ID: 904541719

View in Genome Browser
Species Human (GRCh38)
Location 1:31238341-31238363
Sequence CATGCTGGACTCCTTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904541719_904541730 18 Left 904541719 1:31238341-31238363 CCCAGAACAAGGAGTCCAGCATG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 904541730 1:31238382-31238404 CGCTGCCCACTCTCAGACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
904541719_904541729 17 Left 904541719 1:31238341-31238363 CCCAGAACAAGGAGTCCAGCATG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 904541729 1:31238381-31238403 TCGCTGCCCACTCTCAGACCTGG 0: 1
1: 1
2: 1
3: 8
4: 104
904541719_904541732 23 Left 904541719 1:31238341-31238363 CCCAGAACAAGGAGTCCAGCATG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 904541732 1:31238387-31238409 CCCACTCTCAGACCTGGGTTCGG 0: 1
1: 1
2: 4
3: 21
4: 201
904541719_904541734 29 Left 904541719 1:31238341-31238363 CCCAGAACAAGGAGTCCAGCATG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 904541734 1:31238393-31238415 CTCAGACCTGGGTTCGGCGATGG 0: 1
1: 0
2: 0
3: 4
4: 81
904541719_904541726 -10 Left 904541719 1:31238341-31238363 CCCAGAACAAGGAGTCCAGCATG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 904541726 1:31238354-31238376 GTCCAGCATGAGGGGGGCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904541719 Original CRISPR CATGCTGGACTCCTTGTTCT GGG (reversed) Intronic
902370746 1:16005408-16005430 CATGTTGGACTCTGTGTTCCTGG + Intronic
904192555 1:28758172-28758194 CATGCTGGTCTCCAACTTCTAGG - Intronic
904541719 1:31238341-31238363 CATGCTGGACTCCTTGTTCTGGG - Intronic
906972375 1:50529597-50529619 CATGCTGGGTTCTTTCTTCTGGG - Intronic
907325965 1:53638737-53638759 CCTGCCCCACTCCTTGTTCTGGG - Intronic
910879260 1:91907745-91907767 CATGCTGAAGTCTTTGTTTTTGG - Intergenic
911860703 1:102944458-102944480 CATGCTGGAGTTGTTGTCCTTGG + Intronic
913363906 1:118014310-118014332 CATGCTTGAATCCAGGTTCTTGG + Intronic
915029147 1:152861160-152861182 CATGCAGGTCTCCTTGATCTAGG - Intergenic
915454760 1:156032793-156032815 CATGCTTCATTCCTTGCTCTTGG + Intergenic
916156487 1:161854819-161854841 CAGGCTGGACTGCGTGATCTCGG - Intronic
918418268 1:184335114-184335136 CAGGCAGGACTGCTTGTTTTTGG - Intergenic
919535329 1:198780135-198780157 CCAGCAGGACCCCTTGTTCTTGG - Intergenic
920249378 1:204613122-204613144 CACGCTAGCCTCCTTGCTCTTGG + Intergenic
920972752 1:210756737-210756759 CATGCTGATCCACTTGTTCTTGG + Intronic
922019939 1:221693562-221693584 CCTTTTGGAATCCTTGTTCTTGG + Intergenic
922064471 1:222123815-222123837 CATGCTGGACTCAAACTTCTGGG - Intergenic
923312868 1:232753081-232753103 CATGCTGGTCTCATACTTCTAGG + Intergenic
1062777103 10:160805-160827 CATGCTCGACTTCTAATTCTAGG + Intronic
1064055279 10:12092032-12092054 CATGCTGGAGTACGTGATCTCGG + Intronic
1064399077 10:15005697-15005719 CATGCTGGATTTTTTGTTTTTGG - Intergenic
1064896749 10:20245807-20245829 CCAGCTGTTCTCCTTGTTCTAGG + Intronic
1067677647 10:48398698-48398720 CATGCTGGAGTCCTTTTACTAGG - Intronic
1068120817 10:52780533-52780555 GATTCTGGTCTCCTCGTTCTGGG + Intergenic
1070708113 10:78656502-78656524 CATGCTGCCCTCCTTTGTCTGGG + Intergenic
1071557865 10:86619791-86619813 CATGATGGGCTCCTTTTTCCTGG + Intergenic
1073065584 10:100757267-100757289 AAGGCTGGACACCTTGTACTTGG + Intronic
1073127886 10:101163280-101163302 CATGCTGGACTTGATCTTCTGGG - Intergenic
1075412246 10:122237131-122237153 CATGCTGGACTCCAAGGCCTCGG + Intronic
1075718549 10:124571506-124571528 CATCCTGGACACCTTGTGCAGGG - Intronic
1077293779 11:1814553-1814575 CATGTTGCAATCCTAGTTCTCGG - Intergenic
1077661432 11:4071969-4071991 TTTGCTGGGCCCCTTGTTCTTGG + Intronic
1078715284 11:13833935-13833957 AATGCAGGACTCCTTGCCCTAGG + Intergenic
1080088866 11:28319831-28319853 CATGCTACACTCCTTTTTCCAGG - Intronic
1081709055 11:45205382-45205404 CACGCTGGACCCATGGTTCTGGG - Intronic
1081884454 11:46483105-46483127 GATGCTGGGCTCCTTCTTCATGG + Intronic
1084124156 11:67087861-67087883 CAGGCTGGAGTGCTTGATCTTGG - Intergenic
1084716752 11:70879039-70879061 CTTGGTGGACTCCTTGGTCAGGG + Intronic
1089149399 11:116353139-116353161 CCTGCAGGCCTCCTTGCTCTCGG - Intergenic
1089646027 11:119879675-119879697 CATGATGAAATCTTTGTTCTTGG + Intergenic
1091924867 12:4337650-4337672 CTTGCTGGACTTTTTTTTCTAGG - Intronic
1092072192 12:5640372-5640394 CATGCTCCACACCTTGTTCTAGG + Intronic
1095332210 12:40980220-40980242 CAGGCTGGTCTCCAAGTTCTGGG - Intronic
1097131051 12:56810844-56810866 CATGATGGGGTTCTTGTTCTGGG + Intergenic
1101217149 12:102596031-102596053 CAAGCTGAACTCCTTGGTCAGGG + Intergenic
1101793680 12:107953619-107953641 CATTCTGGGGCCCTTGTTCTAGG - Intergenic
1102206539 12:111094706-111094728 CAGGCTGGTCTCCTACTTCTGGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102588594 12:113940586-113940608 GTTGCTGCACTCCTTGTCCTTGG + Intronic
1105967380 13:25397078-25397100 CTTGCTGGACATCCTGTTCTAGG + Intronic
1106882187 13:34143697-34143719 CATGCTTCTCTCCTAGTTCTAGG - Intergenic
1107424257 13:40276940-40276962 CATGCTGGCCTCAAGGTTCTCGG + Intergenic
1108019764 13:46115202-46115224 CCTGCTAGAATACTTGTTCTTGG - Intergenic
1108084577 13:46772733-46772755 CATGCTGGAGTGCATGATCTTGG + Intronic
1109472351 13:62825625-62825647 GATGCTGGAGTCCTTATTTTTGG - Intergenic
1112806417 13:103167863-103167885 CCTGCTTGTCACCTTGTTCTTGG + Intergenic
1114316848 14:21517276-21517298 CATGCTGGACTCCAACTCCTTGG - Intergenic
1114502531 14:23181728-23181750 CGTCCTGCACTCCTTTTTCTGGG + Intronic
1114528476 14:23380677-23380699 CATGCTGGGCTCCTCGGGCTGGG - Intergenic
1116712018 14:48380556-48380578 CATGGTGGACTTCTTATTTTAGG + Intergenic
1117041079 14:51769618-51769640 CATGCTGGATTTTTTGTTTTTGG - Intergenic
1122171194 14:99877113-99877135 CATGCTGGCCCCCCTGGTCTCGG - Intronic
1122885456 14:104708532-104708554 CATGGTGGGCTCCTTGGGCTTGG - Exonic
1123538997 15:21268608-21268630 CATGCTGGTCCCCTTGTGGTGGG - Intergenic
1124178225 15:27447286-27447308 CATGCTCGACTCCTTTCCCTGGG - Intronic
1125830370 15:42711613-42711635 CATGAAGGACCCCTTGTTGTGGG - Intronic
1126459297 15:48898084-48898106 CATGCTGTTCTCATTGTTCTAGG + Intronic
1129207857 15:74047907-74047929 CATGGTTGACCCCTTGATCTTGG - Intergenic
1129795685 15:78374459-78374481 GATGGTGTCCTCCTTGTTCTTGG - Intergenic
1130857783 15:87856607-87856629 CATGGTGGGCTTCTTGTGCTGGG - Intergenic
1130916144 15:88306253-88306275 CACCCAGGACTCCCTGTTCTGGG + Intergenic
1130937998 15:88486370-88486392 CAGGCTGGACTCGAAGTTCTGGG - Intergenic
1131677126 15:94682069-94682091 CATGCTTGACTCCTTTCTCAGGG - Intergenic
1133139193 16:3731836-3731858 CATGCTGGGCTTCTTCTTGTTGG + Exonic
1133277534 16:4647881-4647903 CATGCTGGGCACCTGGCTCTGGG + Intronic
1136534055 16:30888823-30888845 AAGGCTGGACTCCTGGGTCTTGG - Intronic
1137071180 16:35906194-35906216 CATGTTGGCCTCCTTGATGTAGG + Intergenic
1137321165 16:47384029-47384051 CATGATGGACTCCTAGTCATGGG + Intronic
1137848759 16:51717096-51717118 TTTTCTGTACTCCTTGTTCTGGG + Intergenic
1138583365 16:57955807-57955829 CATGCTGCTCTCCTTGCTCCTGG - Intronic
1138764895 16:59590639-59590661 GATTCTGGACTCCATCTTCTAGG + Intergenic
1140426031 16:74862233-74862255 AATGCTGGACTCTATGTTGTTGG + Intergenic
1140882963 16:79215530-79215552 CATGCTGGCCTCCTGCTTCCTGG + Intergenic
1142585100 17:967251-967273 CATGCCGGACTCCTGCTGCTGGG + Intronic
1143953182 17:10649580-10649602 CATTTTGGAGTCCTTCTTCTTGG + Exonic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146666603 17:34709199-34709221 CAAGCTGGCCTCTTTGTTCCTGG + Intergenic
1147706498 17:42428875-42428897 CATCCTGGTGTCCTTTTTCTGGG - Intergenic
1149200550 17:54181090-54181112 CATGCTGGAGGCCTGGTCCTGGG + Intergenic
1150432549 17:65129916-65129938 CATGCTGGACTCCAACTCCTGGG - Intergenic
1151967877 17:77441083-77441105 TGTGCTGGGCTCCTGGTTCTGGG + Intronic
1152793783 17:82296653-82296675 CTTTCTGGTCTCCTGGTTCTGGG + Intergenic
1153634569 18:7102696-7102718 CATGCTTGACTCCTAGCACTGGG + Intronic
1157026889 18:43855457-43855479 CCTCCTGGAATCCTTGTGCTGGG + Intergenic
1159233964 18:65646924-65646946 CATGCTGGACTCACATTTCTAGG - Intergenic
1160280116 18:77481837-77481859 CATTGTGGACTTTTTGTTCTAGG + Intergenic
1161725827 19:5928055-5928077 ATTGCTGGACTCATTTTTCTGGG + Exonic
1163713781 19:18862506-18862528 CAGAATGGACACCTTGTTCTCGG - Intronic
1167581182 19:50343905-50343927 CAGGCTGGTCTCCATGTCCTGGG - Intronic
925320499 2:2962781-2962803 CAGGCTGGATTTATTGTTCTGGG + Intergenic
925626353 2:5845462-5845484 CTTGTTGGACCTCTTGTTCTCGG - Intergenic
928754846 2:34511609-34511631 CTTGCTGTGCTCCTTATTCTAGG + Intergenic
929928137 2:46231944-46231966 GAAGCTGGTCTTCTTGTTCTGGG + Intergenic
932351028 2:71032067-71032089 CATGCTGGATTTTTTGTTTTTGG + Intergenic
934122647 2:88855154-88855176 TATGCTCAACTCCTTGCTCTTGG - Intergenic
