ID: 904513727

View in Genome Browser
Species Human (GRCh38)
Location 1:31036486-31036508
Sequence GGATCACTTGAGGCGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 5, 2: 18, 3: 150, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904513718_904513727 14 Left 904513718 1:31036449-31036471 CCTCTACATGGCCAGTACTTTCG 0: 1
1: 0
2: 1
3: 2
4: 60
Right 904513727 1:31036486-31036508 GGATCACTTGAGGCGAGGCCAGG 0: 1
1: 5
2: 18
3: 150
4: 573
904513721_904513727 3 Left 904513721 1:31036460-31036482 CCAGTACTTTCGAGGCCAAGGCA 0: 1
1: 6
2: 163
3: 658
4: 1579
Right 904513727 1:31036486-31036508 GGATCACTTGAGGCGAGGCCAGG 0: 1
1: 5
2: 18
3: 150
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904513727 Original CRISPR GGATCACTTGAGGCGAGGCC AGG Intronic
900695655 1:4008204-4008226 GGATCACATGAAGAGAGGCCTGG + Intergenic
901287368 1:8091580-8091602 GGATCTCTTGAGACCAGGCTAGG - Intergenic
901544378 1:9944337-9944359 GGATCATTTGAGCCCAGGCTGGG + Intronic
901604118 1:10445923-10445945 GGATCACTTGAGTCCAGCTCAGG - Intronic
901827404 1:11871171-11871193 GGATCACTTGAGCCCAGCCTGGG + Intergenic
902282634 1:15385561-15385583 GGATCACTTGAGACCAGCCTGGG + Intronic
902552566 1:17228198-17228220 GGATCACTTGAGACCAGCCTGGG - Intronic
902558139 1:17259278-17259300 GGATCACTTGAGGTCGAGCCTGG - Intronic
902567427 1:17321328-17321350 GGACCACTGGGGGCCAGGCCAGG + Intronic
902909847 1:19587534-19587556 GGATCACTTGAGCCCAGCCTGGG + Intergenic
903104520 1:21063948-21063970 GAATCACTTGAGGTCAGGTCAGG - Intronic
903942158 1:26939238-26939260 GGATCACTTGAGGCTGAGGCGGG - Intronic
904216316 1:28922948-28922970 GGATCTCTTGAGACCAGGCTGGG - Intronic
904513727 1:31036486-31036508 GGATCACTTGAGGCGAGGCCAGG + Intronic
904649425 1:31993575-31993597 GGATCACTTGAAGCCCGGCATGG - Intergenic
905144451 1:35876873-35876895 GGATCACTTAAGCCCAGCCCAGG - Intronic
905152168 1:35938204-35938226 GGATCACCTGAGGTCAGGTCTGG - Intronic
905570044 1:38996424-38996446 GGATCACTTGAGGCCAGCCTGGG - Intronic
905633764 1:39535058-39535080 GGATCACTTGAGGCAAGCCTGGG + Intergenic
906083765 1:43112328-43112350 GGATCACTTGACGCCAGGCTAGG - Intergenic
906459712 1:46027967-46027989 GGATCGCTTGAGGCCAGCCTGGG + Intronic
906647446 1:47485627-47485649 GGATCAATTGAGGCCAGCCTGGG + Intergenic
906829410 1:49015712-49015734 AAATCACTTGAGGCCAGGCGCGG - Intronic
907157463 1:52347589-52347611 GGATCACTTGAGCTCAGGCCTGG - Intronic
907370494 1:53999722-53999744 GGATCACCTGAGGTCAGGTCAGG + Intergenic
907901747 1:58747829-58747851 GGATCACTTGAGGCCAAGAGTGG + Intergenic
908146921 1:61256203-61256225 GGATCATTTGAGGTGAGGTCAGG + Intronic
908246583 1:62232095-62232117 GGATCACTTGAGCCCAGCCTGGG - Intergenic
908717405 1:67084975-67084997 GGATAACTTGAGGCTAGGCCAGG - Intergenic
908814481 1:68017710-68017732 GGAGCACATGAGGCTGGGCCAGG - Intergenic
908859430 1:68466345-68466367 GGATCACTTGAGGCCAGGAGTGG + Intergenic
909381383 1:75002827-75002849 GGACCACTTGAGGTGAGGAGGGG + Intergenic
910187902 1:84564821-84564843 GGATCACTTGCGGCCAGCCTGGG + Intronic
911132149 1:94399961-94399983 GGATCACTTGAGCCCAGGAGTGG + Intergenic
911750829 1:101495902-101495924 GGATCACTTGAGCCCAGGACTGG - Intergenic
912767191 1:112425049-112425071 GGATCACTTGGGTCCAGGCCAGG - Intronic
912829586 1:112940263-112940285 GGATCACTTGAGCCCAGCCCAGG - Intronic
912834307 1:112982151-112982173 GGATCACTTGAGGCCAGGCCAGG + Intergenic
912993660 1:114512105-114512127 AGATCACTTGAGGTCAGGTCAGG + Intergenic
913000962 1:114580144-114580166 GGATCACTTGAGACCAGCCTGGG - Intronic
913456779 1:119040532-119040554 GGATCACTTGAGCCCAGCCTGGG - Intronic
914785874 1:150830134-150830156 GGATCACTTGAGGACCAGCCTGG + Intronic
915217844 1:154352010-154352032 GGATCACTTGAGCCCAGCCCAGG + Intergenic
915423742 1:155806517-155806539 GGATTACTTGAGCCCAGTCCAGG - Intronic
915455616 1:156038727-156038749 GGATCACTTGAGACCAGCCTGGG - Intronic
915614578 1:157027171-157027193 GGATCACTTGAGACCAGCCTGGG + Intronic
916232067 1:162550270-162550292 GGATCACTTGAGACCAGCCTGGG + Intergenic
917776807 1:178346191-178346213 GGATTGCTTGAGGCCAGGCCTGG + Intronic
917980160 1:180264172-180264194 GGATCACTTGAGCCCAGCCTGGG - Intronic
918336628 1:183521655-183521677 GGATCACTTGAGACCAGCCTGGG + Intronic
918402099 1:184173765-184173787 GGATCACCTGAGGTCTGGCCAGG + Intergenic
918468112 1:184842456-184842478 GAATCACTTGTGGTAAGGCCGGG + Intronic
918833198 1:189425270-189425292 GGATCACTTGAGTTGAGTCCAGG - Intergenic
919865180 1:201776288-201776310 GGATCACTTGAGACCAGCCTGGG + Intronic
920050357 1:203161160-203161182 GGATCACTTGAGGAGAGAAATGG - Intronic
920227357 1:204448322-204448344 GGATCACTTGAGGTCAGGAGTGG - Intronic
920510289 1:206546315-206546337 TGATCACTTGAGACCAGGCTGGG - Intronic
920925325 1:210336205-210336227 GGATCGCTTGAGCCCAGGTCAGG - Intronic
921031249 1:211336952-211336974 GGATCAGTTGAGGTCTGGCCAGG - Intronic
922187794 1:223291403-223291425 GGATCACTTGAGCCGAGTGGAGG + Intronic
922451555 1:225741781-225741803 GGATCACTTCAGGCCAGTCCTGG + Intergenic
922711428 1:227836307-227836329 GGATCCCTTGAGGCCAGCCTGGG - Intronic
922844325 1:228671293-228671315 GAATTACTTGAGGCTAGGCATGG - Intergenic
923504934 1:234597290-234597312 GGATCACTTGAGACCAGCCTGGG - Intergenic
923613234 1:235513882-235513904 GGAAAACTTGAGGCGTGGACAGG - Intergenic
923696754 1:236260435-236260457 GGATCACCTGAGGTCAGGTCAGG + Intronic
924521922 1:244812953-244812975 GGCTCACTTGAGGCCAGGTATGG + Intergenic
1063176246 10:3553138-3553160 GGATGCTTTGAGGCCAGGCCAGG + Intergenic
1063408104 10:5815392-5815414 GGATCACTTGGGGCCAGGAGTGG + Intronic
1064274444 10:13893122-13893144 AGATCACTTGAGCCCAGGACGGG - Intronic
1064855072 10:19757855-19757877 GGATCACTGGAGCCCAGCCCAGG - Intronic
1065298291 10:24297526-24297548 GGATCACCTGAGGTCAGGTCAGG + Intronic
1065745779 10:28840420-28840442 GGATCAGTTGAGCCCAGGACAGG - Intergenic
1065796674 10:29314403-29314425 GGATCACTTGAGACCAGCCTGGG + Intronic
1066427441 10:35320917-35320939 AGATCACTTGAGTCCAGCCCGGG + Intronic
1066758502 10:38733377-38733399 GGATCACTTGAGGCCAAGACTGG - Intergenic
1066963150 10:42239381-42239403 GGATCACTTGAGGCCAAGACTGG + Intergenic
1067025364 10:42839130-42839152 GGATCTCTTGAGGCCAGCCTGGG - Intergenic
1067358614 10:45555334-45555356 GGATCACTTGAGACCAGCCTGGG + Intronic
1067682854 10:48451252-48451274 GGCTCCCTTGAGGGGCGGCCTGG - Intronic
1068190863 10:53650857-53650879 GGATCACTTGACTTGAGGTCAGG - Intergenic
1068979335 10:63044773-63044795 GGATCACTTGAGCCTGAGCCTGG + Intergenic
1069605484 10:69736372-69736394 GGATCACTTGAGCCCAGTCCAGG + Intergenic
1069971006 10:72169225-72169247 AGATCACTTGAGACCAGCCCGGG + Intronic
1069984408 10:72273744-72273766 GGCTCAATGGAGGCGGGGCCCGG + Intergenic
1070261511 10:74860705-74860727 TGATCAGTTGAGGCTAGGCATGG + Intronic
1070643502 10:78185674-78185696 GAATCTCTGGAGGTGAGGCCTGG + Intergenic
1070699838 10:78593721-78593743 GGATCACTTGAGGCCAGCTTGGG - Intergenic
1070807695 10:79280073-79280095 GGATCACTTGAGCCCAGGGGCGG - Intronic
1070905144 10:80065608-80065630 GGATCGCTTGAGTCCAGGCTGGG + Intergenic
1072231551 10:93418006-93418028 GGATCACTTGAGACTAGCCTGGG - Intronic
1072240634 10:93492473-93492495 AGATTGCTTGAGGCCAGGCCAGG + Intergenic
1072331018 10:94351816-94351838 GGATAACTAGAGGCCAGGCGTGG - Intronic
1072730817 10:97845343-97845365 GGATCACTTGAGATGAGATCAGG - Intergenic
1072815678 10:98506683-98506705 GGATCACTTGAGGAGTGATCAGG - Intronic
1072942051 10:99774083-99774105 GGATCACTTGAGACCAGCCTTGG - Intergenic
1072961917 10:99937140-99937162 GGATCACTTGAGGAGTGATCAGG - Intronic
1072970849 10:100016164-100016186 GGATCACCTGAGGTGAGGTCAGG - Intergenic
1073000746 10:100284450-100284472 GGATCACTTGAGGCCAGCTTGGG + Intronic
1073350645 10:102817332-102817354 GGATCACTTGAGCCCAGCCTGGG - Intergenic
1074519089 10:114200748-114200770 GGATCACTTGAGGTGAGGTCAGG - Intronic
1074543420 10:114384771-114384793 GGATCACAGGAGGTGAGGCGTGG - Intronic
1075006767 10:118836160-118836182 TGATCACTTGAGCCCAGTCCTGG - Intergenic
1075688848 10:124381988-124382010 GGATTACTTGAGGCCAGCCTAGG + Intergenic
1076506528 10:130977838-130977860 AAATCACTTGGGGCCAGGCCCGG + Intergenic
1077001469 11:325312-325334 GGATGACTGCAGGCCAGGCCTGG + Intronic
1077030187 11:462033-462055 GGGACACTTGAGGTGAGACCCGG - Intronic
1077052545 11:574109-574131 GGATGACTGCAGGCCAGGCCTGG - Intergenic
1077075031 11:696554-696576 GGATCATTTGAGGCCAGCCTGGG + Intronic
1077621311 11:3727245-3727267 GGATCACTTAAGGCCAGCCCGGG + Intronic
1077730698 11:4726252-4726274 GGATCACTTGAGGTCCAGCCTGG + Intronic
1078593168 11:12663310-12663332 GGATCACTTGAGGTCAGGAGTGG - Intergenic
1080374257 11:31689216-31689238 GGATCACTTGAGGCCAGGAGTGG + Intronic
1080385908 11:31811164-31811186 GGAGCGGTGGAGGCGAGGCCGGG - Intronic
1080514850 11:33010767-33010789 TGATCACTTGAGGTGCAGCCGGG + Intergenic
1080518670 11:33046993-33047015 GAATCACCTGAGGTGAGGTCAGG + Intronic
1080837786 11:35956262-35956284 GGATCGCTTGAGGCCAGGAGTGG + Intronic
1081877309 11:46417862-46417884 GGATCACTGGGGCCGAGGACTGG - Intronic
1082013077 11:47463793-47463815 GGATCAATTGAGACCAGGCTGGG - Intergenic
1083141765 11:60727925-60727947 GAATCACTTGGGGGGAGACCTGG - Intergenic
1083178694 11:60970723-60970745 GGACCAATTGAGGCAGGGCCAGG + Intergenic
1083321404 11:61849494-61849516 GGATCCCTTGAGCTGAGCCCAGG + Intronic
1083451817 11:62751311-62751333 GAATCGCTTGAGGCCAGGCACGG + Exonic
1083745238 11:64732293-64732315 AGATCACCTGAGGTGAGGTCAGG + Intronic
1083845157 11:65327447-65327469 GGATCACCTGAGGTCAGGTCAGG + Intergenic
1084619934 11:70262847-70262869 GGATCACCTGAGGTCAGGCCTGG - Intergenic
1084711457 11:70846476-70846498 GGATCGCTTGAGGCCAGCCTGGG - Intronic
1084866683 11:72063827-72063849 GGATCACTTGAGTCTGAGCCTGG + Intronic
1084988608 11:72901307-72901329 GGATCACTTGAGCCCAGGAGAGG + Intronic
1085104373 11:73829590-73829612 GGATCACTTGAACCCAGGACCGG - Intronic
1086468034 11:87075510-87075532 GGATCACTTGAGCTCAGGACCGG - Intronic
1088189816 11:107215938-107215960 GGATCACCTGAGCTGAGGTCAGG + Intergenic
1088216543 11:107516794-107516816 GGATCACTGAAGCCCAGGCCTGG + Intronic
1088216548 11:107516815-107516837 GGATCACTTGAGACCAGCCTGGG + Intronic
1090444078 11:126748503-126748525 GGCTCTGTGGAGGCGAGGCCTGG + Intronic
1091492409 12:944423-944445 GGATCACTTGAGCGGGGGCGAGG + Intronic
1091738003 12:2939136-2939158 GGATCACTTGAGCCTGGGACGGG + Intronic
1091755001 12:3045528-3045550 GGATCACTTGAGCCCAGCCTGGG + Intergenic
1091782932 12:3225241-3225263 GAATGATTTCAGGCGAGGCCTGG + Intronic
1091878576 12:3958157-3958179 GGATCACTTGAGGTCAGGAGTGG - Intergenic
1092554854 12:9546858-9546880 GGATCACTTGAGCCCTGGCTGGG + Intergenic
1093184606 12:16005356-16005378 GGATTACTTGAGTCCAGGACAGG + Intronic
1093418572 12:18948630-18948652 GGATCACCTGAGGCCAGCCTGGG + Intergenic
1094479549 12:30870768-30870790 GGATGATTTGAGCAGAGGCCAGG - Intergenic
1094517248 12:31143807-31143829 GGATCACTTGAGCCCTGGCGGGG - Intergenic
1094581892 12:31740853-31740875 GGATCACATAAGGGGAGGCAAGG + Intergenic
1094661816 12:32476667-32476689 GGATCACTTGAGGCCAGCCTGGG + Intronic
1094673790 12:32598014-32598036 GGATCACTTGAGCACAGGCGTGG - Intronic
1095394159 12:41743433-41743455 GGGTCACTTGAGGCCAGGATTGG - Intergenic
1095399225 12:41795471-41795493 GGAGCATTGGAGTCGAGGCCTGG + Intergenic
1095419038 12:42006190-42006212 GGATCACTTGAGGCTAGGAGGGG + Intergenic
1096084191 12:48854524-48854546 GGATCACTTGAGCCCAGGTCAGG - Intergenic
1096331916 12:50720886-50720908 GGATCACTTGAGCCAATGCCTGG - Intronic
1096373998 12:51092535-51092557 GGATCACTTTAAGCCAGGTCAGG - Intergenic
1096980349 12:55725084-55725106 GGATCCCTTGAGGATTGGCCAGG + Intergenic
1097061598 12:56288865-56288887 GGATCACTCGAGGCCAGCCTGGG - Intronic
1097675020 12:62590875-62590897 GGATCACCTGAGGTCAGGCCTGG - Intronic
1097879156 12:64671378-64671400 AGATCACAAGAGGCGAGGCCAGG - Intronic
1097939238 12:65285610-65285632 GGATCACTTGAGTCCAGCCTGGG + Intronic
1098266870 12:68730507-68730529 GTATCACTTGAGACCAGGCCTGG - Intronic
1098359655 12:69642222-69642244 AGATCACTTGAGGCCAGGAGTGG + Intergenic
1098770617 12:74548045-74548067 GGATCACTTGAGGCCAGGCAGGG - Intergenic
1098895156 12:76051585-76051607 GGATCACTTGAGGCCAGCCTGGG - Intronic
1100635145 12:96428254-96428276 GGATCACTTGAGGTCAGGTGTGG + Intergenic
1101096789 12:101350377-101350399 GGATCACTTGAGACTAGCCTGGG - Intronic
1101499803 12:105292522-105292544 GGATCACTTGAGCCCAGAGCTGG + Intronic
1101944866 12:109129055-109129077 GGATCACTTGAGGCCAGCCTGGG + Intronic
1102539261 12:113606745-113606767 AGATCACTTGAGGCCAAGCATGG + Intergenic
1103335463 12:120186109-120186131 GGATAACTTGAGGTCAGGTCAGG + Intronic
1103366942 12:120390432-120390454 GGATCACCTGAGATGAGGTCAGG - Intergenic
1103583794 12:121936236-121936258 GGATCACTTGAGGCCAGGAGTGG + Intronic
1103660861 12:122515447-122515469 GGATCACTGGAGGCCAGCCTGGG - Intronic
1103720149 12:122969525-122969547 GGATCACTTGAACCCAGCCCGGG + Intronic
1104214461 12:126722561-126722583 GGATCACTTGAGCCCAGATCAGG + Intergenic
1105031035 12:132883888-132883910 GGATCATTTGATTTGAGGCCAGG + Intronic
1105356230 13:19662464-19662486 GGATCACTTGAGCCCAGGCTGGG - Intronic
1105790386 13:23792465-23792487 GGATCACTTGAGTCCAGTCAAGG - Intronic
1106267910 13:28126364-28126386 GGATCCCTTGAGACCAGACCAGG - Intergenic
1106360011 13:29022410-29022432 GGATCACTTGAGGTCAGCCTTGG - Intronic
1106670232 13:31897446-31897468 AGATCACTTGAGGCCAGCCTGGG - Intergenic
1106735147 13:32581755-32581777 GGATCACTTGAGATGAGGAGAGG - Intergenic
1107324054 13:39221512-39221534 GGATCACTTGAGGCCAGACTGGG - Intergenic
1107467073 13:40660852-40660874 GGATCACTTGAGCCAGGGGCAGG + Intronic
1108065574 13:46574071-46574093 GGATCACCTGAGGTGAGGTCAGG - Intronic
1108615002 13:52124085-52124107 GGATCACTTGAGGCCAGCCTGGG + Intronic
1108902093 13:55424418-55424440 GGATCACTTGAAACCAGGCTGGG - Intergenic
1111066226 13:83096003-83096025 GGATCACTTGAAGCCAGGAGTGG + Intergenic
1112612379 13:100968367-100968389 GGAGCTCTTGAGGTCAGGCCTGG + Intergenic
1113976610 13:114232090-114232112 GAAACACCTGAGGCCAGGCCCGG - Intergenic
1114291510 14:21292496-21292518 GGATCACTTGAGCCCAGCCTGGG + Intronic
1115165990 14:30449162-30449184 GGATTGCTTGAGGCCAGGCCAGG - Intergenic
1115372231 14:32629850-32629872 GGATCTCTTGAGGCCAGGACCGG + Intronic
1115807934 14:37073433-37073455 GGATCGCTTGAAGCCAGGACAGG - Intronic
1116850503 14:49904078-49904100 GGATCTCTTGAGGCCAGCCTTGG - Intergenic
1117030995 14:51670290-51670312 GGAGCACTTGAGGCCAGCCTGGG - Intronic
1117563733 14:56971674-56971696 GGACCACTTGAGCCCAGCCCAGG - Intergenic
1117766383 14:59087582-59087604 AGATCACTTGAGCTCAGGCCTGG + Intergenic
1118238325 14:64032346-64032368 GGATCCCTTGAGACCAGGCTGGG + Intronic
1118389497 14:65284236-65284258 GGATCGCTTGAGACCAGCCCAGG + Intergenic
1118590637 14:67398310-67398332 GGATCACTTGAGTCCAGGAAAGG - Intronic
1119634130 14:76260436-76260458 TAATCACTTGAGGCCAGGCCCGG + Intergenic
1119913445 14:78372547-78372569 GGATCACTTGAGGTCAGGAGTGG - Intronic
1120772997 14:88401611-88401633 AGATCACTTGAGGCCAGGAGTGG + Intronic
1120790806 14:88579987-88580009 GGATCACTTGAGACTAGCCTGGG + Intronic
1121083653 14:91128405-91128427 GGATCACTTGAGCGCAGGCATGG + Intronic
1122175142 14:99911981-99912003 GGATCACTTGAGCCCAGGAGGGG - Intronic
1122224092 14:100263131-100263153 GGATCACTTGAGGCCAGGACTGG - Intronic
1122737269 14:103849898-103849920 GGATTGCTTGAGGCCAGGCCAGG + Intergenic
1122756074 14:103981127-103981149 GGATCACTTGAGGACAGGTGTGG - Intronic
1123031218 14:105452220-105452242 GGGTTATTTGAGGCGAGGCAGGG - Intronic
1123441912 15:20298045-20298067 GGATCACTTGAGGCCAAGACTGG - Intergenic
1123535223 15:21177108-21177130 GGATCTCTTGAGGCCAGCCTGGG - Intergenic
1123685823 15:22796524-22796546 GGATCACTTGAGGCCAGGAGTGG - Intronic
1124949166 15:34300572-34300594 GGATCACTTGAGCCCAGACCAGG + Intronic
1127159582 15:56167218-56167240 GGATCACTTGAGTTGAGCTCAGG + Intronic
1128257020 15:66204312-66204334 GGATCACTTGAGCCCAGGGTGGG + Intronic
1128453188 15:67818984-67819006 GGATCACTTGAGCCCAGGAGAGG - Intergenic
1128567261 15:68709542-68709564 GGATCGCTTGAGGCCAGGCGCGG - Intronic
1129000836 15:72332553-72332575 GGATCACTTGAGACCAGCCTGGG - Intronic
1129752595 15:78076662-78076684 GGATCTCTTGAGCCCAGGCATGG + Intronic
1130062079 15:80577483-80577505 TCATCACTGGAGGCAAGGCCTGG + Intronic
1130740489 15:86594131-86594153 GGATCACTTGAGGCCAGCCTGGG - Intronic
1130976083 15:88776349-88776371 GAATCACTTGAAGCCAGGCATGG + Intergenic
1131480752 15:92779679-92779701 AGATAACTTGAGGCCAGGCGTGG - Intronic
1131889426 15:96956436-96956458 GGATTCCTAGAGGGGAGGCCTGG + Intergenic
1132535792 16:479467-479489 GGATCACTTGAGGTGCGGAGTGG + Intronic
1132544865 16:528310-528332 GGGTCACTTGAGGCCAGCCCCGG + Intronic
1132786717 16:1661105-1661127 GGATCACTTGAGGCCAGCCTGGG + Intronic
1133046537 16:3091419-3091441 GGATCACTTGAGCCCAGGAGTGG + Intronic
1133158875 16:3896061-3896083 TGATCACTTGGGGCCAGGCGCGG + Intergenic
1133233008 16:4375138-4375160 GGCTCACTTGAGCTGGGGCCTGG + Intronic
1133267961 16:4595907-4595929 GGATCACTTGAGGCCAAACATGG - Intronic
1133742905 16:8664778-8664800 GGATCACTTGAGATGGGTCCTGG - Intergenic
1133748508 16:8706183-8706205 GGATCACTTGAGACCAGTCTGGG + Intronic
1133944281 16:10335452-10335474 GGATCACTTGAGCCCAGGAGGGG + Intronic
1134119867 16:11576095-11576117 GGATCACTTGAGGCCAGCCTGGG - Intronic
1134239498 16:12495013-12495035 GGGTCACATGAGGTGAGGCAGGG - Intronic
1134587225 16:15422191-15422213 GGATCACTTGAGCCCAGGGGCGG + Intronic
1134801353 16:17087562-17087584 GGATCACTTGAGGTCAGGTCAGG - Intergenic
1134915785 16:18069791-18069813 GAATCTCTGGAGGAGAGGCCTGG + Intergenic
1135089586 16:19502580-19502602 GGATTACTTGAGGCCAGACTGGG - Exonic
1135234809 16:20745293-20745315 GGACCACTTGGGGCCAGGCACGG + Intronic
1135408104 16:22212769-22212791 GGATCACTTGAGTCCAGGAGTGG + Intronic
1135678439 16:24436990-24437012 GGATCACTTGAGCCCAGAGCTGG + Intergenic
1135711946 16:24725258-24725280 GGATCGCTTGAGGCTGGGGCAGG - Intergenic
1135722267 16:24827904-24827926 GGATCACTTGAGACCAGCCTGGG - Intergenic
1135765132 16:25171006-25171028 AGATCACTTGAGGTCAGGTCAGG + Intronic
1136223510 16:28844000-28844022 GGAGGACTTGCGGCGGGGCCTGG - Exonic
1136291422 16:29274568-29274590 GGATCACTTGAGACCAGCCTGGG + Intergenic
1136464602 16:30433628-30433650 GGATCTTTTGAGGCCAGCCCTGG + Intergenic
1136646070 16:31616624-31616646 GGATCACTTGAGGCCAGCCTAGG - Intergenic
1136659194 16:31740583-31740605 GGATCACTTGAGGCCAGCCTGGG + Intronic
1136719293 16:32307470-32307492 GGATCACTTGAGGCCAAGACTGG + Intergenic
1136724319 16:32345836-32345858 GGATCACTTGAGGCCAAGACTGG + Intergenic
1136782999 16:32918651-32918673 AGATCACTTGAGGCCAGGTGCGG - Intergenic
1136837663 16:33513734-33513756 GGATCACTTGAGGCCAAGACTGG + Intergenic
1136842646 16:33551877-33551899 GGATCACTTGAGGCCAAGACTGG + Intergenic
1136858262 16:33678934-33678956 GGATCTCTTGAGGCCAGCCTGGG + Intergenic
1136886795 16:33935199-33935221 AGATCACTTGAGGCCAGGTGCGG + Intergenic
1137533391 16:49298782-49298804 GGGTCACTGGAGGTGAGGCTGGG - Intergenic
1137631295 16:49947626-49947648 GGATCACTTGAGGCCAGCCTGGG - Intergenic
1138173200 16:54872300-54872322 GGATCACTTGAGGTGAGGTCAGG + Intergenic
1138486595 16:57349139-57349161 GGATCACTTGAGCCCAGGAGTGG + Intergenic
1139495719 16:67315834-67315856 GGATCACTTGAGGTCAGGGTTGG - Intronic
1139532814 16:67551402-67551424 GGATCACTTGAGGCCAGCCTGGG - Intergenic
1139618989 16:68121578-68121600 GGATCACTTGAGCCTAGGATGGG + Intronic
1139622013 16:68153172-68153194 GGATCACCTGAGGCCAGGGCAGG + Intronic
1139760431 16:69180443-69180465 GGATCACTTGAGCCCAGACTGGG - Intronic
1139832084 16:69808310-69808332 GGATCACTTGAGACCAGCCTGGG - Intronic
1140550328 16:75858066-75858088 GGATCCCTTGAGGCCAGCCTGGG + Intergenic
1140986086 16:80159237-80159259 GGATTGCTTGAGGCCAGGCTGGG + Intergenic
1141951096 16:87339910-87339932 GGATCACTTGAGCCCAGCCTGGG + Intronic
1142097296 16:88248487-88248509 GGATCACTTGAGACCAGCCTGGG + Intergenic
