ID: 904528618

View in Genome Browser
Species Human (GRCh38)
Location 1:31154039-31154061
Sequence GTCTCAGCCTCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 687389
Summary {0: 5482, 1: 97792, 2: 202426, 3: 230698, 4: 150991}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904528611_904528618 29 Left 904528611 1:31153987-31154009 CCCAATCTCGGCTCATTGCAACC 0: 14
1: 350
2: 1918
3: 3858
4: 3358
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991
904528616_904528618 -1 Left 904528616 1:31154017-31154039 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991
904528614_904528618 8 Left 904528614 1:31154008-31154030 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991
904528615_904528618 5 Left 904528615 1:31154011-31154033 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991
904528612_904528618 28 Left 904528612 1:31153988-31154010 CCAATCTCGGCTCATTGCAACCT 0: 43
1: 825
2: 2622
3: 2657
4: 1652
Right 904528618 1:31154039-31154061 GTCTCAGCCTCCTGAGTAGCTGG 0: 5482
1: 97792
2: 202426
3: 230698
4: 150991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904528618 Original CRISPR GTCTCAGCCTCCTGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr