ID: 904514982

View in Genome Browser
Species Human (GRCh38)
Location 1:31047562-31047584
Sequence TGCTGTTGCCTGAGAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904514977_904514982 28 Left 904514977 1:31047511-31047533 CCCAGAAACCTAATTTTGTACTC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG 0: 1
1: 0
2: 1
3: 30
4: 288
904514981_904514982 -3 Left 904514981 1:31047542-31047564 CCTGCAGAGTATTCAGCAAATGC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG 0: 1
1: 0
2: 1
3: 30
4: 288
904514978_904514982 27 Left 904514978 1:31047512-31047534 CCAGAAACCTAATTTTGTACTCA 0: 1
1: 0
2: 1
3: 16
4: 203
Right 904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG 0: 1
1: 0
2: 1
3: 30
4: 288
904514980_904514982 20 Left 904514980 1:31047519-31047541 CCTAATTTTGTACTCAGGCTTAG 0: 1
1: 0
2: 2
3: 10
4: 146
Right 904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG 0: 1
1: 0
2: 1
3: 30
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904514982 Original CRISPR TGCTGTTGCCTGAGAGAAAA TGG Intronic
900572702 1:3366633-3366655 TTTTGTTCCCAGAGAGAAAAAGG + Intronic
901507116 1:9691793-9691815 TGCTGCTGCCTGGGAAAAGAAGG + Intronic
901916374 1:12503673-12503695 TGCTATTAACTGAGAGGAAAGGG - Intronic
902517885 1:16999592-16999614 GATTGTTGCTTGAGAGAAAAAGG + Intronic
902669321 1:17961679-17961701 GGGTGGTGCCTGAGAGCAAAGGG - Intergenic
902767579 1:18627683-18627705 TGTTGTTGCCTTTAAGAAAAGGG + Intergenic
902877634 1:19350252-19350274 TGCTGCAGCCCGAGAGGAAAGGG + Intronic
904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG + Intronic
904713005 1:32445196-32445218 TGCTGTTCCTTCAGTGAAAAGGG - Intergenic
905894063 1:41533939-41533961 TGCTGCTTGCTGAGAGAGAACGG - Intronic
907270073 1:53285858-53285880 TCCTGTTGTCTGAGAGACAGTGG - Intronic
907375436 1:54034270-54034292 TGCTGCTGCTTGGGAGAAAATGG + Intronic
908048909 1:60206111-60206133 TGCTGTTGACTTAGAAGAAAAGG + Intergenic
908466985 1:64405998-64406020 TGCTCTTGACTCAGAGACAAGGG - Intergenic
908662691 1:66454163-66454185 TGCTGTAGCCTGGGATAGAATGG + Intergenic
909855989 1:80532424-80532446 TACACTAGCCTGAGAGAAAAAGG - Intergenic
909950973 1:81720074-81720096 TGAGGTTGCCAGAGTGAAAATGG + Intronic
911590497 1:99742265-99742287 TGCTGATCCCTGAAATAAAAGGG + Exonic
911624739 1:100109624-100109646 CTCTGTTGCCTGAAAGAACAAGG + Intronic
912425120 1:109581311-109581333 TTCTGTTTACTGAAAGAAAACGG + Intronic
913568387 1:120096526-120096548 TACTCTTGCCTGAGAGAACAGGG + Intergenic
914289198 1:146257553-146257575 TACTCTTGCCTGAGAGAACAGGG + Intergenic
914550234 1:148708306-148708328 TACTCTTGCCTGAGAGAACAGGG + Intergenic
915029773 1:152868154-152868176 TGCTGGTGACTGAGACAAACAGG + Intergenic
915050800 1:153070459-153070481 TGATGTTCCCTGATAGCAAAAGG - Exonic
915165384 1:153945479-153945501 TGCTGTTCCCCCAGAGAACAGGG + Intronic
915819778 1:159009905-159009927 TGCTATTGCCCCAGAGAAAATGG - Exonic
