ID: 904541935

View in Genome Browser
Species Human (GRCh38)
Location 1:31239367-31239389
Sequence GCGTGTGCCCGGGCGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 1, 3: 69, 4: 597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904541935_904541945 26 Left 904541935 1:31239367-31239389 CCACCCCCCGCCCGGGCACACGC 0: 1
1: 0
2: 1
3: 69
4: 597
Right 904541945 1:31239416-31239438 CAACCCCACCCGCACGCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 172
904541935_904541944 25 Left 904541935 1:31239367-31239389 CCACCCCCCGCCCGGGCACACGC 0: 1
1: 0
2: 1
3: 69
4: 597
Right 904541944 1:31239415-31239437 GCAACCCCACCCGCACGCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904541935 Original CRISPR GCGTGTGCCCGGGCGGGGGG TGG (reversed) Intronic
900113729 1:1020061-1020083 GCGGGCGGGCGGGCGGGGGGGGG - Intergenic
900113936 1:1020688-1020710 GCCTTTGCCCGGGCGGGGAGCGG + Intronic
900180430 1:1308751-1308773 ACGTGGGCCCGGGCGGAGGCGGG + Intronic
900222871 1:1518650-1518672 GTGTGTACCCGTGCGGGGGGTGG - Intronic
900289818 1:1919101-1919123 GGGTGAGCCCGGGAGGGGCGTGG + Intronic
900435490 1:2628902-2628924 AGGTGAGCCCGGGCGGCGGGAGG + Intronic
900514204 1:3073644-3073666 GCGTGGGCCGGGTCGGGGAGCGG + Intronic
900609294 1:3537718-3537740 GCGTGTGCCCAGGGCAGGGGTGG - Intronic
900623692 1:3598720-3598742 GAGTGGGCCCCGGGGGGGGGGGG - Intronic
900629288 1:3625155-3625177 GCGGCGGCCCGGGCGGGGGGCGG + Exonic
901025782 1:6278069-6278091 GCGTCTGCAGTGGCGGGGGGTGG + Intronic
901086360 1:6614251-6614273 GCGCGGGCCCGAGCAGGGGGCGG - Intronic
901262859 1:7886165-7886187 GAGTCTCCCCGGGAGGGGGGAGG + Intergenic
901521805 1:9791047-9791069 GCGTGAACCCGGGAGGCGGGAGG + Intronic
901526082 1:9824081-9824103 GCGCGGGCCCGGGAGGGGCGGGG + Exonic
901641623 1:10695581-10695603 GCGTGGGGCGGGGGGGGGGGGGG - Intronic
901700774 1:11043901-11043923 GGCTCTGCCGGGGCGGGGGGCGG + Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902350065 1:15847793-15847815 GCATGCGCCCGGGCAGGGGCGGG - Intergenic
902414769 1:16232188-16232210 GAGTGTGCCGGGGCGGCGGCTGG - Exonic
903192495 1:21664496-21664518 GCGTGGGCAAGGGCTGGGGGTGG - Intronic
903263615 1:22143660-22143682 GGGAGGGGCCGGGCGGGGGGCGG - Intronic
903349955 1:22711341-22711363 GCGGCTGCCCGAGCCGGGGGCGG - Intronic
903628222 1:24745974-24745996 CCCGGCGCCCGGGCGGGGGGTGG - Intronic
903907564 1:26697070-26697092 GCGTAGGCCGGGGCGGGCGGGGG - Exonic
904160435 1:28518642-28518664 GCGGCCGCCCGGGCGGGGGATGG + Intronic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
904813774 1:33180958-33180980 AGGTGGGGCCGGGCGGGGGGTGG - Intronic
905308348 1:37033944-37033966 CCGTGCGCCCGGGAGGGGGCGGG - Intronic
905775508 1:40665259-40665281 GAGTGTGCAGGGGCGGGGGTGGG - Intronic
906038112 1:42766008-42766030 GTGTGTGTGGGGGCGGGGGGGGG - Intronic
906535840 1:46550519-46550541 GCCTGGGCGGGGGCGGGGGGTGG + Intronic
906641872 1:47445803-47445825 GCGTGGGCCGGGGTGGGGGTGGG - Intergenic
907052816 1:51341183-51341205 GTGTGTGTGTGGGCGGGGGGTGG - Intronic
907280200 1:53342214-53342236 GAGTGAGCTCCGGCGGGGGGTGG + Intergenic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
908477661 1:64505588-64505610 GGGTGTGCCCAGGGAGGGGGAGG - Intronic
911852443 1:102836424-102836446 GCTTGTGGCAGGGTGGGGGGAGG + Intergenic
912411607 1:109484126-109484148 GCGGGGGCCCGGAAGGGGGGAGG - Intronic
912435184 1:109656590-109656612 GCGTGCGCCGGGGTGGGGGGGGG + Intronic
912717091 1:111990283-111990305 GCGTCTCCCCGGGCGAGTGGAGG + Intergenic
914231370 1:145766780-145766802 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
914788020 1:150851201-150851223 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
915740987 1:158118236-158118258 GCGTGTGTTGGGGCTGGGGGTGG - Intergenic
917375554 1:174349031-174349053 GCGGCTGGCCGGGCGGGGGGGGG + Intronic
918265610 1:182839274-182839296 GCGCGTGCCAGGGCGGGGGATGG - Intergenic
920075668 1:203334691-203334713 GTCTGTGCCAGGGCGGGGTGGGG + Intergenic
920222209 1:204412039-204412061 GCATCAGCCGGGGCGGGGGGGGG + Intergenic
920230439 1:204466466-204466488 GGGTGTGCATGGGCGGCGGGGGG + Intronic
920912525 1:210232505-210232527 GCGTGTCCCCGGGCACCGGGAGG + Intergenic
922518139 1:226223526-226223548 GCGTCTGGCGGGGCCGGGGGCGG + Intergenic
922526501 1:226308689-226308711 GCCTGTCCCGGGGCCGGGGGAGG - Intronic
922705437 1:227788075-227788097 GGGTGTGGCCAGGCGGGGGCGGG + Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923126685 1:231039993-231040015 GCGGGGGCCCGGGCGGCGGCGGG - Exonic
923505306 1:234600246-234600268 GCGCGACCCCGGGCGGGGCGGGG - Intergenic
923631158 1:235650106-235650128 GCGCGGGCCCGGGCTGGGGCGGG - Intronic
924736489 1:246761565-246761587 GCGGTTGCCGGGGCTGGGGGAGG - Intronic
1064011870 10:11742323-11742345 GGGCGTGCCGGGGCGGGGAGGGG + Intergenic
1064011880 10:11742343-11742365 GGGCGTGCCGGGGCGGGGCGGGG + Intergenic
1064354333 10:14604116-14604138 GCGGGCGGCCGGGCGGGTGGGGG - Intronic
1065836250 10:29660876-29660898 GCCTGTGCCTGGGCCGGGTGTGG + Intronic
1065883857 10:30059605-30059627 GGGCGGGCCCGGGCGGTGGGCGG - Intronic
1066126470 10:32347209-32347231 GCGGGCACGCGGGCGGGGGGAGG + Intronic
1067096531 10:43305045-43305067 GCGGGGGCGGGGGCGGGGGGCGG - Intergenic
1067111914 10:43407401-43407423 GCGTGTGTCCCGGCGGAGGGTGG - Intronic
1067733222 10:48828918-48828940 GTGTGTGGGCGGGGGGGGGGCGG + Intronic
1069828560 10:71269008-71269030 ACGTGTGACCGTGCGGGGGCTGG + Intronic
1070162546 10:73874655-73874677 GCCGGGGGCCGGGCGGGGGGGGG - Intergenic
1070304898 10:75234308-75234330 GGAGGTGCCCGGGCGGGAGGCGG + Intronic
1070328769 10:75403837-75403859 GTCTGTGCCCGCGTGGGGGGCGG + Intergenic
1070524823 10:77286757-77286779 GTGTGTGTGCGGGGGGGGGGGGG + Intronic
1070524825 10:77286759-77286781 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1070800721 10:79243159-79243181 GCGTGTGCCCGCGTGGGGCTGGG - Intronic
1072453867 10:95560071-95560093 GCGGGGGGCTGGGCGGGGGGGGG + Intronic
1072547184 10:96448757-96448779 GAGTGTGCTTGGCCGGGGGGAGG + Intronic
1072637235 10:97185843-97185865 GCCTGTGCGCGGACGGAGGGAGG + Exonic
1073121864 10:101126815-101126837 GCCAGGGCCCGGGCTGGGGGAGG - Intronic
1073206204 10:101770740-101770762 GCGGGTGCCCAGGCAGGGGGTGG - Intronic
1073432123 10:103493761-103493783 GAGACTGCCGGGGCGGGGGGCGG + Intergenic
1073868210 10:107829779-107829801 GTGTGTGTCGGGGCGGGGAGGGG + Intergenic
1074618379 10:115093132-115093154 GCGCGCGCGAGGGCGGGGGGCGG + Intergenic
1074995692 10:118755228-118755250 ACGTGAGGCCGGGCAGGGGGCGG - Exonic
1075877890 10:125823066-125823088 GCGGGCACCCGGTCGGGGGGCGG + Exonic
1076120587 10:127934009-127934031 GTGTGTGCGCGGGGGGTGGGGGG - Intronic
1076156605 10:128210355-128210377 GCGCCTTCCCGGGCGGGGCGGGG + Intergenic
1076206693 10:128609766-128609788 GTGAGTGCCTGGGCAGGGGGAGG - Intergenic
1076659769 10:132047867-132047889 GCGGGGGGCGGGGCGGGGGGTGG - Intergenic
1076710632 10:132331966-132331988 GCGCCTGCCCGGGAGGGGGCGGG - Intergenic
1076792917 10:132786248-132786270 GGGGGCGCGCGGGCGGGGGGGGG - Intergenic
1077080309 11:722048-722070 GCAGGTGCCGGGGCGGGGCGGGG - Intronic
1077081510 11:726506-726528 GCTGGGGCCCGGGCGAGGGGTGG + Intronic
1077103027 11:830519-830541 GAGTGGGCCCGGGCGGAGCGGGG - Intronic
1077230692 11:1457062-1457084 GCCTGTGCTGGGGCGGGGAGGGG + Intronic
1077250444 11:1558453-1558475 CCCTGGGCCCGTGCGGGGGGTGG + Intronic
1077408823 11:2394210-2394232 GCCTGTGCCTGGGCCGGGGAGGG + Intronic
1077541768 11:3149912-3149934 GTGTGTGCCTGGGAAGGGGGTGG - Intronic
1077550136 11:3196563-3196585 CCCTGGGCCCGGGCAGGGGGAGG + Intergenic
1078180085 11:9004058-9004080 GCCAGTGCGCGCGCGGGGGGCGG + Intergenic
1078699729 11:13668934-13668956 GGGCGTACCCGGGCGGGGGCGGG - Intronic
1079076748 11:17389215-17389237 GCGAGCGCCCGGGCGGCGGGAGG - Intronic
1079489031 11:20966839-20966861 GTGTGTGTCGGGGCAGGGGGCGG - Intronic
1080935261 11:36856835-36856857 GTGTGTGCGGGGGGGGGGGGTGG - Intergenic
1081488147 11:43547525-43547547 GCGTGTGCTCGGGGGTGGGGCGG - Intergenic
1081831477 11:46119888-46119910 GCGGGGGCGCGGGCGGGGGAGGG + Intronic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083180550 11:60982103-60982125 GCAGATGCCCGGGTGGGGGGCGG + Intronic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1083663490 11:64262821-64262843 GCCTGTGCCTGGGCGGGTGCAGG - Intronic
1083710783 11:64546980-64547002 GCGTGTGCTTCGGCGGGTGGAGG + Intergenic
1083775724 11:64893569-64893591 GACTGTGCCCGGGCAGGGTGGGG + Intergenic
1083883090 11:65557987-65558009 GGGCGCGCCCGGGCGGGGCGAGG + Exonic
1084318855 11:68362240-68362262 GTGTTTGCCGGGGCTGGGGGCGG + Intronic
1084653537 11:70502494-70502516 GGGTGGGCCTGGGCAGGGGGAGG + Intronic
1084665378 11:70573536-70573558 GTGTGTGTGGGGGCGGGGGGGGG + Intronic
1085076809 11:73598483-73598505 GTGTGTGTGTGGGCGGGGGGAGG - Intergenic
1085321551 11:75577322-75577344 GCGGGGGCGGGGGCGGGGGGGGG - Intergenic
1088648444 11:111937118-111937140 GCTGCGGCCCGGGCGGGGGGGGG + Intronic
1089482777 11:118820613-118820635 CCCTGTGCCAGGGCGGGGGAGGG + Intergenic
1090224629 11:125062827-125062849 TCGTGGGCGGGGGCGGGGGGGGG - Intergenic
1091206434 11:133824459-133824481 TCCTGTGCCCGGGGGGGGGGCGG - Intergenic
1091434010 12:459895-459917 ACCTGTGCCCGGGGCGGGGGCGG + Intergenic
1092214594 12:6672278-6672300 GTGTGTGTCCGGGGCGGGGGTGG + Intronic
1093581793 12:20791880-20791902 ATGTGTGTGCGGGCGGGGGGGGG - Intergenic
1093698123 12:22186043-22186065 GTGTGTGGGTGGGCGGGGGGAGG - Intronic
1095692845 12:45110218-45110240 GTGTGTGCGCGCACGGGGGGTGG - Intergenic
1096178740 12:49539318-49539340 GCGCGGGGCCCGGCGGGGGGCGG + Exonic
1096676863 12:53230775-53230797 GGGTGTGCCGGGGTGTGGGGGGG + Intronic
1097127987 12:56789485-56789507 GCGGCTGGCCGGGCGGGGGGGGG + Intergenic
1097218237 12:57430756-57430778 CCGTGGGCCCGGGCGGCGGGCGG - Exonic
1098350679 12:69556000-69556022 GTGTGTGGCGGGGGGGGGGGCGG + Intronic
1099026445 12:77469965-77469987 GTGTGTGCAGGGGCGGGTGGGGG + Intergenic
1099576970 12:84393948-84393970 GCGTGTTCCGGGGGGGGGGGGGG - Intergenic
