ID: 904537303

View in Genome Browser
Species Human (GRCh38)
Location 1:31208347-31208369
Sequence GAACACAAGTTTCCATAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904537303_904537308 17 Left 904537303 1:31208347-31208369 CCCGCTTATGGAAACTTGTGTTC 0: 1
1: 0
2: 2
3: 6
4: 144
Right 904537308 1:31208387-31208409 TGCTGCAGCTTTCTCATTCCCGG 0: 1
1: 0
2: 2
3: 23
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904537303 Original CRISPR GAACACAAGTTTCCATAAGC GGG (reversed) Intronic
902124449 1:14196814-14196836 AAAGACTAGTTTCCAAAAGCTGG + Intergenic
904537303 1:31208347-31208369 GAACACAAGTTTCCATAAGCGGG - Intronic
906911823 1:49960390-49960412 GAACAGAAGTTACTATACGCTGG + Intronic
909062506 1:70895349-70895371 AAAGACAAGTTTCCTCAAGCTGG - Intronic
909164846 1:72206949-72206971 GAAGACAAATTTACATAAGAAGG + Intronic
909462557 1:75934669-75934691 GAACACTTTTTTCCAAAAGCAGG - Intergenic
911229411 1:95344862-95344884 GATCACAGGATTCCATAATCTGG - Intergenic
917239786 1:172935430-172935452 CAACTCAAGTGTCCATCAGCTGG - Intergenic
918133028 1:181645740-181645762 GATCACAAGTTTCAAAGAGCTGG + Intronic
918358445 1:183729716-183729738 CAACACAAATGTCCATCAGCAGG + Intronic
919090511 1:192973463-192973485 GAACACAAATGTCCATTAACTGG - Intergenic
919144831 1:193620925-193620947 CAACACAAGTGTCCATGAACAGG + Intergenic
920122143 1:203666716-203666738 GAAGAGAAGTTTCCATAACAGGG - Intronic
921568005 1:216743920-216743942 GAGCAAAAGTTTCCGTAAGCAGG - Intronic
922550507 1:226490918-226490940 GACCAGAAGTTTCCATGAGAGGG + Intergenic
923060485 1:230467712-230467734 TAACACAATTGTCCATCAGCAGG - Intergenic
924015090 1:239712513-239712535 GAACAGAAGTCTCTGTAAGCTGG + Intronic
924229564 1:241952152-241952174 GGACAGAAGTTTCCAGGAGCTGG - Intergenic
924232651 1:241975441-241975463 GGACACAAGTTTCCATATTTCGG + Intergenic
1064247269 10:13679071-13679093 GAACAGAAGTTTCTAGAGGCTGG - Intronic
1067479538 10:46585894-46585916 GAGCACTAGTTTCCTTAACCAGG - Intronic
1067615199 10:47755904-47755926 GAGCACTAGTTTCCTTAACCAGG + Intergenic
1068801283 10:61143375-61143397 GAATTCAATTTTCCCTAAGCTGG - Intergenic
1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG + Intronic
1071630601 10:87215855-87215877 GAGCACTAGTTTCCTTAACCAGG + Intergenic
1076007772 10:126961742-126961764 TAACCCAAGTTTCCATCAACAGG - Intronic
1078746506 11:14120503-14120525 AGACAGAAGTTTCCAGAAGCAGG - Intronic
1080703001 11:34660739-34660761 GAAGACATGTATCCATAAGAAGG + Intronic
1081680011 11:44995479-44995501 GAACACAGGCTTCCTTATGCTGG - Intergenic
1086138636 11:83469262-83469284 GAGCACAAGTTTATAGAAGCCGG - Exonic
1087527464 11:99335330-99335352 GAACTTATGTTTTCATAAGCAGG - Intronic
1089876213 11:121724110-121724132 GAAAACAAGTTTAGAGAAGCTGG - Intergenic
1091107014 11:132932126-132932148 GAATAGTAGTTTCCAGAAGCTGG + Intronic
1091126938 11:133108888-133108910 GAATACGTGTTTCCATATGCAGG + Intronic
1097344952 12:58480851-58480873 AAAACCAAGTTTTCATAAGCAGG - Intergenic
1097860225 12:64511555-64511577 GGAGGCCAGTTTCCATAAGCAGG - Intergenic
1108645993 13:52429103-52429125 GGATACAAGGTTCCATAAACTGG - Intronic
1108809678 13:54206279-54206301 GAATACAAATTCCCATAAGTAGG + Intergenic
1108894115 13:55301496-55301518 GTCCTCAAGTTTTCATAAGCAGG + Intergenic
1111071859 13:83179825-83179847 AAACACAAGAATCCAAAAGCAGG - Intergenic
1117321343 14:54626591-54626613 TAGTACAAGTTTCCAAAAGCAGG - Intronic
1117439302 14:55745131-55745153 TAACACAAGTTCCCACAAACAGG + Intergenic
1118106164 14:62662284-62662306 CAACATAAGTGTCCATCAGCAGG + Intergenic
1119091455 14:71785350-71785372 GAACACCAGTGTCCAAGAGCAGG - Intergenic
1120430920 14:84413572-84413594 TAACCCAAGTGTCCATCAGCAGG - Intergenic
1122877673 14:104676449-104676471 AAACACAAGGTTCAACAAGCGGG - Intergenic
1127245844 15:57173524-57173546 GAACACAAATTACCAGAATCTGG + Intronic
1130730440 15:86486781-86486803 AGACCCAAGTGTCCATAAGCAGG - Intronic
1135489983 16:22900713-22900735 AAAAACAAGTTTCAACAAGCAGG + Intronic
1139053637 16:63155666-63155688 GAATACAGTTTTCCAAAAGCGGG - Intergenic
1143063908 17:4228080-4228102 GAACACAAATGTCCATCAACAGG + Intronic
1146971357 17:37074986-37075008 CAACACAAATTTCCAAAATCAGG - Intergenic
1147318656 17:39633083-39633105 GGAGACAAGTTTCCAAAAGATGG - Intronic
1148513330 17:48192239-48192261 GAAAACACGATCCCATAAGCTGG + Intronic
1148515370 17:48211908-48211930 ACACACAAGTGTCCTTAAGCAGG - Intronic
1148521544 17:48280897-48280919 GAACCCAAGTATCCATCAACTGG - Intronic
1153103517 18:1501166-1501188 AAAGACAAGTTTCAATAAGGAGG + Intergenic
1153712729 18:7816195-7816217 GAACACAAGTTTCCAGTACTTGG - Intronic
1153731499 18:8017692-8017714 GAAAACAAGTTCCCAGGAGCAGG + Intronic
1154124525 18:11678495-11678517 GGACACTGGTTTCCATAACCTGG - Intergenic
1155077736 18:22375751-22375773 GACTACAAGTTTCCAAAATCAGG + Intergenic
1155531466 18:26771202-26771224 AGACACCAGTTCCCATAAGCAGG - Intergenic
1155611495 18:27672660-27672682 CCACAAAAGTTTCCATCAGCAGG + Intergenic
1158605958 18:58896371-58896393 GAAGAGAAGTTACCACAAGCAGG - Intronic
1158760935 18:60385752-60385774 CAACATAGGTTTCCATGAGCAGG + Intergenic
1159999385 18:75002252-75002274 GACCACAAGTTTCTAAATGCAGG + Intronic
1161878581 19:6931095-6931117 GAACAGCAGTTACCAGAAGCTGG - Intronic
1163122401 19:15225878-15225900 GAGCAGAAGTTTCCAGGAGCTGG + Intergenic
1163823326 19:19508830-19508852 GAATAGAAGTTCCAATAAGCAGG + Exonic
930309463 2:49720349-49720371 TATCACCAGTTTCTATAAGCAGG - Intergenic
930910678 2:56625841-56625863 GAACACTTGCTTCCATAATCTGG + Intergenic
931669272 2:64632036-64632058 GAAAACAATTGTACATAAGCAGG + Exonic