935381183 2:102452621-102452643 CAGGCTGGAATGCATGTTCTTGG + Intergenic
938832156 2:135062069-135062091 CAGGCTGGAGTGCTTGATCTTGG + Intronic
939586800 2:144015535-144015557 CATGCTGGGCTCTCTGTTATTGG + Intronic
940259746 2:151767203-151767225 CATGCTGGACTCCAACTCCTGGG - Intergenic
941396246 2:164977283-164977305 CATGCTGGTCCCCTTGTGGTGGG - Intergenic
941618670 2:167752913-167752935 CATGCAGCACTCATTGTGCTTGG + Intergenic
942186914 2:173432896-173432918 CATGCTGTACACCTTGTGATTGG - Intergenic
943575992 2:189631950-189631972 CTTGATGGTATCCTTGTTCTAGG - Intergenic
944270314 2:197776488-197776510 AATGCTGAACTCCTCTTTCTAGG - Intronic
947072963 2:226311456-226311478 CTCACTGGACTCCCTGTTCTTGG - Intergenic
947500533 2:230667922-230667944 CAGGCTGGGCAACTTGTTCTGGG + Intergenic
947614727 2:231548518-231548540 AATGGTGGACTCCATGCTCTTGG - Intergenic
1168758309 20:331035-331057 CATGCTGGACTCCTGATGCATGG - Intergenic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1170277262 20:14605289-14605311 CATGCTGGTCCCCTTGCTCCTGG + Intronic
1170494755 20:16914391-16914413 CTTGCAGGACACCTTGTTCTAGG - Intergenic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1173256171 20:41395599-41395621 GGTGGTGGACTCCTTGTCCTTGG + Intergenic
1175186717 20:57183849-57183871 CATGAAGGGCTGCTTGTTCTGGG + Exonic
1176516529 21:7788554-7788576 CAGGCTGGACTCAATCTTCTGGG + Intergenic
1178650557 21:34418566-34418588 CAGGCTGGACTCAATCTTCTGGG + Intergenic
1183666894 22:39251204-39251226 CATGCTGGACTCCAACTCCTGGG - Intergenic
1185085418 22:48738179-48738201 CATGCTGGGCTCCCCGTGCTCGG - Intronic
949885628 3:8691296-8691318 CATGCTGGATTTTTTGTTTTTGG + Intronic
950220479 3:11191631-11191653 CATGCTGGCCCCCAGGTTCTGGG - Intronic
951322439 3:21262006-21262028 CATGTAGCACTCCTTGTTCAGGG + Intergenic
952423997 3:33156445-33156467 CATTCTGGTCTCCTAGTTGTGGG - Intronic
954611607 3:51947333-51947355 CCTGGTGGACCCCTTGCTCTTGG - Intronic
954974530 3:54680626-54680648 GCTGCTGGACTCATTGTTGTTGG + Intronic
955402169 3:58600113-58600135 CCTTCTGGATTCCTTCTTCTGGG + Intronic
959502908 3:107127133-107127155 CCATCTGGACTCCTGGTTCTTGG - Intergenic
960853617 3:122080445-122080467 CATGCTATGCTCCTTCTTCTAGG + Intronic
965167230 3:165210623-165210645 CACACTGTACTCCTTTTTCTGGG + Intergenic
966192276 3:177282058-177282080 CCTGCTGGCTTCCTTGTTGTGGG + Intergenic
967341014 3:188398039-188398061 AATGGTGCACTCCTTGTTCTTGG - Intronic
968527139 4:1066131-1066153 CAGGCTGGACTCCATCTCCTTGG + Intronic
971213613 4:24643318-24643340 CATGCTGGACTTATTTTACTTGG + Intergenic
971775124 4:30953473-30953495 CATGCTGAATTGCTTGTTTTAGG - Intronic
972830550 4:42809676-42809698 CATACTGCACTCCGTGTGCTGGG + Intergenic
974355886 4:60812252-60812274 CAAGATGGGCTCCTTGATCTTGG - Intergenic
980030461 4:127823357-127823379 CAGGCTGGTCTCTTAGTTCTGGG + Intronic
982036934 4:151355009-151355031 CAGGCTGGTCTCCTACTTCTGGG - Intergenic