1100254883 12:92872868-92872890 GCTTGAACCCGGGAGGGGGGAGG + Intronic
1100439132 12:94599559-94599581 GTGTGTGTGTGGGCGGGGGGGGG - Intronic
1100613340 12:96210544-96210566 GCGTGCGCCCGCGCGCAGGGCGG - Intronic
1101106841 12:101448849-101448871 GCATGTGGCGGGGCGGGTGGGGG + Intergenic
1101504057 12:105330647-105330669 GCGGGTCCCCGGGCGGGGCGGGG + Exonic
1101750844 12:107581309-107581331 GCGCGGGGGCGGGCGGGGGGCGG + Intronic
1102323394 12:111957582-111957604 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1102865523 12:116371069-116371091 GAGTGAGCCCGGGCTGGGGCTGG - Intergenic
1103008513 12:117439887-117439909 GCGTCTGCCCAGGAGGAGGGTGG + Intronic
1103120115 12:118372971-118372993 GCGTGGTCCGGGGCAGGGGGCGG - Intergenic
1103282459 12:119771343-119771365 GCGTGAGCTCTGGAGGGGGGTGG + Intronic
1103698458 12:122835346-122835368 GCGTTTGCGGGCGCGGGGGGCGG + Intronic
1104833416 12:131770855-131770877 GTGGGTGCCAGGGCTGGGGGAGG - Intronic
1104918336 12:132277980-132278002 GAGGGGGCCGGGGCGGGGGGAGG - Intronic
1104977759 12:132559932-132559954 GCGGGAGCGCGGGCGGGGCGGGG - Intronic
1104987531 12:132605245-132605267 GCGTGTGTGTGGGTGGGGGGTGG - Intronic
1105015888 12:132786662-132786684 GCATGTGCCCGGGGGAGGTGCGG - Intronic
1105559458 13:21476957-21476979 GCCAGTGCCTGGGCGGGTGGCGG + Intergenic
1105964525 13:25372316-25372338 GGGTGGGCCCGGGGCGGGGGCGG + Intronic
1106032173 13:26013283-26013305 GCGTGTGCACGTGATGGGGGTGG - Intronic
1106157302 13:27171210-27171232 GCCTGTGCCGGGGTGAGGGGTGG - Intronic
1106735664 13:32586259-32586281 GCGTGCGCGCGGACGGGGCGGGG + Intergenic
1113680603 13:112241473-112241495 GAGTGTGCTGGGGCCGGGGGTGG - Intergenic
1113906256 13:113820663-113820685 CCGTGGGCCCGGGCGCGGGGAGG - Exonic
1113946088 13:114044429-114044451 GAGTGAGGCGGGGCGGGGGGGGG - Intronic
1114460454 14:22883169-22883191 GTGTGTGTCGGGGGGGGGGGTGG + Exonic
1114677511 14:24453617-24453639 GCGGCAGCCCGGGCTGGGGGAGG - Intergenic
1115436032 14:33374691-33374713 GGGTGTGTCGGGGCGGGGGGGGG + Intronic
1116886956 14:50231381-50231403 GCCTCGGCCCGGGCGGGAGGCGG - Exonic
1117895863 14:60485861-60485883 GCGTGTGCGTGGGTGGGAGGGGG - Intronic
1118366753 14:65102717-65102739 GCGCGTCCCGGGGAGGGGGGGGG + Intergenic
1120406521 14:84099487-84099509 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1120406544 14:84099533-84099555 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1120953047 14:90060490-90060512 CTGTGTGCGCGGGCGGGGGCGGG + Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121148444 14:91607071-91607093 GTGTGTGTGTGGGCGGGGGGGGG + Intronic
1121148448 14:91607075-91607097 GTGTGTGGGCGGGGGGGGGGGGG + Intronic
1121342873 14:93115657-93115679 GCGAGGACCCGGGCGGGAGGAGG - Intronic
1121408194 14:93732193-93732215 GCGTGTCTCCGTGCAGGGGGTGG + Intronic
1121616991 14:95319925-95319947 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1122265795 14:100546347-100546369 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265804 14:100546364-100546386 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265813 14:100546381-100546403 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265822 14:100546398-100546420 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265831 14:100546415-100546437 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265840 14:100546432-100546454 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265849 14:100546449-100546471 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122265858 14:100546466-100546488 GCGAGGGCCGGGGCGGGGCGAGG - Intronic
1122323529 14:100869225-100869247 GCCTGGGCCAGGGCTGGGGGTGG + Intergenic
1122323716 14:100870267-100870289 GCCTGGGCCAGGGCTGGGGGTGG + Intergenic
1122550159 14:102545065-102545087 CCGGCTCCCCGGGCGGGGGGTGG + Intergenic
1122620743 14:103056659-103056681 GCGAGGGCCCGGCGGGGGGGAGG + Intronic
1122825486 14:104368546-104368568 GCAGGTGCCCAGGCGGTGGGAGG - Intergenic
1122878128 14:104678133-104678155 ACGTGTGCCGGGGCGGAGTGCGG + Intergenic
1122975052 14:105167627-105167649 GCGCGCGCCCAGGCGGGGCGGGG - Intronic
1123014214 14:105365873-105365895 GCGTGTGCCCCGGCGAGTTGTGG + Intronic
1123034562 14:105466632-105466654 GCGGGTGCCCGGGCGGGGACGGG - Intronic
1123035505 14:105470242-105470264 CCGTGTGGGCGGGCGAGGGGCGG - Exonic
1202847807 14_GL000009v2_random:197177-197199 GGGTGTGCTGGGGCGGGAGGGGG + Intergenic
1202917281 14_GL000194v1_random:187717-187739 GGGTGTGCTGGGGCGGGAGGGGG + Intergenic
1123425611 15:20168388-20168410 GCGGGTCCCCGGGCGGGATGGGG - Intergenic
1123534838 15:21174915-21174937 GCGGGTCCCCGGGCGGGATGGGG - Intergenic
1124340602 15:28887002-28887024 CGGTGTGCCCAGGCGGGGAGGGG + Intronic
1124652236 15:31482670-31482692 GCTTGAGCCGGGGCTGGGGGAGG + Exonic
1124995775 15:34721939-34721961 CCGAGTGCTGGGGCGGGGGGGGG - Intergenic
1127354732 15:58187458-58187480 GTGTGTGTCAGGGCTGGGGGTGG + Intronic
1127644687 15:60947023-60947045 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1127674836 15:61228997-61229019 GCGGGAGCCCGGGCGCGGAGCGG - Intronic
