ID: 904527180 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:31142534-31142556 |
| Sequence | TCCCCACAGTTCCTCTAGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904527180_904527182 | 22 | Left | 904527180 | 1:31142534-31142556 | CCTATCTAGAGGAACTGTGGGGA | No data | ||
| Right | 904527182 | 1:31142579-31142601 | TTACTTGACTTTTGATCACAAGG | No data | ||||
| 904527180_904527183 | 28 | Left | 904527180 | 1:31142534-31142556 | CCTATCTAGAGGAACTGTGGGGA | No data | ||
| Right | 904527183 | 1:31142585-31142607 | GACTTTTGATCACAAGGAAGTGG | No data | ||||
| 904527180_904527184 | 29 | Left | 904527180 | 1:31142534-31142556 | CCTATCTAGAGGAACTGTGGGGA | No data | ||
| Right | 904527184 | 1:31142586-31142608 | ACTTTTGATCACAAGGAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904527180 | Original CRISPR | TCCCCACAGTTCCTCTAGAT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||