916031873 1:160883986-160884008 GGCAGTTGCCTGGGAGAAGAAGG + Intronic
916623078 1:166522934-166522956 TGTTGTTGTGTGGGAGAAAAAGG - Intergenic
916768083 1:167881296-167881318 TGCTGTTGTCTGTAAGAAAAGGG + Intronic
917628017 1:176865240-176865262 TGCAGATTCCTGAGAGAGAAGGG + Intronic
918219203 1:182420415-182420437 TGCTGATGCTGCAGAGAAAAGGG - Intergenic
918245563 1:182656596-182656618 TGAGGCTGCCTGAGAGAACATGG - Intronic
918638118 1:186804295-186804317 GGCTGTTGGCTTAGAGTAAAAGG + Intergenic
922088083 1:222369872-222369894 TGCTGGTCCCAGAGAGATAATGG - Intergenic
922685183 1:227633350-227633372 ATCTGTTGCCTGAGAGCACAGGG - Intronic
923068990 1:230545671-230545693 TGATGTTGCATGAGAAAGAAGGG + Intergenic
923296097 1:232596261-232596283 TGTTGTTTCATGAGGGAAAATGG - Intergenic
1062891300 10:1062526-1062548 TGATATGGCCTCAGAGAAAAAGG - Intronic
1062960944 10:1573349-1573371 GGCTGCTGCCTGGGATAAAAGGG + Intronic
1063797319 10:9527044-9527066 TGCTGTTGCTTGACAGATCAAGG - Intergenic
1066253818 10:33659638-33659660 TCCTGATGCATGAGGGAAAAAGG + Intergenic
1066270811 10:33820826-33820848 AGCTGATGCAGGAGAGAAAAGGG + Intergenic
1067524364 10:47029273-47029295 TGCTCAGGCCAGAGAGAAAAGGG + Intergenic
1067528092 10:47050346-47050368 TGCTCTTGCATGAGAGTAGAAGG - Intergenic
1068686202 10:59872417-59872439 TGCTGTTGCAGGTAAGAAAATGG + Intronic
1069659682 10:70115346-70115368 TGCTGATGCCAGAGTGGAAATGG + Intronic
1070553655 10:77511860-77511882 ATATGTTGCCTGAGAGACAATGG + Intronic
1070835230 10:79443823-79443845 TGCTTTTGCCTGACACCAAAGGG + Intronic
1071181040 10:82984209-82984231 TGCTGTTCCATGACAGAAAATGG - Intronic
1072456030 10:95576781-95576803 TGCTTTAGCCTGAGAGACAGAGG + Intergenic
1076481368 10:130787048-130787070 TGCGGCTGCCTCAGGGAAAAGGG + Intergenic
1077546461 11:3172500-3172522 TTCTGTATCCTGAGAGGAAAAGG - Intergenic
1077745881 11:4904744-4904766 AGTTGTTGCCAGAGAAAAAAAGG + Intronic
1078808318 11:14730483-14730505 TATTGTTGCATAAGAGAAAAAGG + Intronic
1079484672 11:20922986-20923008 TGATGGTTCCTTAGAGAAAATGG + Intronic
1079914138 11:26347456-26347478 TGGTCTTGTCTCAGAGAAAAGGG - Intronic
1081402964 11:42663993-42664015 TGCCTTTATCTGAGAGAAAAAGG - Intergenic
1083243352 11:61406321-61406343 AGCTGTTCCCTGAGAGTGAAAGG - Intronic
1084440496 11:69170047-69170069 TGCTGTTGACTGTGAGAAGAGGG - Intergenic
1085502368 11:77035598-77035620 AGCTGTGTCCTGAGAGACAAGGG + Intronic
1088409397 11:109516813-109516835 TGATGATGCATGAGAGAAGAGGG - Intergenic
1089288285 11:117421546-117421568 TGCTGTTTCCTAATGGAAAATGG + Intergenic
1092233433 12:6790982-6791004 TGCTGTAGGCTGATACAAAATGG + Intronic
1092867503 12:12776728-12776750 TGCTTTTTGCTGAGGGAAAAAGG - Intronic
1094526981 12:31237756-31237778 TGCTGCTGCCTGAGAAAACCTGG + Intergenic
1094737133 12:33247415-33247437 TGGAGTTACCTGAGAAAAAAAGG - Intergenic
1095317460 12:40782912-40782934 TGCTGTTGCCAGAGACATAAAGG + Intronic
1095985412 12:47995981-47996003 GGCTGTTGGCTGGGAGAAGATGG - Intronic