984944624 4:184961432-184961454 CTTGCTGGACTCCCTTTTCTTGG - Intergenic
986218441 5:5743925-5743947 CATCCTGGCCTCCAAGTTCTTGG - Intergenic
987839548 5:23205712-23205734 CATGCAGTACTTCTTGGTCTTGG + Intergenic
991650370 5:68846586-68846608 CATGCTGGGATGCTGGTTCTTGG - Intergenic
992406737 5:76465670-76465692 CATGATGGACTCATTGTGGTGGG - Intronic
992774509 5:80077848-80077870 CATTCTGGAGTCCTTGTACTGGG - Intronic
1008765537 6:54909272-54909294 CTTGCTGGTCTTCTGGTTCTAGG - Intronic
1011711970 6:90064454-90064476 CATGATGGGCTGCTTGCTCTAGG + Intronic
1013991187 6:116255453-116255475 CATTCTGGACACATTGTCCTTGG - Intronic
1014486553 6:122006193-122006215 AATTCTTGACTCCTTTTTCTGGG + Intergenic
1017110262 6:150925371-150925393 AATGCTGGACTCTTTCCTCTGGG - Intronic
1018160221 6:161034025-161034047 CATGTGGTACTCCTTGTTCATGG + Intronic
1019461446 7:1160865-1160887 CAGGCTGGTCTCCATGTCCTGGG - Intergenic
1022558576 7:31325616-31325638 CATCTTGTACTCCTTGTTCTTGG + Intergenic
1029421794 7:100475834-100475856 CACCCTGGACTCTCTGTTCTTGG - Intronic
1034681408 7:152931238-152931260 CATGCTGGGCTCTTTTTCCTAGG - Intergenic
1040108640 8:43555321-43555343 CCTTCTGTACTCCTTGTTCAAGG + Intergenic
1041211391 8:55554730-55554752 CACTGTGGACTCCTTGATCTTGG + Intergenic
1042086612 8:65115909-65115931 CAACTTGGAATCCTTGTTCTTGG + Intergenic
1044529220 8:93289189-93289211 CATTTTGGACTTCTTCTTCTAGG + Intergenic
1044783651 8:95771514-95771536 CATCCTGGACCCCTGGCTCTAGG + Intergenic
1045846100 8:106638131-106638153 GAGGCTGGACTTCTTTTTCTTGG - Intronic
1046847289 8:118932009-118932031 TAGGCTGGACTCCTTTTTGTGGG - Intronic
1046991478 8:120461393-120461415 GCTGCTGGACTCCTTATTTTTGG + Intronic
1047249067 8:123167848-123167870 GTTGCTGGAGTCCTGGTTCTGGG - Intergenic
1049613768 8:143567611-143567633 CCTGCTGGACTCCCTGTTCCAGG - Exonic
1050567361 9:6900293-6900315 CCTTCTGGACTCATTTTTCTAGG + Intronic
1052651373 9:31307096-31307118 TATGCTGCACTCCTGGATCTGGG + Intergenic
1052799789 9:32956472-32956494 CCTGCTGGTCTCCGTGCTCTTGG + Intergenic
1053404177 9:37856740-37856762 CAGGCTGGACTCCTAATTCCTGG - Intronic
1054770015 9:69074961-69074983 CATGATGTACTCCTTTATCTGGG + Intronic
1055599452 9:77900601-77900623 CAGGCTGGACTCCAATTTCTAGG + Intronic
1056916274 9:90749070-90749092 CATGCTGGATTTTTTGTTTTTGG - Intergenic
1203784142 EBV:117738-117760 CAGGCTGGACGTCTTGTCCTTGG - Intergenic
1185619110 X:1442603-1442625 CCTGCTGGCCTCTTTGTTCCTGG - Intronic
1186276036 X:7939084-7939106 GATGCTGGACTCCATGGTCCTGG - Intergenic
1187807693 X:23139187-23139209 CCTGCTGGGCACCTTGATCTTGG - Intergenic
1189553283 X:42115063-42115085 CATGCCGGGCCCTTTGTTCTAGG + Intergenic
1198712828 X:139524062-139524084 CAGGCAGGCCTCCTTGATCTGGG - Intergenic
1200922558 Y:8626344-8626366 CTAGCTGCACTCCTTGTTGTTGG + Intergenic
1201334327 Y:12863960-12863982 CATGCTGGTCTCCAACTTCTGGG - Intergenic
1201707881 Y:16956847-16956869 CAGGCTGTAGTCCTTTTTCTGGG - Intergenic