931902871 2:66808821-66808843 GAACACATTTTTCTATAATCTGG - Intergenic
935043274 2:99455005-99455027 GAGCAAAACTTTCTATAAGCTGG - Intronic
937041689 2:118826461-118826483 GTTAACAAGTTTCAATAAGCAGG + Intergenic
938320708 2:130360487-130360509 GAACACAAATTACCAAAATCAGG - Intronic
941079011 2:161038812-161038834 GAAACCAAGTTCACATAAGCTGG + Intergenic
942163860 2:173221763-173221785 GATCACAAATTTCTATAATCAGG - Intronic
943620788 2:190145371-190145393 GAACACAAGTATCCAGCAGTAGG - Intronic
943768186 2:191685631-191685653 GAACACCAGTTTTCACATGCTGG + Exonic
946511719 2:220365270-220365292 GCATACCAGTTTCCATAAGATGG + Intergenic
947927841 2:233937285-233937307 CAATACCAGTTTCCATAAGCAGG + Intronic
1169480982 20:5980301-5980323 GAACATAAGCTTCCAAGAGCAGG + Intronic
1169873640 20:10273095-10273117 GAACAAAAGTTCCCAGAGGCAGG - Intronic
1170652314 20:18253924-18253946 GAACCCAAGTGTCCATCAGTAGG + Intergenic
1177279929 21:18967889-18967911 GAACATAATTTTCCAAAAGATGG + Intergenic
1177795688 21:25776566-25776588 TAACACAAATATCCATCAGCAGG + Intergenic
1184241722 22:43214505-43214527 GACCACAGGCTTCTATAAGCGGG - Intronic
949691159 3:6641134-6641156 GAACTCAAGTTGTCACAAGCAGG + Intergenic
952387664 3:32854437-32854459 AAACTCAGGTTTCCATGAGCTGG - Intronic
955866402 3:63388878-63388900 CAACACAAATTCCCATAAACAGG + Intronic
960423726 3:117480750-117480772 GAACACAAGTCTCCCTAAATGGG - Intergenic
961072704 3:123949938-123949960 AACCACAAGTTTCTCTAAGCAGG + Intronic
964277876 3:155026837-155026859 AAACACAAATGTCCAGAAGCAGG + Intronic
964283569 3:155093488-155093510 CAACACATTTTTCCAGAAGCAGG - Intronic
964904690 3:161706138-161706160 GAAAACAAGAATCCAGAAGCAGG - Intergenic
964928366 3:161984149-161984171 GAACAGAGGTTTACATAAGGTGG + Intergenic
966799608 3:183750326-183750348 CAACGCAAGTGTCCATCAGCAGG - Intronic
966811024 3:183844758-183844780 TCACATATGTTTCCATAAGCTGG - Intronic
967006110 3:185384112-185384134 GAACAATAGTTACCAGAAGCTGG - Intronic
973112713 4:46415144-46415166 GAACACAAGTTTTCATCAATAGG + Intronic
973342075 4:49016031-49016053 GAAAACAAGTTTCCATGAGCAGG - Intronic
974209267 4:58748728-58748750 ATACACAAGTTTCCATAAGCTGG - Intergenic
974688687 4:65267135-65267157 GAACATAAGTTTATATAAACAGG - Intergenic
975025100 4:69538659-69538681 GAACAAAAATTTCCATACACTGG - Intergenic
975170798 4:71229900-71229922 GAACACATGTTGCCAAAAGATGG + Intronic
977756647 4:100679600-100679622 GACCAAAAGTTGCCAAAAGCTGG + Intronic
978408274 4:108401942-108401964 GAACACAATCTGCCATAAACGGG - Intergenic
985798109 5:1979747-1979769 GAACCCAAATATCCATCAGCGGG + Intergenic
986651704 5:9970690-9970712 CAACATAAGTGTCCATCAGCAGG + Intergenic
987622137 5:20347889-20347911 GAAAGCAAGTTTCCAGAAACAGG - Intronic
989000508 5:36755527-36755549 GAACAAAGGTTTCTAGAAGCAGG + Intergenic
989067002 5:37473894-37473916 AAACATATGTTTCCAAAAGCTGG - Intronic