1096069600 12:48767635-48767657 TTCTGTTGCCAAATAGAAAAGGG - Exonic
1096620251 12:52860094-52860116 TGCTGGTGCCTGAGAGAGGAAGG + Intergenic
1097237962 12:57552540-57552562 GGATGTTGCCTAAGACAAAATGG - Intronic
1097932659 12:65206619-65206641 TGCCATGGCCTGAGAGAGAAGGG + Intronic
1098977783 12:76921189-76921211 TAATGTAGCCTGAGAGAAGAAGG + Intergenic
1099570022 12:84305122-84305144 TGCAGTTCCCAGGGAGAAAACGG - Intergenic
1102345034 12:112154258-112154280 TGTTGTTGCGTGAAAGAAACTGG + Intergenic
1103698125 12:122833536-122833558 GGCTGTTGCCTGGTTGAAAAGGG + Intergenic
1104910611 12:132238486-132238508 TGCTGGTGCCAGAGAGACCACGG + Intronic
1104988354 12:132610322-132610344 TGCTGGCGCCTGACGGAAAAAGG - Exonic
1105575475 13:21647035-21647057 GGCTGTTGACTGTGAGAAAGAGG + Intergenic
1106072484 13:26425933-26425955 AGCTGTGGCCCGGGAGAAAATGG + Intergenic
1106522872 13:30513241-30513263 TGGGGTGGCCAGAGAGAAAATGG - Intronic
1107880060 13:44824944-44824966 TGCTGGTGCCATAGAGATAATGG - Intergenic
1108729532 13:53220112-53220134 TGCTGCTGCCTGAGACCACAGGG - Intergenic
1108742160 13:53349470-53349492 TGCTCTGGCCTCTGAGAAAAAGG - Intergenic
1109445179 13:62428470-62428492 TGATATTTCCAGAGAGAAAATGG - Intergenic
1110127909 13:71970336-71970358 TGCTGTTGCTAAAGAGAAAGTGG + Intergenic
1111683335 13:91470647-91470669 TTATGGTGCCTGAGATAAAAAGG - Intronic
1111908685 13:94285611-94285633 TACTGTGGCCTGGGGGAAAAAGG - Intronic
1113148584 13:107236993-107237015 TGCAGTTCCCTGATATAAAATGG - Intronic
1117222426 14:53619420-53619442 TTCTGGTGCCTGAGATAAAGGGG + Intergenic
1117504791 14:56391211-56391233 TTCTATTGCCTGGAAGAAAAGGG + Intergenic
1117634895 14:57731498-57731520 TGCTGTAGAATGAAAGAAAAAGG - Intronic
1119024183 14:71139599-71139621 CGCTGTCCCCTGAGAGGAAAAGG - Intergenic
1119670474 14:76514502-76514524 TGCTGTTCACTGAGAGCAGAAGG - Intergenic
1120588701 14:86348731-86348753 GGCTGTTGCCCAGGAGAAAATGG + Intergenic
1120958580 14:90104437-90104459 TGCTGTGCCAAGAGAGAAAATGG - Intronic
1121709921 14:96030246-96030268 TGCTTCTGCCTGTTAGAAAAGGG + Intergenic
1121996335 14:98606401-98606423 GGCTGGTGCCTCAAAGAAAAAGG + Intergenic
1124169816 15:27362717-27362739 TGATGTTGCCTCTGAGTAAAAGG - Intronic
1124183833 15:27503224-27503246 TGGAGTTGCATGACAGAAAATGG + Intronic
1125889444 15:43254661-43254683 TGGTGTTGCTGGAGAAAAAATGG - Intronic
1126187728 15:45847032-45847054 TACTGTTAGCTGAGAGAATATGG - Intergenic
1130154120 15:81334841-81334863 TGCTGCTCCCTGAGTCAAAATGG + Exonic
1131566263 15:93488461-93488483 TGCTCTAGACTGAGAGAAAGTGG + Intergenic
1134624718 16:15715262-15715284 TGCTGTTTGCAGAGAGAAACAGG - Exonic
1135932591 16:26751160-26751182 TATTGTTGTCTTAGAGAAAAGGG + Intergenic
1138144097 16:54593642-54593664 TGATGTTGGCTGAGATAGAAGGG - Intergenic
1139501496 16:67370033-67370055 TGATGATGCCAGGGAGAAAAGGG + Intronic
1139519432 16:67472098-67472120 TGCTGCTGCCTGCGAGAATGAGG - Intronic