1128267612 15:66280368-66280390 GTGTGTACCCGGGGGGAGGGGGG - Intergenic
1128605382 15:69033066-69033088 GCGCGGGCGTGGGCGGGGGGCGG - Exonic
1129082344 15:73052294-73052316 GCGGGGGCGGGGGCGGGGGGCGG - Intronic
1129330876 15:74826546-74826568 GGGCGGGCCCGGGCGGGGGCGGG + Exonic
1129808366 15:78483865-78483887 GCTTGAGCCCGGGAGGGGGGAGG - Intronic
1130115592 15:81002079-81002101 GCGGGAGCCCGGGCGGCGCGGGG - Exonic
1131060374 15:89400412-89400434 GCGTAGTCCCAGGCGGGGGGCGG - Intergenic
1131186039 15:90275053-90275075 GCGCGGGCCCGGGCGGCGGCTGG - Exonic
1131828752 15:96341156-96341178 GCGAGGGCGGGGGCGGGGGGCGG + Intergenic
1132482222 16:172478-172500 GCGCGTGCCAGGCCGGGGCGGGG + Intergenic
1132483070 16:176282-176304 GCGCGTGCCAGGCCGGGGCGGGG + Intergenic
1132575249 16:661008-661030 GCCTGAGGCCGGGCCGGGGGGGG - Intronic
1132576260 16:665809-665831 GGGAGTGCCCGGGCCGGGGGCGG + Intronic
1132577760 16:671813-671835 GTGTGTGCCGGGGAGGGGGCGGG - Intronic
1132585995 16:705958-705980 GCGGGGGCCGGGGCGGGGCGGGG - Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1132666980 16:1085728-1085750 GCAGGTGCCGGGGCTGGGGGTGG - Intergenic
1132880205 16:2158756-2158778 GCGTGGGCTCGGCGGGGGGGGGG + Intronic
1133049000 16:3106274-3106296 CCGGGCGCCCGGGCGGGGGTTGG + Intergenic
1133073790 16:3264287-3264309 CAGTGTGCCCGGACGCGGGGAGG + Intronic
1133156400 16:3879963-3879985 GCGAGGGCCCGGACGGGGGTCGG + Exonic
1133950518 16:10387835-10387857 GTGTGTGTCCGGGTGGCGGGGGG - Intronic
1134290780 16:12901798-12901820 GCGCCCGGCCGGGCGGGGGGAGG - Exonic
1134656079 16:15949515-15949537 GCGGGCGCCGGGGCGGGGCGGGG + Intergenic
1134784235 16:16926275-16926297 GTGTCTGCCCCGGCGGGGGCAGG - Intergenic
1136057889 16:27704123-27704145 CTGTGTGCCAGGGAGGGGGGGGG - Intronic
1136365377 16:29806910-29806932 GCGGCGGCCCGGGCTGGGGGGGG + Intronic
1136540008 16:30923814-30923836 GGGTGCGCGCGGGCTGGGGGGGG + Intronic
1136683651 16:31981952-31981974 GCGGGAGCCCGGGCTGGCGGCGG + Intergenic
1136784278 16:32925512-32925534 GCGGGAGCCCGGGCCGGCGGCGG + Intergenic
1136858633 16:33681129-33681151 GCGGGTCCCGGGGCCGGGGGTGG + Intergenic
1136885506 16:33928294-33928316 GCGGGAGCCCGGGCCGGCGGCGG - Intergenic
1137623789 16:49894722-49894744 GAGGGTGCCAGGGCTGGGGGAGG + Intergenic
1137792039 16:51183350-51183372 GGGTGTTCCCGGGCTGGGGATGG + Intergenic
1138160399 16:54747790-54747812 GCTTGTGGCGGGGGGGGGGGGGG - Intergenic
1138467192 16:57200938-57200960 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
1138546299 16:57721891-57721913 GCGTGTGGCAGGAAGGGGGGAGG - Intronic
1138619035 16:58197573-58197595 GGGGGTGGCCGGGCGGGGGCAGG + Intronic
1139510267 16:67424153-67424175 GCCTGTGCAGGGGCGGGAGGGGG - Intergenic
1140616368 16:76669124-76669146 TTGTGTGCCCAGGCTGGGGGTGG - Intergenic
1141452886 16:84117288-84117310 GCAGGTGCCCGGCCGGGGGTGGG - Intergenic
1141628984 16:85276703-85276725 GCGTGGGCCAGGGCAGGGGCCGG + Intergenic
1141633628 16:85302449-85302471 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
1141972315 16:87492389-87492411 GCGGGCGCCGGGGCGGGGGCGGG + Intergenic
1141989565 16:87602424-87602446 GCGGGGGCGGGGGCGGGGGGCGG + Intronic
1142156305 16:88534226-88534248 GGGCGTGGCCGGGCGGCGGGGGG - Exonic
1142231831 16:88903646-88903668 GGGTGTTCCCGGCTGGGGGGGGG + Intronic
1142293250 16:89202061-89202083 GCGTCCGCGCGGGCGGGGCGAGG + Intergenic
1142299442 16:89247791-89247813 GCGTCCGCGCGGGCGGGGCGAGG + Intergenic
1203120203 16_KI270728v1_random:1529623-1529645 GCGGGTCCCAGGGCCGGGGGTGG + Intergenic
1142656754 17:1399745-1399767 GCGAGTCCCGGGGCGGGGGAGGG - Intronic
1142671904 17:1491451-1491473 GCGTGGACCCGTGCGGGGGGGGG - Intronic
1142757434 17:2024491-2024513 GCGTGTGCCCGCGCAGGGAATGG + Intronic
1142758562 17:2029906-2029928 GCTCGTGCCCGGCCGGGGAGAGG + Intergenic
1143027839 17:3951544-3951566 GGGTGGGACCGGGCGGGGGGCGG - Intronic
1143176873 17:4960434-4960456 GAGTGTCCCTGGGCTGGGGGAGG - Intronic
1143183528 17:4998020-4998042 CCGGGTGCCCGGGCGGCGGGCGG - Exonic
1143746943 17:9002121-9002143 GTGTGTGTGGGGGCGGGGGGCGG - Intergenic
1144656822 17:17042410-17042432 GCGGGCGGCCGGGCGCGGGGAGG - Intergenic
1144696195 17:17305399-17305421 ACGTGTGTGGGGGCGGGGGGGGG - Intronic
1144851169 17:18244710-18244732 GTGTGTGTCCGGCGGGGGGGGGG + Exonic
1145862985 17:28224288-28224310 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1146398550 17:32486943-32486965 GCGGGCGGCCGAGCGGGGGGCGG + Exonic
1147144569 17:38477659-38477681 GCGGGAGCCCGGGCCGGCGGCGG + Exonic
1147274271 17:39301916-39301938 AAGTGTGCGTGGGCGGGGGGAGG - Intronic
1147742999 17:42679300-42679322 GCGCGGGGCAGGGCGGGGGGTGG + Exonic
1147865062 17:43546389-43546411 CGGTGTGGCGGGGCGGGGGGTGG - Exonic
1148331659 17:46817369-46817391 GCCTTGGCCTGGGCGGGGGGAGG - Intronic
1148366292 17:47057993-47058015 GCCTGTAGCCGGGGGGGGGGAGG + Intergenic
1148481627 17:47963353-47963375 GCGTGAGCCCGGGAGGTGGAGGG - Intergenic
1148558224 17:48591199-48591221 GGGTGTGCCCGGGATGGGAGAGG + Intronic