989283532 5:39672490-39672512 AAACCAAAGTTTCCAAAAGCTGG - Intergenic
990115516 5:52385623-52385645 GAACACAAGCTTCCACACCCTGG + Intergenic
991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG + Intronic
991577247 5:68117518-68117540 CAACACAAATATCCATCAGCAGG + Intergenic
992805526 5:80333320-80333342 GAACCCAAATGTCCATCAGCAGG - Intergenic
996486665 5:124042819-124042841 GAACACAGTTTTTCATGAGCTGG - Intergenic
998249466 5:140542055-140542077 GAACACAAGTTGAAATAAGTGGG - Intronic
999512852 5:152270826-152270848 GAAGACAATTTTCCCCAAGCAGG - Intergenic
1000503470 5:162082678-162082700 GAACACAAATTTCTATAATCTGG + Intronic
1004952122 6:20685013-20685035 GAACACAAGAATCAATAAACTGG - Intronic
1007939917 6:45770833-45770855 CAACCCAAATATCCATAAGCAGG + Intergenic
1012325602 6:97912231-97912253 CAACACAAATGTCCATCAGCTGG + Intergenic
1012690493 6:102305377-102305399 GAAAACTAGTATCCATATGCAGG + Intergenic
1017867228 6:158454542-158454564 AAAATAAAGTTTCCATAAGCAGG - Intronic
1018184241 6:161252054-161252076 GAACACTAAGTTCCATAAGTGGG + Intronic
1023770393 7:43551684-43551706 GAACACAAGCCTTCATGAGCGGG - Intronic
1023931163 7:44707504-44707526 GAACACCAGTTTCCCTTTGCTGG + Intronic
1026563672 7:71471864-71471886 TAACCCAAATTTCCCTAAGCAGG + Intronic
1026937479 7:74266669-74266691 TAAGACAAGTTTCTAAAAGCGGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028249151 7:88520095-88520117 GAACACAAAATTCCATTTGCTGG + Intergenic
1028500942 7:91518452-91518474 GAACACAAGATTCCATGATAAGG - Intergenic
1032881202 7:136092382-136092404 GAAAATACATTTCCATAAGCAGG + Intergenic
1034857380 7:154564356-154564378 GATCAAATGTATCCATAAGCAGG + Intronic
1036389042 8:8308621-8308643 GGACACTAGCTTTCATAAGCAGG + Intergenic
1038204044 8:25447756-25447778 CAACCCAAGTGTCCATAAGCAGG + Intronic
1040032097 8:42834229-42834251 CAACACCAGTTACCATCAGCTGG + Intergenic
1046040495 8:108897575-108897597 TAACACAATTTACCATAAACTGG + Intergenic
1046258039 8:111726554-111726576 TAACACAAATTTCCATCAGTGGG - Intergenic
1048489270 8:134877367-134877389 CAACCCAAGTGTCCATCAGCAGG + Intergenic
1051257060 9:15224752-15224774 AAACACAAAATTCCATGAGCAGG + Intronic
1053318213 9:37071028-37071050 GAATACAAGTGCCCATGAGCAGG + Intergenic
1055804726 9:80079766-80079788 GAACACAAGTTTCATGAAGGTGG - Intergenic
1056653965 9:88494310-88494332 TAACCCAAATTTCCATAAGCTGG + Intergenic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1185851445 X:3492614-3492636 GAACACAAGTTTTCAAGAGAGGG + Intergenic
1195673963 X:107492787-107492809 GAACACTAGTCTTCATAAGAGGG - Intergenic
1196784082 X:119407162-119407184 GAAGCCAAGTTTCCAGAAGAAGG - Intronic
1198016884 X:132620470-132620492 GAAATCAAGTTACCAGAAGCTGG + Intergenic
1200091484 X:153638156-153638178 GGCCACAAGTCTCCATCAGCTGG + Intergenic