ID: 904532302

View in Genome Browser
Species Human (GRCh38)
Location 1:31177128-31177150
Sequence CGGGGTGGCCGCCGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904532302_904532315 13 Left 904532302 1:31177128-31177150 CCCTCTGCCCGGCGGCCACCCCG No data
Right 904532315 1:31177164-31177186 CCCAGCAGCTCATTGAGAACGGG 0: 75
1: 1470
2: 511
3: 95
4: 277
904532302_904532318 28 Left 904532302 1:31177128-31177150 CCCTCTGCCCGGCGGCCACCCCG No data
Right 904532318 1:31177179-31177201 AGAACGGGCCATGATGGCAATGG No data
904532302_904532317 22 Left 904532302 1:31177128-31177150 CCCTCTGCCCGGCGGCCACCCCG No data
Right 904532317 1:31177173-31177195 TCATTGAGAACGGGCCATGATGG 0: 8
1: 3
2: 0
3: 10
4: 63
904532302_904532313 12 Left 904532302 1:31177128-31177150 CCCTCTGCCCGGCGGCCACCCCG No data
Right 904532313 1:31177163-31177185 GCCCAGCAGCTCATTGAGAACGG 0: 37
1: 495
2: 1142
3: 422
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904532302 Original CRISPR CGGGGTGGCCGCCGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr