ID: 904517824

View in Genome Browser
Species Human (GRCh38)
Location 1:31070569-31070591
Sequence GTGGCGTGACCTCAGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904517822_904517824 -7 Left 904517822 1:31070553-31070575 CCCAGGCTAGAGTACAGTGGCGT 0: 100
1: 3234
2: 39206
3: 165066
4: 260425
Right 904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG No data
904517823_904517824 -8 Left 904517823 1:31070554-31070576 CCAGGCTAGAGTACAGTGGCGTG 0: 98
1: 3267
2: 37712
3: 136157
4: 208991
Right 904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG No data
904517820_904517824 6 Left 904517820 1:31070540-31070562 CCTCGCTCTGTCGCCCAGGCTAG 0: 11
1: 436
2: 2253
3: 5804
4: 6925
Right 904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG No data
904517818_904517824 12 Left 904517818 1:31070534-31070556 CCAGAGCCTCGCTCTGTCGCCCA 0: 2
1: 78
2: 351
3: 686
4: 1018
Right 904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904517824 Original CRISPR GTGGCGTGACCTCAGCCCCC TGG Intergenic
No off target data available for this crispr