1203002111 16_KI270728v1_random:171929-171951 GGATCACTTGAGGCCAAGACTGG - Intergenic
1203007138 16_KI270728v1_random:210301-210323 GGATCACTTGAGGCCAAGACTGG - Intergenic
1203085648 16_KI270728v1_random:1182635-1182657 AGATCACTTGAGGCCAGGTGCGG - Intergenic
1203119831 16_KI270728v1_random:1527404-1527426 GGATCTCTTGAGGCCAGCCTGGG + Intergenic
1203133714 16_KI270728v1_random:1708336-1708358 GGATCACTTGAGGCCAAGACTGG - Intergenic
1203147848 16_KI270728v1_random:1814012-1814034 GGATCACTTGAGGCCAAGACTGG + Intergenic
1203152811 16_KI270728v1_random:1852174-1852196 GGATCACTTGAGGCCAAGACTGG + Intergenic
1142554473 17:764197-764219 GGATCACTGGAGGCCAGCCTGGG + Intronic
1142580642 17:940154-940176 GGATCACCTGAGGCCAGCCTGGG - Intronic
1142649192 17:1335777-1335799 GGGTCACTTGAGGTGAGGTCAGG + Intergenic
1142779327 17:2168666-2168688 GGATCACTTGAGCCTAGCCTGGG + Intronic
1142875821 17:2851797-2851819 GGATCACTTGAGTTGAGACCAGG - Intronic
1143458591 17:7084717-7084739 GGATCACTTGAGCCCAGGAGGGG - Intergenic
1143556386 17:7663961-7663983 GGATCCCTTGAGACCAGCCCAGG - Intronic
1143629779 17:8131999-8132021 GGATCACTTGAGACAAGCCTGGG - Intergenic
1145375309 17:22342175-22342197 GGATCACTTGAGGTCAGGCACGG - Intergenic
1145749179 17:27343014-27343036 GGATCACTTGAGACCAGCCTGGG - Intergenic
1145968835 17:28942290-28942312 GGATCGGTTGAGGCCAGGACAGG + Intronic
1146355968 17:32134712-32134734 GGATCACTTGAGCCCAGTTCAGG + Intergenic
1146408631 17:32562689-32562711 GGATCACTTGAGGCCAGCCTGGG - Intronic
1146848752 17:36203254-36203276 AGATCACTTGAGGCCAGTTCGGG - Intronic
1147205464 17:38834397-38834419 GGATCACTTGAGACCAGCCTGGG - Intergenic
1147847376 17:43413989-43414011 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1148099807 17:45082191-45082213 GGATCACTTGAGCCCAGGAGTGG - Intronic
1148105637 17:45117331-45117353 GGATCACTTGAGCCCAGGACTGG - Intronic
1148369764 17:47089561-47089583 AGATCACTTGAGGCCAGGCACGG + Intergenic
1149137032 17:53379793-53379815 AGATCACCTGAGGTCAGGCCTGG - Intergenic
1149263457 17:54902579-54902601 GAACCACTTGAGGCGGGGCCCGG - Intronic
1149776661 17:59363533-59363555 GGATCACTTGAGGTCAGGTCAGG - Intronic
1149834666 17:59901806-59901828 GGATCACTTGAGACTAGCCTGGG + Intronic
1150116559 17:62555872-62555894 GGATCACATCAGGCGGGGACTGG - Intronic
1150471362 17:65440100-65440122 TGATCAGGTGAGGGGAGGCCAGG - Intergenic
1151056292 17:71035421-71035443 GGATCACTTGCGGCCAGGAGTGG + Intergenic
1153732135 18:8024928-8024950 GGATCACTTGAGGCCAAAGCAGG - Intronic
1153794177 18:8607887-8607909 GGATCACTTGAGGCCAGTTCAGG + Intergenic
1153895922 18:9560069-9560091 GGATCACTTGAGCCCAGCCTGGG + Intronic
1154317304 18:13314934-13314956 GGATCCCTTGAGGCCAGCCTGGG - Intronic
1155023672 18:21920957-21920979 GGATCACTTGAGTCCAAGACTGG - Intergenic
1155029679 18:21973414-21973436 GGATCACTTGAGTCGGGGGGTGG - Intergenic
1155207298 18:23571306-23571328 GGATCATTTGAGACCAGGCCTGG + Intronic
1155373832 18:25134740-25134762 GGATCCCTTGGGGCGTGGCCAGG - Intronic
1155603462 18:27576112-27576134 GGATCACTTGAGGTCAGGCCAGG + Intergenic
1155803687 18:30140413-30140435 GGACAACTTGAGGCGAGGAGGGG + Intergenic
1156892124 18:42203160-42203182 CGATCACCTGAGGCGAGGTCAGG - Intergenic
1157249209 18:46079536-46079558 GGATCACTGAAGGCCAGGCAGGG + Intergenic
1157829357 18:50842267-50842289 GGATCACTTGAGGTCAGACCAGG - Intergenic
1157864695 18:51171036-51171058 GGATCGCTTGAGGCCAGCCTGGG + Intergenic
1158255112 18:55537500-55537522 GGATCACTTGAGCCCAGGAGGGG + Intronic
1158335987 18:56415592-56415614 TCATCACTTAAGGCAAGGCCCGG - Intergenic
1158650645 18:59281699-59281721 GGATCACTTGAGCCCAGCCTGGG - Intronic
1158662347 18:59399758-59399780 GGATCACTTGAGGTGATTACAGG + Intergenic
1160135489 18:76267627-76267649 GGATCACTTGTGGTCAAGCCTGG + Intergenic
1160487076 18:79303151-79303173 GGATCGCTTGAGACCAGGCTGGG + Intronic
1160711932 19:556059-556081 AGATCAGTGGAGGCCAGGCCAGG + Intergenic
1161081404 19:2312316-2312338 GGATCACTTGAGGCCAGTTCAGG - Intronic
1161191665 19:2960752-2960774 GGATCACTTGAGCCCAGGAGTGG - Intergenic
1161206378 19:3043274-3043296 AGATTGCTTGAGGCCAGGCCGGG - Intronic
1161210886 19:3064926-3064948 GGATCACTTGAGCCCAGGAGTGG - Intergenic
1161713666 19:5863829-5863851 GGCTCACGGGAGGCCAGGCCAGG - Intergenic
1161758133 19:6149796-6149818 GGATCTCTTGAGGCCAGGTGTGG - Intronic
1161758149 19:6149864-6149886 GGATCTCTTGAGGCCAGGTGTGG - Intronic
1161944747 19:7428617-7428639 GGATCACTTGAGCCCAGGAGTGG + Intronic
1162426494 19:10599868-10599890 GGATCACTTGAGACCAGCCTGGG + Intergenic
1162812293 19:13171662-13171684 GGATCACCTGAGGTCAGGTCAGG - Intergenic
1162819482 19:13213906-13213928 GGATCACTTGAGGCCAGGAGTGG - Intronic
1162933791 19:13970450-13970472 GGATCACTTGAGCCCAGGCTGGG + Intronic
1163421303 19:17215165-17215187 GGATTGCTTGAGGCCAGCCCGGG - Intergenic
1163737209 19:18988782-18988804 GGATCACTTGAGCCCAGGATTGG - Intergenic
1163851420 19:19666205-19666227 AGATCTCTTGAGGCCAGGACAGG - Intergenic
1164208252 19:23075406-23075428 GCATCCCTTGAGGCGAGAGCGGG + Intronic
1164555317 19:29246644-29246666 GGATCACTTGAGTCCAGGAGTGG + Intergenic
1164771660 19:30814355-30814377 GGATCACTTGAAGCCAGGACAGG - Intergenic
1165379368 19:35467431-35467453 GGATTACTTGAGGTCAGGCAGGG - Intergenic
1165461461 19:35946390-35946412 GGATCACTTGAGGCCAGTTTGGG - Intergenic
1165753705 19:38278592-38278614 GGATCACTTGAGACCAGCCTGGG + Intronic
1165763170 19:38334510-38334532 GGATCGCTTGAGGCCAGCCTGGG - Intergenic
1165860415 19:38906369-38906391 AGATCACCTAAGGCCAGGCCAGG - Intronic
1166202511 19:41247669-41247691 GGATCACTTGAGCCCAGGGGTGG - Intronic
1166222086 19:41371944-41371966 GGATCACTTGAGTCCAGGAGTGG - Intronic
1167275610 19:48537214-48537236 GGATCACCTGAGGCCAGGAGTGG - Intergenic
1167652301 19:50738994-50739016 GGATCACTTGAGCCCAGGATGGG - Intergenic
1167919737 19:52773114-52773136 GTATCATGTGAGGCAAGGCCAGG + Intronic
1167927178 19:52830783-52830805 GTATCATGTGAGGCAAGGCCAGG + Intronic
1167931442 19:52869016-52869038 GTATCATGTGAGGCAAGGCCAGG + Intronic
1168033850 19:53703286-53703308 GGACCACTTGAGGCTGGGCGCGG - Intergenic
1168036987 19:53727784-53727806 GGACCACTTGAGGCTGGGCGAGG - Intergenic
1168038452 19:53738867-53738889 GGACCACTTGAGGCTAGGCGTGG - Intergenic
1168062125 19:53898849-53898871 GGCTCAACGGAGGCGAGGCCGGG + Intronic
1168386172 19:55965061-55965083 GGATCACTTGAGGCCAGGAGTGG + Intronic
925278805 2:2669032-2669054 GCCTCACTTGGGGCGACGCCTGG + Intergenic
926201972 2:10807410-10807432 GGATCACTTGAGACCAGCCTGGG - Intronic
927370141 2:22344983-22345005 GGATCACTTGAGACCAGCCTGGG + Intergenic
927469132 2:23359257-23359279 GGATCACTTGAGATCAGGTCAGG - Intergenic
