTTTCTGG + Intergenic
993469462 5:88288945-88288967 TTGGCTGCCACATGACTTCCCGG - Intergenic
993508203 5:88737301-88737323 TGGGCACTTACATGATTTCCTGG - Intronic
994360997 5:98848090-98848112 AGGGGTCTCACATGTTTCCCAGG - Intergenic
994808112 5:104478287-104478309 TGGGTTCTGCCATGTTTTCCAGG - Intergenic
994927704 5:106139740-106139762 TGGGCTGTTTCTAGTTTTCCTGG - Intergenic
995797892 5:115961596-115961618 TGGGCTGGAACTGGTTTTCCCGG - Intergenic
996815138 5:127566003-127566025 TTGGCAGTCACAATTTTTCCAGG - Intergenic
998436326 5:142112192-142112214 TGGGGTTTCACATGTTGGCCAGG - Intronic
999751309 5:154629969-154629991 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1001644799 5:173272038-173272060 TGGGGTGTCACTAGTTTGCCGGG + Intergenic
1001700958 5:173706167-173706189 TGTGCTGTCACGTGTTTCCAGGG + Intergenic
1001991460 5:176119055-176119077 GGGGTTGTCCCATGTTGTCCAGG - Intronic
1002106623 5:176882413-176882435 GGGGATGTCACATGTCTCCCAGG - Intronic
1002225416 5:177719073-177719095 GGGGTTGTCCCATGTTGTCCAGG + Intronic
1002268433 5:178052132-178052154 GGGGTTGTCCCATGTTGTCCAGG - Intronic
1002417506 5:179128109-179128131 TGGGCTGGCACAGGTCATCCCGG - Exonic
1003118722 6:3301853-3301875 TGGGCTGTCACCTCCTATCCTGG - Intronic
1003725084 6:8752117-8752139 TGGGCTTTCGCATGTTGGCCAGG + Intergenic
1004546820 6:16605934-16605956 TAGGGTCTCACATGTTTCCCAGG - Intronic
1004951448 6:20677259-20677281 TGGGCTTTCACCTGTTGTCCCGG + Intronic
1005396156 6:25384028-25384050 TGGGGTTTCACATGTTTGCCAGG + Intronic
1005499652 6:26418593-26418615 GGGCCTGTCAGAGGTTTTCCTGG - Intergenic
1006090326 6:31624989-31625011 TGGGGTTTCACATGTTGGCCAGG + Intronic
1007502671 6:42310598-42310620 GGGGCTGTCCCATGCCTTCCAGG - Intronic
1007643105 6:43358745-43358767 TGGGGTTTCACATGTTGGCCAGG + Intronic
1007688652 6:43683146-43683168 TGGGCTTTGATCTGTTTTCCAGG - Intronic
1007874086 6:45075987-45076009 TGGCCTGTTACATGTTTAGCTGG + Intronic
1008330217 6:50236285-50236307 TTGTCTGTGACATGTTTTCCAGG + Intergenic
1008330224 6:50236349-50236371 TTGTCTGTGACATGGTTTCCAGG + Intergenic
1008919992 6:56832928-56832950 TGGGGTTTCACATGTTGGCCAGG + Intronic
1009424158 6:63496114-63496136 TGGGATTTCACATGTTGGCCAGG + Intergenic
1010182073 6:73098000-73098022 TTGAGTGTCTCATGTTTTCCTGG - Intronic
1010241499 6:73620112-73620134 TGGGGTTTCACATGTTGGCCAGG + Intronic
1010390230 6:75328677-75328699 TGGGGTTTCACATGTTTGCCAGG + Intronic
1011820719 6:91250264-91250286 TATGTTGTCACTTGTTTTCCTGG + Intergenic
1013100904 6:106986030-106986052 TGGAGTTTCACATGTTTGCCAGG + Intergenic
1013209945 6:107977789-107977811 TGGGGTTTCCCATGTTTGCCAGG + Intergenic
1014384005 6:120779272-120779294 TGGGCTGTTCCATGTATTCTGGG + Intergenic
1016276128 6:142355065-142355087 TGGGGTTTCTCATCTTTTCCTGG + Intronic
1017830375 6:158122588-158122610 TGGGGTTTCACATGTTGGCCAGG - Intronic
1019908414 7:4082342-4082364 TGGGGTTTCACATGTTGGCCAGG - Intronic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1020913255 7:14159861-14159883 TGGGGTTTCACATGTTGGCCAGG + Intronic
1022436495 7:30390945-30390967 TGTGCTTTAACATGTTTTCTTGG - Intronic
1022700682 7:32757051-32757073 TGGGAGGTCCCATGTTTTACTGG - Intergenic
1024183893 7:46928168-46928190 TGGGCTGTTACAAGGCTTCCAGG - Intergenic
1026263592 7:68777108-68777130 TGGGGTTTCACATGTTGTTCAGG + Intergenic
1026264122 7:68781777-68781799 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1026574970 7:71564475-71564497 TGGGGTTTCACATGTTGGCCAGG + Intronic
1027432018 7:78124269-78124291 TGGGCCTCCACATGGTTTCCTGG - Intronic
1027515823 7:79140053-79140075 GGGGATGTCAGATGTATTCCAGG - Intronic
1028185917 7:87785220-87785242 GGGGCTGTCCCAAGTGTTCCAGG + Intronic
1028600714 7:92597607-92597629 TGGGCTTTCACATGTTGACCAGG + Intergenic
1029295634 7:99538270-99538292 CGGGCTCTCACATGTTGCCCTGG + Intergenic
1029625230 7:101716571-101716593 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1029689042 7:102168454-102168476 TGGGGTTTCACATGTTGGCCAGG - Intronic
1031799569 7:126224745-126224767 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1032006760 7:128308521-128308543 TGGGCTGTCAAATGTTCTTACGG - Exonic
1032165876 7:129544272-129544294 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1032571860 7:133009170-133009192 TGGGGTGTCACATGTTGGCCAGG - Intronic
1033553260 7:142466551-142466573 TGGGGTTTCACATGTTAGCCAGG - Intergenic
1036704588 8:11037414-11037436 TGGGCTGTGCCATGTTGTCCAGG + Intronic
1036926743 8:12914309-12914331 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1036937094 8:13013757-13013779 TGGGGTTTCACATGTTGGCCAGG - Intronic
1037881621 8:22576242-22576264 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1038795195 8:30703553-30703575 TGGGTTTTGACATGTTTCCCAGG - Intronic
1039487611 8:37923740-37923762 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1039788285 8:40853361-40853383 TGGGGTTTCACATGTTGGCCAGG - Intronic
1039847286 8:41334519-41334541 TGGGCAGTCACCAGGTTTCCAGG - Intergenic
1042098678 8:65248559-65248581 TGGGCTGCCATATGTTGTTCTGG - Intergenic
1042177897 8:66055749-66055771 TGGGGTTTCCCATGTTTGCCAGG - Intronic
1043215634 8:77583915-77583937 TGGGATTTCACATGTTGCCCAGG + Intergenic
1043883419 8:85570489-85570511 TGGGGTTTCACATGTTTCCCAGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1045361301 8:101436195-101436217 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1047004842 8:120609829-120609851 TGTTCTGTCTGATGTTTTCCAGG + Intronic
1047263953 8:123288105-123288127 TGGGATTTCACATGTTGGCCAGG - Intergenic
1047788993 8:128183124-128183146 CAGGCTGTTAGATGTTTTCCAGG + Intergenic
1048486735 8:134855299-134855321 TGGGGTCTCACATGTTGCCCAGG + Intergenic
1048834306 8:138503699-138503721 TGGGCTGGCAAAGGCTTTCCTGG + Intergenic
1049715682 8:144089908-144089930 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1049903380 9:191839-191861 TTTGCTGTTACATGTTTACCAGG - Intergenic
1050531565 9:6594502-6594524 AGGGCTTTGCCATGTTTTCCAGG - Intronic
1053831409 9:42085693-42085715 TGAGCTGTCACATGTATCACTGG + Intronic
1054456466 9:65433935-65433957 TGGTCTGTGGCATGTTTTCCTGG + Intergenic
1054599138 9:67101745-67101767 TGAGCTGTCACATGTATCACTGG - Intergenic
1054885142 9:70188794-70188816 TGGGGTCTCACATGCTGTCCAGG + Intronic
1055959551 9:81807570-81807592 TGGAGTGTCACATATTTTCATGG - Intergenic
1056268902 9:84926753-84926775 TTGGTTGTCTCATGTATTCCAGG + Intronic
1056934075 9:90902545-90902567 TGGCCTGTCCCATGGTGTCCGGG - Intergenic
1058815176 9:108676350-108676372 TGGGGTTTCACATGTTGCCCAGG + Intergenic
1058968053 9:110055384-110055406 TGAGGTTTCACATGTTGTCCAGG + Intronic
1060692560 9:125677245-125677267 TGGGGTTTCACATGTTGACCAGG - Intronic
1061111263 9:128573011-128573033 TTGACTGTCACATGGTTTTCAGG + Intronic
1061198682 9:129123278-129123300 TGGGGTTTCACATGTTGGCCAGG - Intronic
1062061633 9:134499819-134499841 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1062291253 9:135796038-135796060 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1185578569 X:1193002-1193024 TGGGGTTTCACATGTTGGCCAGG + Intronic
1186175417 X:6921190-6921212 TAGGGTCTCACATGTTGTCCAGG - Intergenic
1186663589 X:11695174-11695196 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1188282267 X:28284889-28284911 TGGGGTTTCACATGTTACCCAGG + Intergenic
1188726606 X:33591762-33591784 TGGGGTTTCACGTGTTATCCAGG - Intergenic
1189919681 X:45891243-45891265 TGGGGTCTCGCATGTTTCCCAGG + Intergenic
1190195489 X:48314435-48314457 TGGGGTGACACATTTTTCCCAGG + Intergenic
1190661941 X:52662657-52662679 TGGGGTGACACATTTTTCCCAGG + Intronic
1194001310 X:88432987-88433009 TGGCCTTTTATATGTTTTCCAGG + Intergenic
1194051017 X:89069306-89069328 TGGGCTTTCACAATTTTTCATGG + Intergenic
1195776369 X:108410447-108410469 TGGCCTTTACCATGTTTTCCAGG + Intronic
1196840545 X:119855105-119855127 CGGGATGTCACATGTTGGCCAGG - Intergenic
1197851421 X:130864820-130864842 TGGGGTTTCACATGTTGGCCAGG - Intronic
1200003100 X:153072194-153072216 TGGGCTGGCGCCTGTGTTCCCGG + Intergenic
1200004623 X:153077815-153077837 TGGGCTGGCGCCTGTGTTCCCGG - Intergenic