ID: 904533004

View in Genome Browser
Species Human (GRCh38)
Location 1:31181628-31181650
Sequence GCGAGCTCGGGCCAAGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904533004_904533014 11 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533014 1:31181662-31181684 TCAGCCCAGGGCGAGGCGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 269
904533004_904533015 12 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533015 1:31181663-31181685 CAGCCCAGGGCGAGGCGCCGGGG 0: 1
1: 0
2: 3
3: 47
4: 447
904533004_904533019 16 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533019 1:31181667-31181689 CCAGGGCGAGGCGCCGGGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 329
904533004_904533010 -2 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533010 1:31181649-31181671 GCGGCAGCTGCGGTCAGCCCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
904533004_904533021 22 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533021 1:31181673-31181695 CGAGGCGCCGGGGTGGGCGCGGG 0: 1
1: 0
2: 1
3: 46
4: 509
904533004_904533013 10 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533013 1:31181661-31181683 GTCAGCCCAGGGCGAGGCGCCGG 0: 1
1: 0
2: 1
3: 41
4: 233
904533004_904533011 -1 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533011 1:31181650-31181672 CGGCAGCTGCGGTCAGCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 135
904533004_904533020 21 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533020 1:31181672-31181694 GCGAGGCGCCGGGGTGGGCGCGG 0: 1
1: 0
2: 4
3: 58
4: 653
904533004_904533024 29 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533024 1:31181680-31181702 CCGGGGTGGGCGCGGGGCAGAGG 0: 1
1: 1
2: 7
3: 180
4: 3999
904533004_904533012 4 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533012 1:31181655-31181677 GCTGCGGTCAGCCCAGGGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 324
904533004_904533017 15 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533017 1:31181666-31181688 CCCAGGGCGAGGCGCCGGGGTGG 0: 1
1: 0
2: 5
3: 30
4: 385
904533004_904533022 23 Left 904533004 1:31181628-31181650 CCTGCGCCTTGGCCCGAGCTCGC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 904533022 1:31181674-31181696 GAGGCGCCGGGGTGGGCGCGGGG 0: 1
1: 0
2: 1
3: 57
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904533004 Original CRISPR GCGAGCTCGGGCCAAGGCGC AGG (reversed) Exonic