927586650 2:24313295-24313317 GGATTGCTTGAGGCCAGGCTGGG - Intronic
927814712 2:26204808-26204830 GGATCATTTGAGGCCAGGCCAGG - Intronic
928508441 2:31978640-31978662 GGATCACTTGAGGCCGGGTATGG - Intronic
928569333 2:32587513-32587535 GGATCACTTGAGACTAGCCTGGG + Intronic
928571331 2:32612088-32612110 GGATCACTTGAGCCTAGCCTAGG - Intronic
928638242 2:33270140-33270162 GGATCACTTGAGGCGAGGTCAGG - Intronic
929186188 2:39097649-39097671 GAATCACTTGAGCCCAAGCCTGG - Intronic
929255209 2:39802943-39802965 GGATCACTTGAGGCCAGGACTGG + Intergenic
929496561 2:42449671-42449693 GGATCACTTGAGGCCAGGTGTGG - Intronic
929536171 2:42785637-42785659 GGATCACTTGAGGCCAGGAGTGG + Intronic
929589432 2:43135471-43135493 GGATCCCTTGAGGCCAGCCTGGG - Intergenic
929606810 2:43240226-43240248 GGAGGACTGGAGGCGAGGCCAGG + Intronic
929658954 2:43763632-43763654 GGATCACTTGAGCCTAGCCTGGG - Intronic
930079923 2:47437759-47437781 GGAACACTTGAGCTGAGCCCAGG - Intronic
930660593 2:54049050-54049072 AGATCACTTGAGGCCAGCCTGGG + Intronic
930666707 2:54106284-54106306 GGATCACTTGAGGCCAGCCTGGG - Intronic
931430701 2:62206610-62206632 GGATCACTCGAGGCCAGCCTGGG - Intronic
932700814 2:73990169-73990191 TGATCACTTGAGACCAGGCTGGG + Intronic
932732304 2:74230060-74230082 GGATCACTTGAGACCAGCCTGGG - Intronic
932738545 2:74273871-74273893 GGAACACCTGAGGCCGGGCCTGG + Intronic
932800993 2:74742262-74742284 GGATCACTTGAGGTCAGGTTTGG + Intergenic
933686111 2:85142329-85142351 GGATCACTTGAGCCTGGGCATGG + Intronic
933752997 2:85615240-85615262 GGATCACCTGAGGTCAGGACTGG - Intronic
934321820 2:91977724-91977746 GGATCACTTGAGGCCAAGACTGG - Intergenic
934533289 2:95110578-95110600 GGATCACTTGAGGCCAGAGTTGG + Intronic
936384952 2:112020901-112020923 GCATCACTTGAGGCTAGGCGTGG + Intronic
937264091 2:120605338-120605360 GGTTCACTGGAGGCCAGGACAGG - Intergenic
938022587 2:127918356-127918378 GGATCACTTGAGGCCAGGCGTGG - Intergenic
940391467 2:153137420-153137442 GGTTCACTTGAGGACAGACCTGG - Intergenic
940891994 2:159044215-159044237 GGATCACTTGAGACCAGCCTGGG + Intronic
940944345 2:159599018-159599040 GGATCACTTGAGGACCAGCCTGG + Intronic
941071712 2:160962262-160962284 GGATCACTTGAGCCCAGCCTGGG + Intergenic
941217991 2:162737840-162737862 GGATCACTTGAGGTCAGGGGTGG + Intronic
941629056 2:167864328-167864350 GGATCACTTGAGCCCAGCCAAGG + Intergenic
942024197 2:171896466-171896488 GAATCTCTTGAGGCCAGGCACGG + Intronic
943792964 2:191955572-191955594 GGATCACTTGAAGCCAGCCTGGG - Intronic
944231995 2:197404958-197404980 GGATCACTTGAGACCAGCCTGGG + Intronic
944550771 2:200842520-200842542 GGATCACTTGAGCCCAGGAAGGG + Intergenic
944610316 2:201397732-201397754 GGATCATTTTAGCCAAGGCCAGG - Intronic
944807666 2:203298298-203298320 GGATCACTTGAGACCAGGAGAGG + Intronic
944884176 2:204046107-204046129 GGATCACTTGAAGCCAGTTCAGG - Intergenic
946008306 2:216544125-216544147 GAATCACTTGAGGCCAGGCGCGG - Intronic
946242009 2:218362131-218362153 GGATCACTTGAGGTCAGGAGTGG + Intronic
946293259 2:218761989-218762011 AGATCACTTGAGCCCAGGCAAGG + Intergenic
947184723 2:227444754-227444776 TCATCACTTAAGGCAAGGCCTGG + Intergenic
947303657 2:228718774-228718796 GGATCACTTGATGCCAGGAGTGG - Intergenic
947725860 2:232399967-232399989 GGATCCTTTGAGGCCAGGCTGGG - Intergenic
948786911 2:240357421-240357443 GCATTGCTTGAGGGGAGGCCTGG + Intergenic
1168789092 20:563913-563935 GGGCCACTTGAGGTGAGCCCAGG + Intergenic
1169366625 20:4997842-4997864 GGATCACTTGAGACCAGTCTAGG - Intronic
1169394242 20:5215502-5215524 GGATCACTTGAGTTGAGGTCAGG + Intergenic
1169729190 20:8767959-8767981 GGATCACTTGAGACCAGCCTGGG + Intronic
1170304600 20:14924236-14924258 GCATCACTTGAGGCCAAGCCTGG + Intronic
1170362789 20:15565794-15565816 GGGTCACTTGAGGCCAGCCTGGG - Intronic
1170602919 20:17855246-17855268 GGATTACATGAGGCCAGGCATGG - Intergenic
1172032944 20:31994488-31994510 TGATCACTTGAGATGAGGCCAGG + Intronic
1172243503 20:33429427-33429449 GGATCACCTGAGGCCAGGAGTGG + Intronic
1172267037 20:33625275-33625297 GGATCACTTGAAGCCAGTCTGGG + Intronic
1172663436 20:36583051-36583073 AGTTCGCTTGAGGCCAGGCCAGG + Intronic
1172706510 20:36886213-36886235 GGATCACTTGAGCCCAGGAGTGG - Intronic
1172996462 20:39073594-39073616 GGCTCACTTGAGCCCAGGCCTGG - Intergenic
1173493959 20:43505547-43505569 CTATCACTTGAGGGGAGGACTGG + Intergenic
1173512333 20:43639951-43639973 GGATCACTTGAGACCAGCCTGGG + Intronic
1174303913 20:49601738-49601760 GGATTACTTGAGGCCAGGAGTGG - Intergenic
1174469762 20:50748739-50748761 GGATCACTTGAGCCCAGCCTGGG - Intronic
1174482945 20:50844054-50844076 GGATCACTTGAGCCTAGCCTGGG + Intronic
1174869409 20:54169123-54169145 AGATCGCTTGAGGCCAGCCCAGG - Intronic
1175079765 20:56409253-56409275 AGATCATTTGAGGCCAGGCCTGG - Intergenic
1175333552 20:58180376-58180398 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1175465846 20:59191106-59191128 GGGTCAGGTGAGGTGAGGCCTGG - Exonic
1176199384 20:63853714-63853736 GGCTCACCTGAGTGGAGGCCGGG - Intergenic
1176211243 20:63923231-63923253 GGATCACTTGAGACCAGCCTGGG + Intronic
1177260778 21:18726367-18726389 GGATCACTTGAGGGCCAGCCTGG - Intergenic
1177708685 21:24741909-24741931 AGATCACTTGAGGCCAGGAGTGG - Intergenic
1177797931 21:25798569-25798591 GGATCACTTGAGCCCAGGAGTGG - Intergenic
1177844273 21:26270555-26270577 GGATCACTTGAGGCCAGCCTGGG - Intergenic
1178291548 21:31372747-31372769 GGATCACTTGAGACCAGCCTGGG + Intronic
1178375182 21:32060993-32061015 GGATCACTTGAGCCCAGGCAGGG - Intergenic
1178987609 21:37321217-37321239 GGATCACTTGAGGTCAAGACTGG + Intergenic
1179900233 21:44388604-44388626 GGATCACTTGAGCCCAGCCTAGG + Intronic
1180138041 21:45873970-45873992 GGATCACTTGAGCCCAGGCTGGG - Intronic
1180138061 21:45874048-45874070 GGATCACTTGAGCCCAGCCTGGG - Intronic
1180896191 22:19334642-19334664 GGATCACCTGAGGTCAGGACTGG - Intronic
1181098392 22:20521951-20521973 GGATCACCTGAGGTCAGGTCAGG - Intronic
1181144793 22:20837164-20837186 GGATCACTTGAGACCAGGGTTGG + Intronic
1182210889 22:28676794-28676816 GGATCACTTGAGGTCAAGACTGG + Intronic
1182286480 22:29251422-29251444 GGATCACTTGAGCCTAGCCAGGG - Intronic
1182356948 22:29726454-29726476 GGACCCCTTAAGGCAAGGCCTGG + Intronic
1182503572 22:30766010-30766032 GGATCGCTTGAGGCCAGGAGTGG + Intronic
1182631512 22:31689655-31689677 GGATCTCTTGAGCCCAGCCCAGG - Intronic
1182643750 22:31790689-31790711 GGATCACTTGAGCCCAGCCTGGG + Intronic
1183093668 22:35540230-35540252 GGGTCACCTGCGGCCAGGCCGGG + Intergenic
1183155762 22:36073814-36073836 GGATCACTTGAGGCCAGCCTGGG + Intergenic
1183402904 22:37615088-37615110 GGATCCCTTGAGGCTAGCCTGGG + Intronic
1183405883 22:37630362-37630384 GGAACACCTGGGGGGAGGCCAGG - Intronic
