ID: 904528614

View in Genome Browser
Species Human (GRCh38)
Location 1:31154008-31154030
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904528614_904528621 17 Left 904528614 1:31154008-31154030 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 904528621 1:31154048-31154070 TCCTGAGTAGCTGGGATTAGAGG 0: 531
1: 60158
2: 150035
3: 235914
4: 200229
904528614_904528618 8 Left 904528614 1:31154008-31154030 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991
904528614_904528619 9 Left 904528614 1:31154008-31154030 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 904528619 1:31154040-31154062 TCTCAGCCTCCTGAGTAGCTGGG 0: 7228
1: 111845
2: 214076
3: 239146
4: 143572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904528614 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr