ID: 904528621

View in Genome Browser
Species Human (GRCh38)
Location 1:31154048-31154070
Sequence TCCTGAGTAGCTGGGATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 646867
Summary {0: 531, 1: 60158, 2: 150035, 3: 235914, 4: 200229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904528615_904528621 14 Left 904528615 1:31154011-31154033 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 904528621 1:31154048-31154070 TCCTGAGTAGCTGGGATTAGAGG 0: 531
1: 60158
2: 150035
3: 235914
4: 200229
904528616_904528621 8 Left 904528616 1:31154017-31154039 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 904528621 1:31154048-31154070 TCCTGAGTAGCTGGGATTAGAGG 0: 531
1: 60158
2: 150035
3: 235914
4: 200229
904528614_904528621 17 Left 904528614 1:31154008-31154030 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 904528621 1:31154048-31154070 TCCTGAGTAGCTGGGATTAGAGG 0: 531
1: 60158
2: 150035
3: 235914
4: 200229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904528621 Original CRISPR TCCTGAGTAGCTGGGATTAG AGG Intergenic
Too many off-targets to display for this crispr