ID: 904541736

View in Genome Browser
Species Human (GRCh38)
Location 1:31238399-31238421
Sequence GGACCTCCATCGCCGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904541736_904541738 -2 Left 904541736 1:31238399-31238421 CCTGGGTTCGGCGATGGAGGTCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 904541738 1:31238420-31238442 CCCCATGCACCTCTGCCTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904541736 Original CRISPR GGACCTCCATCGCCGAACCC AGG (reversed) Intronic
902732909 1:18381496-18381518 CGACCTCCTTCTCAGAACCCTGG + Intergenic
903178353 1:21593461-21593483 GGACCTCCATGGCCAACCCTGGG - Intergenic
904541736 1:31238399-31238421 GGACCTCCATCGCCGAACCCAGG - Intronic
915557037 1:156666570-156666592 AGACCTCTGTCCCCGAACCCTGG + Intergenic
918040889 1:180913155-180913177 GGACTTCCAGCCCCGAATCCGGG - Intronic
918114315 1:181483778-181483800 GAGTCTCCATCGCCGGACCCTGG - Exonic
918128049 1:181601643-181601665 TGACCTCCAGCGCTGCACCCTGG + Intronic
921484851 1:215703649-215703671 GGACATCCCTCCCCGAACCAAGG + Intronic
921908354 1:220519740-220519762 GGCCCTCCAGCCCTGAACCCAGG - Intergenic
1063157624 10:3394954-3394976 GGACCTCAATCCCCCAACCCTGG - Intergenic
1064782878 10:18862144-18862166 AGACCTCCATCGCCAGCCCCAGG - Intergenic
1075016022 10:118910495-118910517 GGACCTCCATTTCTGGACCCAGG - Intergenic
1076683409 10:132186569-132186591 TGCCCTCCAGCGCGGAACCCAGG - Intergenic
1083203813 11:61135390-61135412 GGCCCTACATCCCTGAACCCTGG - Intronic
1084599496 11:70136439-70136461 GCACCTCCCTCGCCTCACCCTGG + Intronic
1089834153 11:121355569-121355591 CGAGCTCCATCCCCGAACCTCGG + Intergenic
1090306112 11:125692737-125692759 GGACCTTCAGCGCCAAAGCCAGG + Intergenic
1090381202 11:126328745-126328767 GGAGCTCCACTGCCCAACCCAGG + Intronic
1107940358 13:45377232-45377254 GGACCCCCATGGCGGATCCCAGG - Intergenic
1121436960 14:93926754-93926776 GGCCCTCCATCCCCGATCCCTGG + Intronic
1133732596 16:8589829-8589851 GCACCCGCATCGCCGAGCCCAGG + Exonic
1136037314 16:27549999-27550021 GGAACTCCTCCTCCGAACCCTGG - Intergenic
1138458189 16:57133165-57133187 GGACCTCCAGCCCCCAAACCTGG + Intronic
1141748188 16:85940161-85940183 AGACCTCCATGTCCTAACCCCGG - Intergenic
1143587385 17:7857027-7857049 GGAACTCCTGCGCCGAGCCCAGG + Exonic
1148129285 17:45253355-45253377 GGGCCTCCAAGGCCAAACCCTGG + Intergenic
1151747451 17:76018997-76019019 GGACCTGCAGCGGCGAAGCCGGG - Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
936769596 2:115895320-115895342 GGAACTCCATCCCCTAACCAAGG - Intergenic
939653895 2:144798673-144798695 TGACCTCCATCGTAGAAACCTGG - Intergenic
946366187 2:219250535-219250557 CGACCGCCATCGCCGAGGCCTGG - Exonic
1175531654 20:59677320-59677342 GGATCTCCACCACTGAACCCTGG + Intronic
1178085100 21:29104556-29104578 GAACCTCCTTTGCCGAAGCCGGG + Intronic
1178147953 21:29761272-29761294 GGACTTCCAGCTCAGAACCCAGG + Intronic
1178915677 21:36704586-36704608 GGACCTGGATCCCTGAACCCCGG + Intronic
1180083690 21:45497996-45498018 GGTCCTCCAGTGCCGACCCCCGG - Intronic
1184337140 22:43860590-43860612 GGACTTCCAACTCCGAAGCCAGG + Intronic
1184748307 22:46469399-46469421 GGTCCTCCATCGAGGGACCCAGG - Intronic
955769114 3:62371987-62372009 CGGCCCCCCTCGCCGAACCCTGG + Intronic
965501552 3:169462057-169462079 GGCTCTCAATCGCCAAACCCTGG + Intronic
965707776 3:171526311-171526333 CATCCTCCATCCCCGAACCCAGG - Intergenic
967328638 3:188267845-188267867 AGACCTCCATCCCTAAACCCGGG + Intronic
985723447 5:1502590-1502612 GGACCTCCATCCTCAGACCCTGG - Intronic
1001362740 5:171103837-171103859 GGACCTCCGTCGCCTAGCCAAGG - Intronic
1002322531 5:178384283-178384305 GGGCCTCCGTCGCCGGATCCAGG - Intronic
1003902950 6:10672083-10672105 GGCCTTCCATCTCCGAACCCTGG + Intronic
1025032836 7:55571900-55571922 GGACCACCCCCGCCCAACCCCGG + Intronic
1027790324 7:82633299-82633321 GGAACTCCATCTCCCAGCCCAGG + Intergenic
1034418118 7:150975807-150975829 GGACCTGCAGCTCCAAACCCTGG + Intronic
1035468238 7:159093681-159093703 GGTCTCCCATCTCCGAACCCAGG - Intronic
1036672564 8:10801850-10801872 GAACCTCCATCGCTGACCACGGG + Intronic
1047114530 8:121826033-121826055 TGACCTCCATCACCCTACCCTGG + Intergenic
1057024209 9:91723626-91723648 GGGCTTCTATCCCCGAACCCCGG + Exonic
1060979795 9:127785622-127785644 GGAGCTCCCTGGCCGGACCCGGG - Intergenic
1193359340 X:80561702-80561724 CCACCTCCCTAGCCGAACCCTGG + Intergenic
1198495449 X:137187584-137187606 GGACCTTCTTCGCAGATCCCAGG - Intergenic