1183810038 22:40247985-40248007 GGATCACTTGAGCCCAGGAGGGG + Intronic
1183922793 22:41182661-41182683 GGATTACTTGAGGCCAGGAGTGG + Intergenic
1184194769 22:42919892-42919914 GGATCACTTGAGGCCACCCTGGG + Intronic
1184747493 22:46464767-46464789 GGATCCCTGGAGGCCAGGGCAGG - Intronic
949438535 3:4055689-4055711 GGATCACTTGAGGCTAGACTGGG - Intronic
950371809 3:12537186-12537208 GGATCACTTGAGACCAGCCTGGG + Intronic
950706467 3:14785590-14785612 GCATCACATGAGGCAAAGCCAGG - Intergenic
950889852 3:16394142-16394164 GGATCACTTGAGGCCAGAAAAGG + Intronic
950996174 3:17499483-17499505 GGATCACTTGAGACCAGCCTGGG + Intronic
951119943 3:18914859-18914881 GGATCACTTGAGCCCAGGAGTGG - Intergenic
951524527 3:23641250-23641272 AGATCACTGGAGGTCAGGCCAGG - Intergenic
952317311 3:32242407-32242429 GGATCACTTGAGCCCAGGAGGGG - Intronic
953654755 3:44841302-44841324 GGATCACTTGAGCCCAGCCTGGG - Intronic
954142061 3:48612982-48613004 GGATCACTTGAGCCAGGGCATGG - Intergenic
954733792 3:52687833-52687855 GGATCACTTGAGACCAGCCTTGG - Intronic
954907878 3:54078035-54078057 GGATCGCTTGAGGCCAGCCTGGG + Intergenic
955279489 3:57580614-57580636 GGATCACTTGAGGCCAGTCCAGG - Intronic
955460927 3:59182511-59182533 GGATCACTTGAGCCCAGGAATGG + Intergenic
955478300 3:59362405-59362427 GGATCACTTGAGGTCAGGAGTGG + Intergenic
955927474 3:64022599-64022621 GGATGACTTGTGGCGGGGCGGGG - Intronic
956294289 3:67695137-67695159 GGATCACTTGAGGCCAGCCTGGG + Intergenic
956535833 3:70275298-70275320 GGATCACTTGAGCCCAGCCCAGG + Intergenic
956766515 3:72488975-72488997 GGATCACTTGAGGCCAGACTGGG - Intergenic
956772119 3:72535481-72535503 GGATCACTTGAGGTGTGTGCTGG - Intergenic
958036583 3:88176543-88176565 GGATCACTTGAGGTTAGGTTAGG - Intergenic
958500766 3:94905565-94905587 GGATCACCTGAGTTGAGGTCAGG - Intergenic
959277123 3:104290454-104290476 GGATCACTTGAGGTCAGTCCTGG + Intergenic
959985581 3:112567525-112567547 GGATCACTTGAGGTCAGGAGTGG - Intronic
960910199 3:122642238-122642260 GGATCACTTGAGGCTAAGATGGG - Intergenic
961199800 3:125035999-125036021 GGATTACTTGAGGCCAGCCTGGG + Intronic
961221145 3:125201174-125201196 AGATCACTTGAGGCCAGGCAAGG + Intronic
961811138 3:129522500-129522522 GGATCAATTGAGCCAAGGACAGG + Intergenic
961811482 3:129524255-129524277 GGATCACTTGAGCCTAGGACAGG + Intergenic
961964007 3:130883677-130883699 AGATCACTTGAGGTTAGGTCAGG - Intronic
963110183 3:141682154-141682176 GGATCACTTGAGCTGAGGTGGGG + Intergenic
963148955 3:142023886-142023908 GGATCCCTTGAGCCCAGGTCAGG - Intronic
964371695 3:156006945-156006967 GGATCACCTGAGGTGAGGTCAGG + Intergenic
965189999 3:165515655-165515677 GGATCACATGAGGCCAGCCTGGG - Intergenic
966380697 3:179342107-179342129 GGATCACCTGAGGCCAGCCTGGG + Intergenic
966563561 3:181350443-181350465 AGATCACTTGAGGTCAGGCCTGG + Intergenic
967395219 3:189000954-189000976 GGATCACTTGAAGCCAGCCTGGG - Intronic
967661104 3:192111439-192111461 GGATCACTTGAGCCCAGGGATGG + Intergenic
967967398 3:194972832-194972854 GGACCACTTGAGTCCTGGCCAGG - Intergenic
968055051 3:195684904-195684926 GGATCACCTGAGCCGAGGGGAGG - Intergenic
968100849 3:195964313-195964335 GGATCACCTGAGCCGAGGGGAGG + Intergenic
968121437 3:196128672-196128694 AGGTGAATTGAGGCGAGGCCAGG - Intergenic
968133351 3:196205885-196205907 GGATCACTTGAGGCCAGGTCAGG - Intronic
968150337 3:196332935-196332957 GGATCACTTGAGCCCAGATCAGG - Intronic
968153763 3:196360913-196360935 GGATCACTTGAGCCGGGGCGGGG + Intronic
968219630 3:196926864-196926886 GGATCACATGAGGTGAGGTCAGG - Intronic
968321217 3:197770633-197770655 GGATCGCTTGAGCCCAGGGCAGG - Intronic
968616953 4:1581319-1581341 AGACCACAGGAGGCGAGGCCAGG - Intergenic
968752477 4:2397247-2397269 GGATCACCTGAGGTCAGGTCAGG + Intronic
969062155 4:4445177-4445199 GGATCACCTGAGGTGAGGTCAGG + Intronic
969286670 4:6206737-6206759 AATTCACTTGAGGCCAGGCCAGG + Intergenic
969376497 4:6766914-6766936 GGATCACTTGAGCCCAGGAGGGG - Intergenic
969665065 4:8552734-8552756 GGTTCCCTAGAGGTGAGGCCTGG - Intergenic
970119357 4:12735395-12735417 GGATCACTTGAGCCAAGCCTGGG - Intergenic
971200581 4:24506456-24506478 TCATCACTTGAGGCAAGGACCGG - Intergenic
971205693 4:24566256-24566278 GGATCACTTGAGTCCAGGGTGGG - Intronic
971307044 4:25492305-25492327 GGATCACTTGAGGTCAGATCAGG + Intergenic
971942815 4:33237590-33237612 GGATCACTTGAGCCCAGGTCGGG + Intergenic
972801292 4:42478266-42478288 GGATCACTTGAGTCTGGGGCTGG + Intronic
973949790 4:56000101-56000123 GGATCACTTGAGCCCAGGGGCGG + Intronic
977373228 4:96167571-96167593 GGATCACTTGAGACCAGCCTGGG + Intergenic
977585714 4:98773380-98773402 GGATCACTTGAGCCCAGGAGGGG + Intergenic
978391795 4:108234980-108235002 GGATTGCTTGAGGCCAGGCCTGG + Intergenic
979061675 4:116069329-116069351 GGATCACTTGAGCCCAGGACTGG - Intergenic
980122338 4:128740996-128741018 GAATCACTTGAGGCCAGCCTGGG + Intergenic
980224908 4:129970088-129970110 GGATCACTTGACTTGAGGTCAGG - Intergenic
980485901 4:133457323-133457345 GGATCACCTGAGGCCAGCCTGGG - Intergenic
980677717 4:136110706-136110728 GTATCACTTGAGGCGAGGCCAGG - Intergenic
981008793 4:139903195-139903217 GGATCGCTTGAGCCAAGGCCTGG - Intronic
981072744 4:140561559-140561581 GGATCACTTGAGCCCAGACTGGG - Intronic
981286167 4:143021227-143021249 GGATCATTTGAGGCCAAGCTAGG + Intergenic
981821616 4:148893777-148893799 GGATCACTTGAGACAAGCCTGGG - Intergenic
982000549 4:151017231-151017253 GGATCACTTGAGACTAGCCTAGG + Intergenic
982196153 4:152917028-152917050 GGATCACTTGAGCCCAGCCTGGG - Intronic
982222603 4:153137844-153137866 GGATCACTTGAGGCCCGAACTGG + Intergenic
982728527 4:158930727-158930749 AGATTGCTTGAGGCCAGGCCTGG - Intronic
983881577 4:172939079-172939101 GGATCACTTGAGAACAGGCTGGG + Intronic
983940621 4:173531393-173531415 GGCTCACGTGCGGCGAGGGCGGG + Intergenic
985491098 5:180157-180179 GGATCATTTGAGGCCCGGGCTGG + Intronic
985491865 5:184797-184819 GGATCACTTGACTTGAGCCCAGG + Exonic
985502366 5:257011-257033 GGATCACTTGAGACCAGCCTAGG - Intergenic
987355342 5:17058854-17058876 GGATCACTTGAGCCCAGGACGGG + Intergenic
988541326 5:32112512-32112534 GGATCACTTGAGGTCAGGGGTGG + Intergenic
988781774 5:34529040-34529062 GGATCACTTGAGACCAGCCTGGG + Intergenic
988963938 5:36396849-36396871 AGATTACTTGAGGCCAGGCACGG + Intergenic
990427936 5:55707103-55707125 AGATTACTTGAGGCCAGGCTGGG - Intronic
990589944 5:57252182-57252204 GGATCACTTGAGACCAGTCTGGG - Intronic
991064157 5:62408054-62408076 GGATCGCTTGAGGCCTGGACAGG - Intronic
991713041 5:69426878-69426900 GGATCACTTAAGACCAGCCCAGG - Intronic
991713822 5:69433372-69433394 GGATCACTTGAGGCCACTCTTGG - Intronic
992515746 5:77491164-77491186 TCATCACTTAAGGCGAGGACCGG - Intronic
993646006 5:90463311-90463333 GGATCGCTTGAGGCCAGCCTTGG - Intronic