1139532019 16:67547067-67547089 GGCTGTGGCCTGGGAGCAAAGGG + Intergenic
1140509933 16:75499655-75499677 TGCTTTTCCCTCAGAGACAACGG - Intergenic
1140515727 16:75539864-75539886 TGCTTTTCCCTCAGAGACAACGG - Exonic
1142630215 17:1220864-1220886 TACTGTTGTGGGAGAGAAAAGGG + Intronic
1145207660 17:20993187-20993209 TGCTGTTTCCTGGGAACAAAGGG - Intergenic
1145353239 17:22109246-22109268 TGCTTTCTTCTGAGAGAAAAGGG + Intergenic
1145889932 17:28407247-28407269 TGCAGTTCCCTTAGAGAAGATGG + Intergenic
1147454979 17:40531394-40531416 GGCTGTTGCTTGAGAGAAATGGG + Intergenic
1147936745 17:44015849-44015871 GCCTGTGCCCTGAGAGAAAAAGG + Intronic
1148212141 17:45815038-45815060 TGCTGTTTCCTGAGAGACTGGGG + Intronic
1150856912 17:68761805-68761827 TGCTCTTGCTGGAAAGAAAAAGG + Intergenic
1151367190 17:73625343-73625365 TCCTGGAGCCTGAGAGAAGAGGG + Intronic
1152025102 17:77803704-77803726 TGCTGGAGTTTGAGAGAAAATGG + Intergenic
1152193805 17:78904380-78904402 TGTTGTTTCTTGAGAGAAGAAGG + Intronic
1152216548 17:79035987-79036009 TGCGGATGCATGAGAGGAAAGGG + Intronic
1152671000 17:81606212-81606234 CGCTGTGCCCTTAGAGAAAACGG - Intronic
1152862926 17:82706094-82706116 TGCTGCTGCCTGAGGAAACAGGG + Intergenic
1152931293 17:83111520-83111542 TTCTGCTGCCTGAGAGAAGAGGG + Intergenic
1155247085 18:23920810-23920832 AGCTGCTGCCTCAGTGAAAAGGG - Intronic
1155467793 18:26157552-26157574 TGCTGTTTCCTCACAGACAATGG - Intronic
1155745579 18:29353126-29353148 TGGTGTGGCTTCAGAGAAAAGGG - Intergenic
1156656297 18:39291720-39291742 TGCTCTTGAATGAGAGGAAAGGG + Intergenic
1156836872 18:41565578-41565600 TGCTGAAGACTGAGAGAAGATGG + Intergenic
1157006010 18:43585834-43585856 TGCAGTAGCCTGAAAAAAAATGG - Intergenic
1157429152 18:47609124-47609146 TGCTGTTGCCTGTGATAAACTGG - Intergenic
1158131494 18:54157664-54157686 TGCTGTGGCATGAAAGATAAAGG + Intronic
1158768001 18:60479030-60479052 TACTGATGCCTGAAAGCAAAAGG + Intergenic
1163505415 19:17703081-17703103 AGCTGTTGGCTGGAAGAAAATGG - Intergenic
1164824251 19:31272953-31272975 TGCTGTTGCGAGAGAGTGAATGG - Intergenic
1168449747 19:56457031-56457053 TGGTGTAGGCTGGGAGAAAACGG - Intronic
1168595416 19:57671624-57671646 TGCTTTTCCCTGAGGGCAAAGGG + Intronic
925434806 2:3827454-3827476 TTCTGTGGACTGGGAGAAAAAGG + Intronic
929027655 2:37620132-37620154 TGCTGTTTGCTCAGATAAAATGG - Intergenic
929826471 2:45312408-45312430 TGTTTTTGCCTGTGGGAAAATGG - Intergenic
930085853 2:47496676-47496698 TTCTGTTGCCTGTGACCAAAGGG + Intronic
931057946 2:58493879-58493901 TGATGTTTCTTGAGAGAAGAGGG + Intergenic
931173577 2:59830511-59830533 TGCTGCTGCCAGAGGGAAAATGG - Intergenic
931175179 2:59847293-59847315 TGCTGCTGCCCTACAGAAAAAGG + Intergenic
931224286 2:60316352-60316374 AACTGTGGCCTGAGAGACAAGGG - Intergenic
932148267 2:69343989-69344011 TGGTGTGGCCTGAGTGAGAAGGG - Intronic
932671236 2:73739574-73739596 TGCTGTAGCCTGTGACATAATGG + Intergenic
932765455 2:74466366-74466388 TGCTGGGGACTCAGAGAAAATGG + Intergenic