1149575125 17:57706473-57706495 GCGTGTGTGGGGGCGGGGGGCGG + Intergenic
1149679345 17:58494235-58494257 GCGTGAACCCGGGAGGGCGGAGG + Intronic
1149863352 17:60136695-60136717 GTGTGTGTCGGGGGGGGGGGGGG - Intergenic
1150217204 17:63477350-63477372 GCCCGGGCCCGGGCGGGGGCGGG + Intergenic
1150228770 17:63538547-63538569 GCGTGTCCCCAGGCGGCGCGTGG - Exonic
1150326662 17:64263273-64263295 GCGTGTGCCCGGGGGCGGGCGGG - Intronic
1150402992 17:64874482-64874504 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1150488912 17:65561345-65561367 GCGTGGGCGCGGGGGGCGGGAGG - Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151388487 17:73770109-73770131 GCGTGTGCTGGGGAGAGGGGAGG - Intergenic
1151392756 17:73798694-73798716 GCTTTTGGCCGGGGGGGGGGGGG + Intergenic
1151828268 17:76535623-76535645 GCCTGGGCCTGGGCTGGGGGAGG - Intronic
1152072463 17:78140692-78140714 GCGTGGCCTCGGGCGGGGCGTGG + Intronic
1152107995 17:78341970-78341992 GCGGGTCCGCGGGCGGGGTGGGG + Intergenic
1152185630 17:78854912-78854934 GCATGTGGGCGGGGGGGGGGGGG + Exonic
1152215023 17:79027068-79027090 CCCTGTTCCTGGGCGGGGGGGGG + Intronic
1152349698 17:79777932-79777954 GCGGGGCCCCGGGCGGGGGCGGG - Intergenic
1152354596 17:79800687-79800709 GCGTGTGTTGGGGCGGGGGATGG + Intronic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152729230 17:81961538-81961560 GCGCCTGCCGGGGTGGGGGGCGG + Intronic
1152861148 17:82697800-82697822 GCGGGTTCCAGGGCGAGGGGAGG - Intronic
1152867961 17:82735529-82735551 GCGTGACCCCGGGCGGCGGGAGG - Intergenic
1154954578 18:21242078-21242100 GCGCGAGGCGGGGCGGGGGGAGG + Intergenic
1155954226 18:31943313-31943335 GCGGGGGCGGGGGCGGGGGGAGG + Intronic
1156171721 18:34493928-34493950 GCGCCTCCCCGGGCGGCGGGCGG + Intronic
1157162260 18:45324750-45324772 GTGTGTGCGGGGGTGGGGGGCGG - Intronic
1157184623 18:45528173-45528195 GTGTGTGTGCGGGGGGGGGGGGG + Intronic
1157184625 18:45528175-45528197 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1157473700 18:48008339-48008361 GCGGGGGCCAGGGCTGGGGGTGG + Intergenic
1157682733 18:49619575-49619597 GCCAGTGCCAGGGCAGGGGGTGG + Intergenic
1157849103 18:51030646-51030668 GCGCGGGCCCGGCCGGGGGAAGG - Intronic
1158954030 18:62523215-62523237 TCGTCTTCCCGGGCTGGGGGCGG - Exonic
1159790821 18:72777333-72777355 GCTTGAACCCGGGAGGGGGGAGG + Intronic
1160125749 18:76169774-76169796 GCATGTGCCCAGGTGGAGGGAGG + Intergenic
1160412299 18:78683353-78683375 GAGTGTGTCCGGACGGGGGGTGG - Intergenic
1160675865 19:390944-390966 GCGGGGGCCGGGGCGGGGGCCGG - Intergenic
1160710448 19:548857-548879 GAGAGTGCGGGGGCGGGGGGCGG - Intronic
1160725023 19:614043-614065 GCGGGTGCCCTGGCGGGGGAGGG + Intronic
1160739633 19:680002-680024 GCGCGGGCCGGGGCGGGGGGGGG - Intronic
1160739725 19:680232-680254 GCGTGGGGCCGGGCGCGGGAGGG - Intronic
1160788428 19:912314-912336 GCGTGGGCCAGGGCAGTGGGGGG + Intronic
1160806925 19:996008-996030 GCTGGTGCCAGGGCGGGGTGAGG + Intronic
1160826226 19:1081799-1081821 GCGGGAGCCCGGGGGTGGGGAGG - Intronic
1160830871 19:1104422-1104444 GCGCGTGCCGGGGCCGGGGTCGG + Intronic
1160842821 19:1154154-1154176 GGGTGGGCCGGGGCCGGGGGTGG + Intronic
1160861802 19:1240275-1240297 GCGTGAGCGCGGGGGCGGGGCGG + Intergenic
1160861896 19:1240764-1240786 GCTCGAACCCGGGCGGGGGGGGG - Intergenic
1160873049 19:1285754-1285776 GGGTGGGCCGGGGCAGGGGGCGG + Intergenic
1160894795 19:1397333-1397355 GGGTGTGGCCGGGCCGGGGTGGG + Intronic
1160972311 19:1775085-1775107 CCGTGTGGCCGGCCGGGGAGAGG - Intronic
1161029425 19:2050911-2050933 GCGGGCGGCCGGGCGGGGGGCGG + Exonic
1161063595 19:2227149-2227171 GCGGGGGCCGGGGCGGGGGGCGG - Intronic
1161148957 19:2696786-2696808 GTGGGTGCCAGGGCTGGGGGAGG + Intronic
1161201847 19:3019481-3019503 GGATGGGCCGGGGCGGGGGGCGG + Intronic
1161203707 19:3029386-3029408 GCGGGTGCCCGGGGGCCGGGGGG - Intronic
1161241143 19:3224640-3224662 GCGGGGGCCCGGGAGGGAGGCGG + Intergenic
1161394565 19:4038274-4038296 GCGGGGACCCGGGCGGCGGGCGG + Exonic
1161400560 19:4065110-4065132 GCCTGAGCCCGGGCAGGGGAGGG - Intronic
1161405887 19:4090893-4090915 GCGTGTGCCAGGCCTGGGAGGGG + Intronic
1161467975 19:4442701-4442723 GAGTGTGCCCGGGTGGTGGGGGG + Intronic
1161479157 19:4502028-4502050 GCCTGAGCTCGGGCGGGGGCTGG - Exonic
1161581738 19:5084860-5084882 GGGTGGGCCGGGGCGGCGGGCGG - Intronic
1161911639 19:7198498-7198520 GCGTGTGCCCGGGAGGAGATCGG + Intronic
1162031793 19:7920701-7920723 GGGTGAGCCTGGGCGGGGTGAGG + Intronic
1162044016 19:7987108-7987130 GGGGGTGCCGGGGGGGGGGGAGG + Intronic
1162659523 19:12158087-12158109 GCATGAACCCGGGCGGGAGGCGG - Intergenic
1162752644 19:12838366-12838388 GCGAGTGCGCGGGCGGGGCCTGG + Intronic
1163051731 19:14689770-14689792 GCCTGTGCGCGGGGGCGGGGTGG - Intronic
1163118370 19:15201067-15201089 CCGGGAGGCCGGGCGGGGGGCGG - Intergenic
1163156450 19:15442498-15442520 GCGTGTGCTGGGGTTGGGGGAGG - Intronic
1163369824 19:16895970-16895992 GCGTGGGCCAGGGTGGAGGGAGG + Intronic
1163632496 19:18424555-18424577 GTGTGGGTCGGGGCGGGGGGCGG + Intronic