994629243 5:102262623-102262645 GGATCACTTGAGGCCAGGAGTGG - Intronic
995585553 5:113644426-113644448 GGATCACTTGAGGCCAGCCTGGG - Intergenic
996063757 5:119059202-119059224 GGATCCCTTGAGCCCAGGACAGG - Intronic
996077614 5:119215552-119215574 GGATCACTTGAGGTCAGGAGTGG - Intronic
996445105 5:123539054-123539076 GGATTGCTTGAGGCCAGGCCAGG - Intronic
996564172 5:124862548-124862570 GGATCACTTGAGCCCAGCCTGGG + Intergenic
996799892 5:127391478-127391500 GGATCACTTGAGCCCAGGGAAGG + Intronic
996819447 5:127610071-127610093 GGATTACTTGAAGCCAGCCCGGG - Intergenic
996899284 5:128525171-128525193 AGATCAGTTGAGGCAAGGCAAGG + Intronic
997146994 5:131445775-131445797 GGATCACTTGAGGCCAGCCTTGG - Intronic
997999129 5:138610305-138610327 GGATCACTTGAGCCCAGGTCAGG - Intergenic
998082091 5:139284380-139284402 GGATCACTTGAGGCCAGGACAGG + Intronic
999782883 5:154864829-154864851 GGATCACTTGAGACCAGCCTGGG + Intronic
999887600 5:155940058-155940080 GGATCACCTGAGGTCAGGTCAGG - Intronic
1000776792 5:165429773-165429795 GGATCACTTGACTTGAGGTCAGG + Intergenic
1002024463 5:176387690-176387712 GGATCACTTGAGGCCCAGCCTGG + Intronic
1002259282 5:177982754-177982776 GGATCATGTGAGCCCAGGCCAGG - Intergenic
1002598201 5:180337922-180337944 GGATCGCTTGGGGCTACGCCGGG + Intronic
1002991577 6:2244090-2244112 GGATTGCTCGAGGTGAGGCCAGG - Intronic
1003665532 6:8108029-8108051 AGATCACCTGAGGCCAGGCATGG - Intergenic
1003954420 6:11148511-11148533 GGATCACTTGAGCCCAGCCTGGG - Intergenic
1004013992 6:11715893-11715915 GGATCCCTTGTGGTGAGGCCAGG - Intronic
1005037182 6:21567568-21567590 AAATCACTTGAGGCCAGGCGTGG - Intergenic
1006180081 6:32149336-32149358 AGATCGCTTCACGCGAGGCCCGG - Exonic
1006579166 6:35066732-35066754 TTATCCCTTGAGGTGAGGCCAGG + Intronic
1006647502 6:35524919-35524941 GGATCACTTGAGGCCATGAGTGG + Intergenic
1006675030 6:35756476-35756498 GGATCACCTGAGGTCAGGTCAGG - Intergenic
1007294483 6:40811536-40811558 GGGTCACCTGAGGCCTGGCCAGG - Intergenic
1007480693 6:42147871-42147893 AGATCACCTGAGGTGAGGTCAGG + Intergenic
1008094632 6:47327350-47327372 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1008522495 6:52375598-52375620 GGATCACTTGAGCCCAGGAGGGG - Intronic
1008783916 6:55142495-55142517 TGATCAGTTGAGGCCGGGCCCGG - Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010201161 6:73283457-73283479 GGATCACTTGAGACTAGCCTGGG - Intronic
1010394208 6:75372138-75372160 GGATCACCTGAGGTGAGATCGGG + Intronic
1011285543 6:85718747-85718769 GGATCACTTGAGGCCAGGACTGG + Intergenic
1011540578 6:88423217-88423239 GGATCACCTGAGGTCAGGTCAGG - Intergenic
1011694195 6:89897430-89897452 GAATAACTTGAGGCCAGGCATGG + Intergenic
1012726761 6:102823731-102823753 GGATCACTTAAGGCCAGGAATGG + Intergenic
1012899886 6:104993243-104993265 GGATCACATGAGGCGAGTTCAGG + Intronic
1013027529 6:106292116-106292138 GGATCACTTGACTTGAGGTCAGG + Intronic
1013093957 6:106927283-106927305 GGATCACTTGAGACAAGCCTGGG - Intergenic
1013293102 6:108735625-108735647 GGATCACTTGAGCCCAGGAGTGG + Intergenic
1013372350 6:109482255-109482277 GGATCACTTGAGACCAGCCTGGG + Intronic
1013782991 6:113749181-113749203 GGATCGCTTGAGCCTAGGACTGG - Intergenic
1013987568 6:116213947-116213969 GGATCACTTGAGCCTAGCCTAGG - Intronic
1014146559 6:118004769-118004791 GGATCACTTGAGGCCAGCCCAGG - Intronic
1014558006 6:122856505-122856527 GAAACACTGGAGGGGAGGCCTGG - Intergenic
1014657507 6:124126697-124126719 GGATCACTTGAGCCCAGTCTGGG + Intronic
1015301517 6:131657938-131657960 GGATCACTTGAGGTCAGGAGTGG + Intronic
1017183200 6:151573951-151573973 GCATCACTTAAGGCCAGGCCTGG + Intronic
1018108521 6:160512324-160512346 TAATCACTTGAGGCCAGGCATGG - Intergenic
1018537687 6:164838786-164838808 GGATCACTTGAGCCTAGGATGGG - Intergenic
1018600896 6:165539696-165539718 GGATCACTTGAGGTCAGGATTGG + Intronic
1018674133 6:166204595-166204617 GGATTACTTGAGGCCAGGCTGGG - Intergenic
1019139445 6:169934283-169934305 GGAGCGCTTGAGGCCAGGACAGG - Intergenic
1019418889 7:940249-940271 GGATCACTTGAGCCCAGGGGTGG + Intronic
1019479315 7:1259324-1259346 GGATCACTTGAGCCCAGGAGTGG + Intergenic
1019778220 7:2924975-2924997 GGATCACTGGAGGCCAGGAGGGG - Intronic
1020829371 7:13074927-13074949 GGATCACTTGAGGCCAGGAGTGG - Intergenic
1021088462 7:16452016-16452038 GGATGAGTTGAGGTGATGCCTGG - Intergenic
1021565130 7:22009387-22009409 GGATCATCTGAGGCCAGGTCAGG - Intergenic
1021777606 7:24068711-24068733 GGATCACTTGAGGCCAGCCTGGG + Intergenic
1022169707 7:27813560-27813582 GGATCACTTGAGCCCAGCCTGGG - Intronic
1022434113 7:30362825-30362847 GAATCACTTGAGGCTGGGCATGG + Intronic
1022440655 7:30430329-30430351 GGAGCATTTCAGGAGAGGCCTGG - Intronic
1022491598 7:30824780-30824802 TGATCACTTGAGGCCAGCCTGGG - Intronic
1022667392 7:32424558-32424580 GGATCACTTGAGCCCAGGCCTGG + Intergenic
1023383570 7:39632727-39632749 GGATCACTTGAGCCCAGGAGGGG + Intronic
1024004289 7:45214017-45214039 GTATCACTTGAGCCCAGGTCGGG - Intergenic
1024957796 7:54943383-54943405 GGATCACTTGAGCCCAGGATAGG + Intergenic
1026058962 7:67009218-67009240 GGATCACTTGAGGCCAAGCCTGG - Intronic
1026523711 7:71136993-71137015 GGATCACTTGAAACCAGCCCTGG - Intronic
1026699277 7:72625534-72625556 GGATCACTTGAGCCCAGGAGCGG + Intronic
1026719127 7:72815815-72815837 GGACCACTTGAGGCCAAGCCTGG + Intronic
1026805409 7:73426441-73426463 GGATCACTTGAGGTCAGGAGAGG + Intergenic
1027125035 7:75550497-75550519 GGATCACTTGAGCCCAGGAGTGG - Intronic
1029373704 7:100165606-100165628 GGATCATTTGAGGCCAGCCTGGG + Intronic
1029454766 7:100663514-100663536 GGATCACTTGAGGCCAGTGTTGG + Intergenic
1029658374 7:101942687-101942709 GGATCACTTGAGCCCAGGAGTGG - Intronic
1029791617 7:102848769-102848791 GCATCACCTGAGGTGAGGTCAGG + Intronic
1029855468 7:103511653-103511675 GGATCGCTTGAGGCCAGCCTGGG + Intronic
1029995869 7:105007616-105007638 GGATCACTTGAGACCAAGCTGGG - Intergenic
1030188718 7:106789791-106789813 GGATCACCTGAGCCCAGGGCGGG + Intergenic
1031338798 7:120572743-120572765 GGATCACTTGAGGTCAGGACAGG - Intronic
1031881075 7:127199181-127199203 GGATCACTTGAGGTCAGCCTGGG - Intronic
1032058460 7:128703566-128703588 GGATCACTTGAGACCAGCCTGGG + Intergenic
1032824047 7:135551992-135552014 GGATCACCTGAGGTCAGGTCAGG - Intergenic
1033952161 7:146798182-146798204 GGATCACTTGAGCCGGGGATGGG + Intronic
1034322105 7:150195581-150195603 AGATCACTTCAGGGGGGGCCAGG + Intergenic
1034431743 7:151044527-151044549 GGATCTCTTGAGGCTAGCCTGGG + Intronic
1034493676 7:151407896-151407918 GCATCACTGGAGCCCAGGCCTGG + Intronic
1034675093 7:152887151-152887173 GGATCACTTGAGCTGAGATCAGG - Intergenic
1034990938 7:155547936-155547958 GGCTCCCTTGAAGCTAGGCCAGG + Intergenic
1035184691 7:157117181-157117203 GGATCACTTGAGGCTAGGAGTGG - Intergenic
1036150580 8:6293672-6293694 AGATCACCTGAGGTGAGGTCAGG + Intergenic
1036505587 8:9352350-9352372 GGAGCACTTGAGGTCAGGCCTGG - Intergenic
1036815554 8:11900113-11900135 GGACCACTTGAGGCCAGCCTGGG - Intergenic
1037293136 8:17372356-17372378 AGATCACTTGAGGTCAGGTCAGG + Intronic
1037329497 8:17730252-17730274 GGATCACCGGAGGCCAGGCCAGG + Intronic
1037600141 8:20387024-20387046 GGATCGCTTGATCCCAGGCCAGG + Intergenic
1037817729 8:22120715-22120737 GGAGCACTGGAGGCAGGGCCAGG - Exonic
1038557295 8:28532634-28532656 GGATCACTTAAGACCAGGCTGGG - Intronic
1038576724 8:28710757-28710779 GGATGACTTGAGACCAGCCCTGG - Intronic
1038635131 8:29280226-29280248 GGATCTCTTGAGTCCAGTCCAGG + Intergenic
1038669470 8:29570838-29570860 GAATCACTTAAGGCTAGGCACGG - Intergenic
1038718834 8:30015179-30015201 GGATCACTTGAGGCCAGTGTTGG + Intergenic
1038783952 8:30593702-30593724 GGATCGCTTGAGGCCAGCCTGGG - Intronic
1038805602 8:30788470-30788492 GGATCACTTGAGGCCAGCCTGGG - Intronic
1039513090 8:38106906-38106928 GGATCACTTGAGACCAGCCTGGG + Intronic
1039556770 8:38482093-38482115 GGATCACTTGAGCCCAGGAGTGG + Intergenic
1039602986 8:38857483-38857505 GGATCACTTGAGCCCAGGATGGG - Intergenic
1039738203 8:40355258-40355280 GGATCACTTGAGGCCGGGAGGGG + Intergenic
1039769369 8:40668247-40668269 GGATCACTTGAGGTCAGGATTGG + Intronic
1039912630 8:41836830-41836852 GGATCACTTGAGCCCAGGAGTGG + Intronic
1040060187 8:43097030-43097052 GGATCACTTGAGTCTAGCCTGGG + Intronic
1041081433 8:54218553-54218575 GGATCTATTGAGGCCAGTCCTGG + Intergenic
1041447848 8:57972539-57972561 GGATCACTTGAGACCAGCCTGGG - Intergenic
1042139855 8:65667048-65667070 GGATCGCCTGAGGTGAGGTCAGG + Intronic
1042219082 8:66455690-66455712 GGATCCCTTGAGCTGAGCCCAGG + Intronic
1042276016 8:67006428-67006450 GGATCGCTTGAGCCCAGGACAGG - Intronic
1042564331 8:70097336-70097358 GGATCACCTGAGCCCAGGCAGGG + Intergenic
1042626214 8:70760547-70760569 GGATCACTTGATGCTAGCCTGGG - Intronic
1042912018 8:73837660-73837682 GGATCACTTGAGACCAGGCCAGG - Intronic
1043434417 8:80224364-80224386 AGATCACTTGAGGCCAGCCTGGG - Intronic
1043768842 8:84171604-84171626 GGATCACTTGAGTTGAGTTCAGG + Intergenic
1044591274 8:93916701-93916723 GGGTCACGTGAGGCGGGCCCGGG + Intronic
1045311744 8:101009194-101009216 GGATCACTTGAGTCCCAGCCTGG - Intergenic
1045425522 8:102062179-102062201 GGATCACTTGAGGCCAGGAGAGG + Intronic
1046452370 8:114411033-114411055 GGATCACTTGAGCTGAGTCCAGG - Intergenic
1046477067 8:114759299-114759321 GGATCACTTGAGACCAGCCTGGG - Intergenic
1046936221 8:119887725-119887747 GGATCACTTGAGGTCAGGTCAGG - Intronic
1049839998 8:144764815-144764837 GGATCGCTTGAGCTGAGCCCAGG + Intergenic
1050354753 9:4771979-4772001 GGATCACTTGAAGCCAGGAGTGG - Intergenic
1050568842 9:6916480-6916502 GGATCACTTGAGACCAGCCAGGG - Intronic
1052683226 9:31721242-31721264 GGATCACTTGAGGCCAGCCTGGG + Intergenic
1055027480 9:71737591-71737613 GGATCACTTAAGGTTAGGTCTGG - Intronic
1055307894 9:74949937-74949959 GGATCACTTGAGCCCAGCCTGGG + Intronic
1055430406 9:76237686-76237708 GGATCACTTGAGCCCAGGAGAGG + Intronic
1055470143 9:76602816-76602838 GGATCACTTGAGCTCAGGCCTGG - Intergenic
1056039076 9:82642227-82642249 TGATCACTTGAAGTCAGGCCAGG + Intergenic
1056207612 9:84335330-84335352 GGATCACTAGAGGCCAGCCTGGG + Intronic
1056213317 9:84385320-84385342 AGATCACTTTAGGCGGGGCATGG - Intergenic
1056336201 9:85572253-85572275 AGATCACTTGAGGTCAGGCCAGG - Intronic
1056381161 9:86058484-86058506 GGATCACTTGAGGTCAGAACTGG + Intronic
1056705465 9:88948951-88948973 GGATCACTTGAGGCAAGGTAAGG - Intergenic
1056825861 9:89875907-89875929 GGATCACCTGAGGCCAGGAGGGG + Intergenic
1057584094 9:96314041-96314063 GGATCACTTGAGGCCAGCCTAGG + Intergenic
1057730096 9:97601066-97601088 GGGTAACTGGAGGCGGGGCCAGG + Exonic
1058013140 9:100000207-100000229 GGATCACTTCAGGCCAGGCCAGG + Intronic
1058457969 9:105155852-105155874 GGATTGCTTGAGGCCAGACCTGG + Intergenic
1058803860 9:108570684-108570706 GGATCACTTGAGTCCAGGAATGG + Intergenic
1058976788 9:110132280-110132302 AGATCACCTGAGGTGAGGTCAGG - Intronic
1059206295 9:112469461-112469483 GGATCACTTGAGACCAGCCTGGG + Intronic
1059747322 9:117215710-117215732 AGAACAATTGAGGGGAGGCCTGG - Intronic
1060051635 9:120382567-120382589 GGCTCACTAGAGGTGGGGCCAGG + Intergenic
1060363131 9:122980331-122980353 GGATCACTTGAGGCCAGCCTGGG - Intronic
1060587179 9:124793801-124793823 GGATCACTTGAGGCCAAGGTGGG + Intronic
1061111635 9:128576324-128576346 GGATCACTTGAGACCAGCCTGGG + Intronic
1061116469 9:128616345-128616367 GGATCACTTGAGGTCAGGTGAGG - Intronic
1061308550 9:129747120-129747142 AGATCACTTGAGGTCAGGCCTGG - Intronic
1061766562 9:132885289-132885311 GGATCACCTGAGGCCAGGAGTGG + Intronic
1062409630 9:136416567-136416589 GGATCACCTGAGCTGAGCCCAGG - Intronic
1062467369 9:136687165-136687187 GGAGAACATGAGGCAAGGCCGGG - Exonic
1185862081 X:3589069-3589091 GGATTACTTGAGGCCAGCCTGGG + Intergenic
1186091680 X:6055270-6055292 GGATCATTTGAGGCCAGGAGTGG + Intronic
1187073746 X:15913990-15914012 GGATCGCTTGAGCCCAGGCATGG - Intergenic
1187189774 X:17023135-17023157 GGAACACTTGAGGCTGGGCACGG + Intronic
1187254639 X:17630875-17630897 GAATCACTGGAGGTGGGGCCTGG - Intronic
1187687754 X:21832669-21832691 GGATCACTTGAGACCAGCCCGGG + Intergenic
1187896863 X:23990087-23990109 GGATCACTTGAGACCAGCCTGGG + Intronic
1187961309 X:24568870-24568892 GGATCACTTGAGGTCAGGTCAGG + Intronic
1187993022 X:24896210-24896232 GCATCTCTTGAGTAGAGGCCAGG + Intronic
1188321779 X:28747411-28747433 GGATCACTTCACTTGAGGCCAGG + Intronic
1189434429 X:40979217-40979239 GAATCACTTGAGGCTGGGCGCGG + Intergenic
1189520065 X:41757720-41757742 GGATCACTTGAGACCAGCCTGGG - Intronic
1189864568 X:45312235-45312257 GGATCACCTGAGGTCAGGCTGGG - Intergenic
1190859205 X:54327757-54327779 AGATCACTTGAGGCCAGCCTGGG + Intronic
1192136978 X:68611932-68611954 GGATCACTTGACTTGAGCCCAGG - Intergenic
1192422976 X:71050351-71050373 GGATCACTTGAGACCAGCCTGGG - Intergenic
1193274805 X:79572700-79572722 GGATCACTTGAGACCAGCCTGGG + Intergenic
1194355635 X:92881048-92881070 GGATCACTTGAGGCCAGGCCAGG + Intergenic
1196237029 X:113293947-113293969 GGATCTCTTGAGGCCAGACATGG + Intergenic
1196351580 X:114737440-114737462 GGATCACTTGAGGTCAGGAGTGG - Intronic
1197867160 X:131031150-131031172 GAAGCACTTTAGTCGAGGCCTGG + Intergenic
1198110755 X:133500933-133500955 GGATCACTTGAGGCCAAGGCAGG - Intergenic
1198451679 X:136772646-136772668 GGATCACTTGAGGCCAGGAGAGG + Intronic
1200663982 Y:5998039-5998061 GGATCACTTGAGGCCAGGCCAGG + Intergenic
1201189303 Y:11432903-11432925 GGATCATTTGAGGCCAAGACTGG - Intergenic
1201505319 Y:14693080-14693102 GGATCACTTGAGGCCAGGAGTGG - Intronic