ID: 904527180

View in Genome Browser
Species Human (GRCh38)
Location 1:31142534-31142556
Sequence TCCCCACAGTTCCTCTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904527180_904527182 22 Left 904527180 1:31142534-31142556 CCTATCTAGAGGAACTGTGGGGA No data
Right 904527182 1:31142579-31142601 TTACTTGACTTTTGATCACAAGG No data
904527180_904527183 28 Left 904527180 1:31142534-31142556 CCTATCTAGAGGAACTGTGGGGA No data
Right 904527183 1:31142585-31142607 GACTTTTGATCACAAGGAAGTGG No data
904527180_904527184 29 Left 904527180 1:31142534-31142556 CCTATCTAGAGGAACTGTGGGGA No data
Right 904527184 1:31142586-31142608 ACTTTTGATCACAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904527180 Original CRISPR TCCCCACAGTTCCTCTAGAT AGG (reversed) Intergenic
No off target data available for this crispr