1163641063 19:18462357-18462379 GTGTGTGTTTGGGCGGGGGGCGG + Intronic
1163718764 19:18887918-18887940 GGGGGTGCCAGGGCTGGGGGAGG - Intronic
1164244730 19:23419530-23419552 GCGGCTGGCCGGGCGGGGGCTGG - Intergenic
1164274216 19:23702647-23702669 GCGGGGGCGGGGGCGGGGGGGGG - Intergenic
1164394386 19:27850776-27850798 GCGTGGGCCCAGGGGCGGGGTGG + Intergenic
1164834894 19:31350218-31350240 GCGCGGGCCGGGGCGGGTGGGGG + Intergenic
1165289828 19:34874196-34874218 GCGCCTGCCCGGGCTGGGGCAGG - Intergenic
1165773403 19:38390769-38390791 GTGTGAGTCGGGGCGGGGGGGGG - Intronic
1166193742 19:41193354-41193376 GCGTGGGCCCGGGGGGCAGGTGG - Exonic
1166799989 19:45450899-45450921 GCGTCTGCGCGGGCGTGGGGGGG - Intronic
1167134531 19:47608993-47609015 GCGCGGGCCTGGGCGCGGGGCGG + Intronic
1167154598 19:47730318-47730340 GGGTGTGGCCGGGCTGGGGGCGG - Intronic
1167269606 19:48499592-48499614 GCGTGGGGCCGGCCGGGGTGGGG - Exonic
1167997084 19:53414497-53414519 GCTTTTCCCCGGGGGGGGGGGGG - Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
1168100862 19:54140245-54140267 GCGGGTGGCGGGGTGGGGGGAGG - Intronic
1168505003 19:56926395-56926417 TCGTGTGTGTGGGCGGGGGGGGG + Intergenic
925380685 2:3423510-3423532 GCGGGTGCCGGGGCTGGGGGTGG - Intronic
925984721 2:9206713-9206735 GCGTGGGGCGGGGCGGCGGGAGG - Intergenic
926170038 2:10547410-10547432 GGGTGTGTCAGTGCGGGGGGCGG + Intergenic
926626632 2:15095981-15096003 GCTTGCGCCTGGGCTGGGGGTGG - Intergenic
927168603 2:20350388-20350410 GGGTGTGCGCGTGCGGGGGAGGG - Intronic
927920825 2:26970852-26970874 GCCAGGGCCCGGGCTGGGGGAGG + Intronic
929313573 2:40452173-40452195 GAGTGTGCGCGGGAGGGAGGGGG - Intronic
929452752 2:42047960-42047982 GCGGGGGCGGGGGCGGGGGGCGG + Intergenic
929460935 2:42101631-42101653 GGGGGTGCCTGGGCCGGGGGCGG - Intergenic
929937224 2:46302144-46302166 GTGTGTGCCCGTGCGTCGGGGGG + Intronic
930011514 2:46941389-46941411 GCGGGGGCCCGGGCGGCGGAGGG - Exonic
931682915 2:64767997-64768019 GCGCGGGCCAGGGCGGGGAGCGG - Intergenic
933782347 2:85811309-85811331 GCGCCTGCGGGGGCGGGGGGAGG - Intergenic
933893201 2:86789608-86789630 GCGGGGGCCCGGGGCGGGGGCGG - Intronic
934896960 2:98127580-98127602 GTGTGTGTGTGGGCGGGGGGGGG + Intronic
934896964 2:98127584-98127606 GTGTGTGGGCGGGGGGGGGGGGG + Intronic
934954852 2:98608750-98608772 GCGCGAGCCCGGGCCGCGGGAGG - Intronic
935592473 2:104855363-104855385 GCGGGGGCCCGGGGCGGGGGCGG + Intergenic
936412961 2:112276253-112276275 GCACGTGCCCGGCCGGGGGCGGG - Intronic
936747981 2:115603324-115603346 GGGGGTGGCGGGGCGGGGGGTGG - Intronic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
937978035 2:127593410-127593432 GCCTGTGCCTGGGCGGGGGTGGG + Intronic
939808973 2:146808262-146808284 GCGTGAGGCCGGGGGGTGGGGGG + Intergenic
941916713 2:170818084-170818106 GCGTGTGGGCCAGCGGGGGGAGG - Intronic
942046641 2:172102789-172102811 GCGCGGGCTCTGGCGGGGGGCGG + Exonic
942150922 2:173075689-173075711 GCGGGTGCCGGGGCGCGGGGCGG + Intronic
944221842 2:197310882-197310904 GCGTCGGCCCAGGCGGCGGGCGG - Intronic
946321285 2:218955891-218955913 GGGGGTGCCAGGGTGGGGGGGGG + Intergenic
947667907 2:231918717-231918739 GTGTGTGCCCTGGCGAGGTGGGG - Intergenic
948046995 2:234952323-234952345 GCGGGTGCCTGGGCGTGGGGCGG + Intronic
948467358 2:238158834-238158856 GGGAGTGTCCGGGCGGGGGAGGG - Intergenic
948552860 2:238786272-238786294 GCGGGTGCCAGGGCTGGGGGAGG - Intergenic
948790010 2:240372242-240372264 CTGTGTGCCTGGGCTGGGGGAGG + Intergenic
948874633 2:240820093-240820115 GCGGGAGGCCGGGCGGGCGGCGG + Intronic
948933807 2:241149657-241149679 GCATCTGCCCGGCCCGGGGGCGG - Intronic
1169214798 20:3786670-3786692 GCGCGTCGCCGGGCGGCGGGCGG + Exonic
1170612131 20:17923361-17923383 GCGGGGGCGGGGGCGGGGGGCGG - Intergenic
1170889794 20:20367847-20367869 GCGTGTGCCTGGACCGGGCGGGG + Intergenic
1170934378 20:20796955-20796977 GCGTGCGCCGGCGCTGGGGGTGG + Intergenic
1171223458 20:23421268-23421290 GTGCGTGCCCTGGGGGGGGGGGG - Intronic
1172037304 20:32019110-32019132 GCGGAGGCCCGGGCCGGGGGAGG + Exonic
1172100735 20:32483134-32483156 GAGTGGGCTGGGGCGGGGGGCGG - Intronic
1172109417 20:32536531-32536553 GCGTGCGCCCCGGCGGGGAGGGG + Intronic
1172118300 20:32584118-32584140 GTGTGTGCGCGCGCGGAGGGTGG - Intronic
1172984412 20:38972090-38972112 GCTTGAACCCAGGCGGGGGGAGG - Intronic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1173807471 20:45935097-45935119 GCGCGCGGCGGGGCGGGGGGCGG + Intronic
1174282648 20:49450375-49450397 GCCTGTGCCAGGGAGGGGTGGGG - Intronic
1174357669 20:50009470-50009492 GTGAGTGCAGGGGCGGGGGGGGG - Intergenic
1174607102 20:51768690-51768712 GCGCGGGCGCGGGCCGGGGGCGG - Intergenic
1174804762 20:53594711-53594733 AGGTGTGCGCGGGCGAGGGGAGG + Intronic
1175223581 20:57432003-57432025 GCGTGGGCCTGGGCTGGGGGTGG + Intergenic
1175402160 20:58707033-58707055 GCGTGGGGCCGGGTGGGGGTGGG + Intronic
1175439543 20:58981190-58981212 GCCTCGGCCCGGGCGGGAGGCGG - Exonic
1175439638 20:58981537-58981559 GCGGGACCCCGGGCGGGCGGGGG - Intronic
1175470217 20:59222275-59222297 CAGGGTGCCCGGGCGGGCGGCGG + Intronic
1175911500 20:62407308-62407330 GCGGGCGCGCGGGCAGGGGGTGG - Intergenic
1175950839 20:62582281-62582303 GCGTGTGCCCCGGAGTGCGGGGG - Intergenic
1176135486 20:63520475-63520497 GCCTGGGCCCGGGAGAGGGGCGG + Intergenic
1176161844 20:63652493-63652515 GCGCAGGCCCGGGCGGGGGGCGG - Intronic
1176223614 20:63981645-63981667 GCGGGCGGGCGGGCGGGGGGGGG - Intronic
1176311810 21:5154602-5154624 GGGTGAGCGCGGGCGGCGGGCGG - Exonic
1176733279 21:10521189-10521211 AGGTGTGCCTGGGCGAGGGGAGG - Intergenic
1178257216 21:31065151-31065173 GAGTCTGCCGGGGCGGGGGTTGG + Intergenic
1179213802 21:39349266-39349288 GGGGGCGCCCGGGGGGGGGGGGG - Intronic
1179535059 21:42046092-42046114 GGGTGTGCATGGGCGAGGGGAGG + Intergenic
1179629710 21:42668896-42668918 GCGTGGGACGTGGCGGGGGGTGG - Intronic
1179675004 21:42975032-42975054 GCGCGCGCCCCGGCGCGGGGCGG + Intronic
1179810075 21:43864896-43864918 GCTGGGGCCCGGGCTGGGGGAGG - Intergenic
1179845240 21:44107433-44107455 GGGTGAGCGCGGGCGGCGGGCGG + Exonic
1179920690 21:44505578-44505600 GTGGGTGCCGGGGCTGGGGGGGG - Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180843603 22:18970359-18970381 GCGCGGGCCTGGGCGGGGGCTGG - Intergenic
1180843618 22:18970385-18970407 GCGCCTGCCTGGGCGGGGGCTGG - Intergenic
1180950542 22:19718707-19718729 GCGTGCCCCCGGGCCTGGGGGGG + Intronic
1181085538 22:20437824-20437846 GTGCGAGGCCGGGCGGGGGGCGG + Exonic
1181514370 22:23402681-23402703 GCGCGGGCCCGGGCTGGGGCTGG + Intergenic
1182149508 22:28018291-28018313 GCGTGTGTGCGCGCGCGGGGGGG + Intronic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1183067270 22:35371893-35371915 GGGTACGCCTGGGCGGGGGGGGG - Intergenic
1183325242 22:37187948-37187970 GTGTGTGCCCGGGTAGGGGCGGG + Intronic
1183486187 22:38088894-38088916 GCGAGCGCCCGGGCGGCGGCGGG - Exonic
1183535734 22:38399256-38399278 AGGTGTGCCCGGGCGAGGGGAGG + Intergenic
1183642444 22:39100832-39100854 GTGAGAGCCGGGGCGGGGGGCGG - Intronic
1184035292 22:41915111-41915133 GCGCGGGCTCGGGCGGGCGGGGG + Intergenic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
1184239855 22:43206388-43206410 GCGTGTGTGTGTGCGGGGGGTGG - Intronic
1184276420 22:43411796-43411818 GCGGGGGCCCCGGCGGGTGGCGG + Intronic
950518227 3:13480753-13480775 ACCTGAGCCAGGGCGGGGGGCGG - Intronic
950758329 3:15196911-15196933 GTGTGTGTGTGGGCGGGGGGGGG - Intergenic
951543857 3:23806694-23806716 GCGGGTGCCCGGGTGGGGGAAGG - Intronic
951570719 3:24059803-24059825 GTGTGTGTTGGGGCGGGGGGCGG + Intergenic
952970937 3:38649714-38649736 GCGCGGGCTCGGGCTGGGGGCGG + Intergenic
953531223 3:43741346-43741368 GTGTGTGTGTGGGCGGGGGGGGG - Intergenic
953881393 3:46693195-46693217 GTGTGTGCCTGGGCAGGGAGAGG - Intronic
953901419 3:46846063-46846085 GCCTGGGCCGGGGCCGGGGGAGG - Intergenic
954155684 3:48683781-48683803 ACGTGTGCCAGGGCCAGGGGAGG - Intronic
954181192 3:48882686-48882708 GTGTGTGTCGGGGCGGCGGGGGG - Intronic
954380329 3:50215820-50215842 TCGTGAGCCCTGGCGTGGGGAGG + Exonic
954401316 3:50321248-50321270 GCCTGCGCCCGGTCGGGTGGGGG + Exonic
961319655 3:126063946-126063968 GTGTGTCCCCGGGGGGGGGTTGG - Intronic
961320103 3:126067099-126067121 GCGGTGGCCGGGGCGGGGGGCGG - Intronic
962001715 3:131305149-131305171 GTGTGTGCACTGGCGGGGGAGGG + Intronic
962245279 3:133785634-133785656 GCGGCTGGCCGGGCGGGGGGGGG - Intronic
962575420 3:136751795-136751817 CCGAGAGCCCGGGCGGGGGGGGG + Intronic
964302977 3:155309864-155309886 GCGAGTGCCGGGGCCGGGGCCGG + Intergenic
966119441 3:176506071-176506093 GCCTGCGGCGGGGCGGGGGGAGG + Intergenic
966684889 3:182682926-182682948 CCGTGGGCCCGGGCGAGGGGCGG + Intergenic
966796975 3:183724824-183724846 GCTTGAACCCGGGCGGGGGGAGG - Intronic
966866536 3:184261501-184261523 GCGGGGGCGGGGGCGGGGGGCGG + Intronic
966874732 3:184315335-184315357 CGGTGTCCCCGGGTGGGGGGTGG + Intronic
968083300 3:195862264-195862286 GCGTGTGCCATGGCGGTGGGTGG - Intergenic
968169169 3:196494938-196494960 GCTTGAGCCCGGGCGGTGGAGGG + Intronic
968272802 3:197417562-197417584 GCGTGTGTCGGGGCAAGGGGAGG + Intergenic
968452140 4:680778-680800 GCCTGTGCCCGGTGGGGGTGGGG + Intronic
968479303 4:826440-826462 GCGGGGGCGGGGGCGGGGGGTGG + Intergenic
968569297 4:1331212-1331234 GCGTGTGCAGGGGCTGGGGACGG - Intronic
968582777 4:1402668-1402690 GGGTGGGCCCGGCCGGGCGGAGG + Intergenic
968585533 4:1414490-1414512 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585574 4:1414612-1414634 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585596 4:1414673-1414695 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585608 4:1414704-1414726 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968596894 4:1490338-1490360 GTGTGTGCCGGGGTGGGGGCCGG - Intergenic
968699248 4:2047007-2047029 GGGTGAGACGGGGCGGGGGGCGG - Intergenic
968986909 4:3880563-3880585 GCGTGTGGCCGGGGGAGGGACGG - Intergenic
969271353 4:6105438-6105460 GCGTGCCCGCGGGCGGGGGAGGG + Intronic
969285711 4:6200676-6200698 GCATCTGCCCGGGGCGGGGGCGG - Intergenic
969344740 4:6563678-6563700 GCGTGAGCGCGGGCCCGGGGCGG + Intergenic
