ID: 904525077

View in Genome Browser
Species Human (GRCh38)
Location 1:31127452-31127474
Sequence AAGCTAATCACTTGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904525073_904525077 7 Left 904525073 1:31127422-31127444 CCAGACTCAAATGTTGAATTCCT No data
Right 904525077 1:31127452-31127474 AAGCTAATCACTTGGAAGCCAGG No data
904525072_904525077 12 Left 904525072 1:31127417-31127439 CCTAACCAGACTCAAATGTTGAA No data
Right 904525077 1:31127452-31127474 AAGCTAATCACTTGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904525077 Original CRISPR AAGCTAATCACTTGGAAGCC AGG Intergenic
No off target data available for this crispr