ID: 904530657

View in Genome Browser
Species Human (GRCh38)
Location 1:31166671-31166693
Sequence AGGAGCGACCTCTCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904530657_904530671 22 Left 904530657 1:31166671-31166693 CCCACCCAGGAGAGGTCGCTCCT No data
Right 904530671 1:31166716-31166738 AGCCGTGCTGTTAACAGGGCTGG No data
904530657_904530668 17 Left 904530657 1:31166671-31166693 CCCACCCAGGAGAGGTCGCTCCT No data
Right 904530668 1:31166711-31166733 CCACCAGCCGTGCTGTTAACAGG No data
904530657_904530669 18 Left 904530657 1:31166671-31166693 CCCACCCAGGAGAGGTCGCTCCT No data
Right 904530669 1:31166712-31166734 CACCAGCCGTGCTGTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904530657 Original CRISPR AGGAGCGACCTCTCCTGGGT GGG (reversed) Intergenic