935059529 2:99595506-99595528 GTCTGTTGCCAGAGAAAAAATGG + Intronic
935712280 2:105909752-105909774 TGCTGCTACCTGGAAGAAAAAGG + Intergenic
935919134 2:107991093-107991115 TACTGTTTCCTCAGAGAAAATGG + Intronic
936282248 2:111152287-111152309 TGGGGCTGCCTGAGAGAAAGAGG + Intronic
937559711 2:123206687-123206709 TGCTTTTGCCTGTGAGTAAAAGG - Intergenic
938644263 2:133315163-133315185 TGCTGTTGACTGAAGGAATAGGG + Intronic
939041085 2:137190179-137190201 TGCTATTGCCTATGAGAAATAGG - Intronic
940290426 2:152073177-152073199 TGCAGTTGGCAGAGAGAATAAGG + Intronic
940384103 2:153050256-153050278 TGCTCTGGCCTGAGACACAAGGG + Intergenic
940984242 2:160036872-160036894 TGCTGTTCCCTGGGGAAAAATGG + Intronic
941052914 2:160755299-160755321 AGCTGCTGCCTCAGTGAAAAGGG - Intergenic
941730135 2:168908418-168908440 TGCTGAAGACTGTGAGAAAATGG - Intronic
942600360 2:177634722-177634744 TGCAGTTAGCTGAGAGAATATGG + Intronic
942886075 2:180925747-180925769 TGCTTTTGGCTGAGACAGAATGG + Intergenic
944415588 2:199476463-199476485 TGATGTTGTCTAAAAGAAAATGG - Intergenic
945612642 2:212024076-212024098 TGTGTCTGCCTGAGAGAAAAGGG - Intronic
948242595 2:236449903-236449925 TGCTTTTGGTTGAAAGAAAAAGG + Intronic
948517614 2:238514008-238514030 ATCTGTTGCCTGAGAGCACACGG + Intergenic
1170297995 20:14850378-14850400 TGATATTCCCTGAGAGAGAATGG - Intronic
1171511685 20:25690721-25690743 AGCAGTTGCCTATGAGAAAATGG + Intronic
1171563485 20:26153442-26153464 TGCTTTCTTCTGAGAGAAAAGGG + Intergenic
1173003298 20:39121038-39121060 TGTTGGAGCCTGAGAGCAAAAGG - Intergenic
1173641876 20:44609170-44609192 TGCTGTTCCCTGAGGGGATATGG + Intronic
1176961383 21:15163032-15163054 TGCTTAGGCATGAGAGAAAAAGG - Intergenic
1176981303 21:15384246-15384268 TTTTGTTGCCTAAGACAAAATGG - Intergenic
1178303096 21:31469009-31469031 AACTGAAGCCTGAGAGAAAAAGG - Intronic
1178472152 21:32903528-32903550 TGCTGTACCCTGAGTGATAAAGG - Intergenic
1179094150 21:38296912-38296934 TGCTACTGCCTGAAAGAAAGAGG - Exonic
1179640993 21:42747181-42747203 TGCTGTTGACAAAGACAAAAGGG - Intronic
1181108004 22:20585998-20586020 AGTGGTCGCCTGAGAGAAAAGGG + Intronic
1181652786 22:24270109-24270131 TGCTGATGCCTAAGAAAAACCGG - Intergenic
1182228258 22:28816789-28816811 TGCTGGTACCTGAGAGAATGTGG - Intergenic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
1185393271 22:50573893-50573915 TGGTGTTGCGTGAGAGAGAGTGG - Intronic
949278730 3:2320823-2320845 TGCTGTTCCCTTAAAGAAAGAGG - Intronic
949539300 3:5019941-5019963 AGCTGTGGCCAGAGAGGAAAGGG - Intergenic
950705014 3:14774041-14774063 TGCTCTGGGCTGGGAGAAAAAGG - Intergenic
953468472 3:43146314-43146336 TTTTGTTCCCTGAGAGAAGAAGG + Intergenic
953608658 3:44429089-44429111 TGCTGCTGCCTAAGAGAAAGTGG + Intergenic
953785738 3:45909887-45909909 TGATGTTGCCTGAGACAAGGTGG + Intronic
954401754 3:50322831-50322853 TGCTGCCCCCTGAGAGGAAAGGG + Intronic
954813858 3:53265121-53265143 TGCTTTTCCCAGACAGAAAATGG - Intergenic
954908098 3:54079888-54079910 TGCTGTTACCAGAGAGACAGTGG - Intergenic
955995728 3:64678658-64678680 CCCTCTTGCCAGAGAGAAAAGGG - Intronic
959086368 3:101854590-101854612 TGCTGTTGCCCAAGGGAGAAGGG + Exonic
961602568 3:128072795-128072817 CCCTCTTGCCTGAGAGCAAACGG + Intronic
962494048 3:135921815-135921837 TGCTGTTGCATCTGAGAAACAGG - Intergenic
962496507 3:135945500-135945522 AGCTCCAGCCTGAGAGAAAAAGG + Intergenic
964776708 3:160287158-160287180 TGATGTGTCCTGAGAGAAGAGGG + Intronic
970361453 4:15312339-15312361 TGCTGTTGCCTAGAAGTAAAAGG + Intergenic
970636558 4:18016861-18016883 TGCTGTGCCCTTAGACAAAATGG + Intronic
970784366 4:19778375-19778397 TGCTCTGGGCTGAGAGAACAAGG + Intergenic
970876956 4:20882738-20882760 TGCTGTCTGCAGAGAGAAAAGGG + Intronic
971218120 4:24680742-24680764 TGCTGCTGCTTAGGAGAAAAGGG + Intergenic
971692371 4:29853539-29853561 TACAGTTTCCTGAGAAAAAATGG + Intergenic
971988005 4:33851533-33851555 TGCTTTCTTCTGAGAGAAAAGGG - Intergenic
971998090 4:33993375-33993397 TGCTCTTGCCTGAGAGGACAGGG + Intergenic
973884335 4:55305483-55305505 TGCTGTTTCCTGAAGGGAAATGG - Intergenic
975129090 4:70814601-70814623 TGCTGCTGCTTGACAGAAGATGG - Intergenic
975286397 4:72626345-72626367 TGCTGCTACCTGAGAGTATAAGG + Intergenic
975607428 4:76169066-76169088 AGCTGATGGCTAAGAGAAAAGGG + Intronic
980227611 4:130007136-130007158 TGCTGTTTCTTGAGAAAAGATGG + Intergenic
980350319 4:131675540-131675562 AGCTGTTTCATGGGAGAAAATGG + Intergenic
981220948 4:142234001-142234023 TGCTGATTTCTGAGAGAAAAAGG - Intronic
982811723 4:159833866-159833888 AGCTGATGTCAGAGAGAAAATGG - Intergenic
982853771 4:160354452-160354474 TACTATTACTTGAGAGAAAAGGG + Intergenic
983975110 4:173924567-173924589 TGCTGTTGAGAGAGAAAAAAAGG + Intergenic
984793776 4:183638618-183638640 AGCTGTGGCCTGTGACAAAACGG + Intergenic
984854243 4:184179664-184179686 TGCTGTTGTCTGAGAGACTGTGG - Intronic
985734635 5:1571474-1571496 TGTTGGTGCCTGAGAGCAAATGG - Intergenic
986172189 5:5324159-5324181 TGGAGTTGCCAGAGAGAAAGGGG + Intergenic
986631671 5:9780064-9780086 TGATGGTGCAGGAGAGAAAAGGG - Intergenic
987538717 5:19224945-19224967 TGATGATGCCACAGAGAAAAGGG + Intergenic
988894233 5:35654648-35654670 TGCTTTTGCACGAGAGCAAAGGG + Exonic
989729608 5:44633057-44633079 TCGTGTTACCTGAGAGGAAAAGG - Intergenic
990463498 5:56050822-56050844 TGCTTGTGCCTGAGAGGAAATGG - Intergenic
990920328 5:60957788-60957810 TGTAGTTGCCTGTGAGAAATAGG + Intronic
991050835 5:62271537-62271559 TGCTGCAGCCTGAGTGATAAGGG + Intergenic
991451456 5:66755120-66755142 TGCTATTGCAAGAGAGAAAGGGG + Intronic
992734231 5:79702900-79702922 TGCTACTGCCAGAGAGAACAAGG + Intronic
993782019 5:92077838-92077860 TTCTTGTTCCTGAGAGAAAAGGG - Intergenic
994146154 5:96397435-96397457 TGCTCTTGGCTGAAAGAGAACGG - Exonic
995199493 5:109410374-109410396 TGGTTTGGGCTGAGAGAAAAGGG + Intergenic
996399494 5:123046294-123046316 TGGTGTTGCCTGAGAGCAGGTGG - Intergenic
997617320 5:135257107-135257129 TTCTGTAGGCTGAAAGAAAATGG + Intronic
997875970 5:137547377-137547399 TCCAGTCCCCTGAGAGAAAATGG + Intronic
999367938 5:151035059-151035081 TGCTTTTAGCTGAGAGAAGAAGG + Exonic
1000531887 5:162432971-162432993 AACTGTTGGCTGAGAGAATATGG - Intergenic
1000817173 5:165937761-165937783 TGTTGTTGTTTGAAAGAAAATGG - Intergenic
1003269629 6:4595987-4596009 ATCTGTTGCCTGAGAGCACAGGG - Intergenic
1003654328 6:7991731-7991753 AGCTGTTGGCTGACAGAAAAGGG + Intronic
1006850267 6:37093151-37093173 TGCTTTTTACTGAGAGAAAGAGG - Intergenic
1007341200 6:41192498-41192520 TGCTGTAGCCTGCAAGAAACAGG + Exonic
1010153639 6:72766155-72766177 TGCAGTTGTCTGGGACAAAAGGG + Intronic
1011293675 6:85804858-85804880 AGCTGTGGCCTGAGAGCAGATGG - Intergenic
1016113273 6:140252464-140252486 AGATGCTTCCTGAGAGAAAATGG + Intergenic
1017130406 6:151103698-151103720 TGCTGTGGCCTCAGAAAAGATGG - Intergenic
1021403870 7:20241293-20241315 TATTGTTTCCTGAGAGAAGAGGG + Intergenic
1021914572 7:25418730-25418752 TGCTGTTCCCTTAAAGAAAAGGG - Intergenic
1022415935 7:30176974-30176996 TGCTGTGGCCTGAACAAAAAGGG + Intergenic
1023080404 7:36521244-36521266 TGGTATTGCCTGAGAGTAAATGG + Intronic
1024318682 7:48044421-48044443 ATCTATTGCCTGAGAGCAAAGGG - Intronic
1024944644 7:54796596-54796618 GGGTGCTGCCTGAGAGAGAAGGG - Intergenic
1025274232 7:57560853-57560875 TGCTTTCTTCTGAGAGAAAAGGG - Intergenic
1026257726 7:68726960-68726982 TGCTGTTGCCTGGGATAAAAGGG - Intergenic
1027711322 7:81604891-81604913 TCCTGTAGACTGAGAGAAAAGGG + Intergenic
1027771991 7:82418574-82418596 TGCTATTACATGAGGGAAAATGG - Intronic
1027991789 7:85372136-85372158 TGCTGTTGCTTTTGATAAAATGG + Intergenic
1028697813 7:93736876-93736898 TGCTGTTGACTGAGAGAGCTGGG + Intronic
1029213174 7:98925405-98925427 TGTTGGGGCCTTAGAGAAAATGG + Intronic
1029577876 7:101415567-101415589 TCCTGGTGCCTGTGAGAAGAGGG + Intronic
1030983402 7:116211501-116211523 TGGTGTCGCCTGGGAGAAAAGGG + Intronic
1031001770 7:116423938-116423960 TGCAGTTGGTGGAGAGAAAAGGG - Intronic
1031200735 7:118682008-118682030 TTGTGTTGCCAGAAAGAAAAAGG + Intergenic
1032176955 7:129638235-129638257 AGCTATTGTCTGAAAGAAAAGGG - Intronic
1032253197 7:130275485-130275507 TGCTGTTGAGTGAGAGAGAGGGG + Intronic
1032899144 7:136286994-136287016 TTCTTTAGTCTGAGAGAAAATGG + Intergenic
1033264517 7:139873259-139873281 TGCAGTTGGGTGAGAGAAAGGGG + Intronic
1033767584 7:144510976-144510998 TGCTGTTGCTGGACTGAAAAGGG + Intronic
1035129735 7:156640749-156640771 GGGAGTTGCCTGAGGGAAAAGGG + Intronic
1035770046 8:2139659-2139681 AGCTGGTGCCCGAGAGAAACAGG + Intronic
1036059610 8:5301365-5301387 TGCTGTTGCCTTGGAGAAAGAGG + Intergenic
1036436766 8:8742212-8742234 TGCTGAGGCCGCAGAGAAAAAGG - Intergenic
1036528763 8:9561379-9561401 GGTGGTTGCCTGAGGGAAAAGGG - Intronic
1037080056 8:14773666-14773688 TTCTTTTGCCTCAGAGCAAAGGG + Intronic
1038326790 8:26577872-26577894 GGCTTTTGCCTGAGAGGAAAGGG + Exonic
1038689002 8:29744182-29744204 TGCTGTTGGCTGAGAACAAGAGG - Intergenic
1038739522 8:30204672-30204694 TGCCGTTGGCTGAGAGGACAGGG + Intergenic
1041902270 8:62995448-62995470 AGCTGGTGCCTGAGAGGGAAGGG + Intronic
1042509449 8:69596249-69596271 TTCTGTTGCCTGTTAGATAAGGG - Intronic
1043517009 8:81003983-81004005 TGATGTTGCCAGAGTGCAAATGG - Intronic
1043693645 8:83189483-83189505 GGCTGTTTCTTGAGATAAAATGG - Intergenic
1044188076 8:89280555-89280577 TGGCATTGCCTGAGAGAAAAAGG - Intergenic
1045461961 8:102433084-102433106 TGCTTGTGCCTGAGAGGAAGAGG + Intergenic
1045892318 8:107171450-107171472 AGCAATTGCCTGAGACAAAATGG + Intergenic
1046069369 8:109232142-109232164 TCCTGTTGCCTGAGAGGTATGGG - Intergenic
1047490817 8:125373359-125373381 TGGTGTTGGCAGAGAGAACAAGG - Intergenic
1048740000 8:137546074-137546096 CACTGCTGCCTGAGAGAAACAGG - Intergenic
1048779351 8:137984679-137984701 TGGTGTGGGCAGAGAGAAAAGGG - Intergenic
1049126786 8:140796515-140796537 TTCTATTTCCTGAAAGAAAAAGG + Intronic
1049433917 8:142577526-142577548 TGCTGCTCCCTGCGAGGAAAAGG - Intergenic
1050847634 9:10242893-10242915 TGCTGGAGTTTGAGAGAAAAAGG + Intronic
1052399724 9:27985696-27985718 TTCTACTGGCTGAGAGAAAAAGG + Intronic
1052891575 9:33705116-33705138 TGCAGTTTCCTGAGAAAAACTGG + Intergenic
1054971836 9:71096974-71096996 TGCTGGTGCTTCAGAGAAGAAGG + Intronic
1056314990 9:85379677-85379699 TGCTGACTCCTGAGATAAAAGGG + Intergenic
1056592155 9:87972496-87972518 TTGTGTTGAATGAGAGAAAAGGG + Intronic
1057356412 9:94335514-94335536 AGCTGTTGTTTGAGATAAAAGGG + Intergenic
1057651337 9:96922113-96922135 AGCTGTTGTTTGAGATAAAAGGG - Intronic
1060130134 9:121088108-121088130 TGACCTTGCCAGAGAGAAAAGGG - Intronic
1060194839 9:121616909-121616931 TGCTGTCCCCTGGGAGAAGAGGG + Intronic
1060453895 9:123771820-123771842 TGCTGTTTGCTTAGATAAAAAGG - Intronic
1062296799 9:135834952-135834974 AGCCCTTGCCTGGGAGAAAAGGG + Intronic
1062310707 9:135934757-135934779 TGCTGTTTATTGAGAGGAAATGG - Intronic
1062365589 9:136207210-136207232 TGTTGTCGCTTGAGAAAAAAAGG - Exonic
1185489422 X:509718-509740 TGCTGTTGATGGAAAGAAAAGGG - Intergenic
1186798835 X:13072749-13072771 TGCTGATGCCTCTGAAAAAATGG - Intergenic
1187780429 X:22816388-22816410 TGAAGTTGCAGGAGAGAAAATGG + Intergenic
1188450362 X:30302325-30302347 TGCAGATGCCCTAGAGAAAAAGG + Intergenic
1188514669 X:30972434-30972456 TACTGTGGCCGGAGAGAATAAGG + Intronic
1189377828 X:40479610-40479632 TGCAGCTGCCTGAGAGCAAGTGG + Intergenic
1192048114 X:67697941-67697963 TGGTGTTGTCTGAGAGTAGAAGG - Intronic
1192425916 X:71076303-71076325 TCCTCTTGCTTCAGAGAAAAAGG - Intergenic
1198154796 X:133948271-133948293 TGCTGTGAGCTGACAGAAAAGGG + Intronic
1200211585 X:154349028-154349050 TGTTGTTGCCTGAGGCAAGAGGG + Exonic
1200767304 Y:7091058-7091080 TGCTGTTGCCTCAGAGGTAAAGG - Intronic
1200834599 Y:7721022-7721044 TGCTAATTCTTGAGAGAAAATGG + Intergenic
1201552507 Y:15233432-15233454 TACTGTAACCTGAGAGAAAGAGG + Intergenic