969619078 4:8269918-8269940 GCGGGAGACCGGGCGGGGGCCGG - Exonic
969698247 4:8748097-8748119 CCCTCTGCCCAGGCGGGGGGTGG + Intergenic
970192234 4:13528027-13528049 GCGGGTGAGGGGGCGGGGGGCGG - Intergenic
970754889 4:19413877-19413899 GTGTGTGGCGGGGGGGGGGGGGG - Intergenic
971215945 4:24662264-24662286 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
971405633 4:26319494-26319516 GCGCGTGCCCGGGAGGCGGGCGG - Intronic
972304142 4:37815757-37815779 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
972396564 4:38663825-38663847 GCGGGGACGCGGGCGGGGGGCGG + Intergenic
972654199 4:41049514-41049536 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
972770979 4:42196859-42196881 GCGGGGGCGGGGGCGGGGGGTGG - Intergenic
973162251 4:47032609-47032631 GTGTGTGCCGGAGCGGGGAGCGG - Intronic
973907477 4:55546424-55546446 GCGTGTGTGGGGCCGGGGGGCGG - Intronic
976092421 4:81471972-81471994 GCGCCTGCCGGGGCGGGGCGGGG - Intronic
977557390 4:98499218-98499240 GCTTCTGCCCGGGCAGGCGGTGG + Intronic
978285615 4:107073477-107073499 GCGCGGGCCAGGGTGGGGGGAGG - Intronic
982784432 4:159523813-159523835 GCGGCTGGCCGGGGGGGGGGCGG - Intergenic
985580577 5:693497-693519 GCGCGTCCCCGGGCCGGGTGGGG - Intergenic
987099838 5:14581963-14581985 GCCTGGGGCCGGGCGGGGCGGGG + Intronic
987156737 5:15096608-15096630 GCGGGCGGGCGGGCGGGGGGTGG + Intergenic
991224409 5:64252917-64252939 GTGTGTGCTGGGGCGGGGGGTGG - Intronic
992627788 5:78649723-78649745 GCATTTGACTGGGCGGGGGGCGG - Intronic
993855564 5:93070435-93070457 GTGTGTGCGGGGGCGGGGGGCGG + Intergenic
995438043 5:112159990-112160012 GCTTGAACCCGGGCGGGGTGGGG - Intronic
995724792 5:115170767-115170789 GCGTAGGCCCGGGTGGCGGGGGG - Intronic
996299818 5:121967750-121967772 GCTTGAGCCCGGGAGGGGGACGG + Intronic
996716865 5:126595255-126595277 GGGTTCTCCCGGGCGGGGGGCGG - Exonic
997129642 5:131264025-131264047 GCGCGAGCCTGGGCGGGGAGGGG + Intronic
998060093 5:139112639-139112661 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
998957634 5:147453727-147453749 GCGGGAGCCCGGGAGGGGGGCGG - Intronic
999129448 5:149271799-149271821 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1001639567 5:173235167-173235189 ACGGGTGCGCGGGCGGGCGGCGG - Exonic
1001867258 5:175116412-175116434 GGGTGTGCTGGGGGGGGGGGGGG + Intergenic
1002131818 5:177086789-177086811 GGGCGGGCCCGGGTGGGGGGGGG + Intergenic
1002187331 5:177460396-177460418 GAGTGGGGCCGGACGGGGGGTGG + Intronic
1002193799 5:177491775-177491797 GCGTGGGCGCGGGCGGGCAGGGG + Intronic
1002296153 5:178232473-178232495 TCAGGTACCCGGGCGGGGGGCGG - Exonic
1002833285 6:843659-843681 GCGTGTGCCTGGGTGGGTGGGGG + Intergenic
1003035489 6:2637537-2637559 GTGTGTGCGCGTGCGGGGGTGGG + Intergenic
1003058162 6:2841589-2841611 GCCTGTACCCAGGCGGGGGCGGG + Intronic
1003283301 6:4712528-4712550 GCTTGTGCCCGGGTGGGAGGTGG - Intronic
1003290295 6:4774975-4774997 GCTTGTTCCTGGGCGTGGGGAGG + Intronic
1003291272 6:4780403-4780425 GCGGGGGCGGGGGCGGGGGGGGG - Intronic
1003409689 6:5851459-5851481 GCGTGGGCACCGGCGCGGGGCGG - Intergenic
1006337530 6:33428202-33428224 GCGTGTGCGTGGGCGCGGGGAGG + Intronic
1006350966 6:33521010-33521032 GTGTGTGGGCGGGGGGGGGGGGG - Intergenic
1006350970 6:33521014-33521036 GTGTGTGTGTGGGCGGGGGGGGG - Intergenic
1006362275 6:33593189-33593211 GCGTGGGCGCCTGCGGGGGGAGG + Intergenic
1006374600 6:33664972-33664994 GCGTGTCCCTGGGGTGGGGGTGG + Intronic
1006460503 6:34155031-34155053 GCGTGTCCCCGGGCGTGGGACGG - Intronic
1006630747 6:35427981-35428003 GCATGTGGCCGGGGAGGGGGAGG - Exonic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1012051522 6:94351204-94351226 GCGGGAGCGGGGGCGGGGGGAGG + Intergenic
1012245781 6:96924467-96924489 GCGGGGGCGGGGGCGGGGGGCGG + Intergenic
1012632497 6:101489431-101489453 CAGTGTGGGCGGGCGGGGGGAGG - Intronic
1012895316 6:104940713-104940735 GCGAGTGGCGGGGCGCGGGGAGG - Intergenic
1013306181 6:108848718-108848740 GAGGGTGGCCGGGCGGGGTGAGG + Intronic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1016340917 6:143060812-143060834 GCGCGGGCGCGGGCGCGGGGCGG - Intronic
1017810707 6:157981734-157981756 GCGCGGGGCCGGGCGGGAGGCGG + Intergenic
1018010246 6:159663233-159663255 GCGTGTGCTTGGGCCGGGTGTGG - Intergenic
1018757488 6:166862733-166862755 GGGTGTGCGCGTGCTGGGGGTGG - Intronic
1019343640 7:519685-519707 GCGAGGCCCCGGGCGGCGGGTGG - Intronic
1019474540 7:1237588-1237610 GCGTGTGCCAGTGCGCGCGGGGG - Intergenic
1019559401 7:1648452-1648474 GCCTGTCCCGGGGAGGGGGGTGG + Intergenic
1019687164 7:2388352-2388374 GAGGGTGCCGGGCCGGGGGGTGG + Intergenic
1019770739 7:2882478-2882500 GGGTGTGCCCGGGCAGAGGTGGG + Intergenic
1020274371 7:6615697-6615719 GCGGGGGCCGGGGCGGGGGCGGG - Exonic
1022106282 7:27199911-27199933 GCGGCTGCCGGGGCCGGGGGCGG - Exonic
1022715170 7:32891925-32891947 GCGCGTTCCCGGGCCGCGGGCGG - Intronic
1022729058 7:33005884-33005906 GCGTGTGCGTGTGCGGGGGTGGG - Exonic
1023382686 7:39623885-39623907 GGGTGTGTCCGGGCGGCGGCGGG + Intronic
1024578286 7:50782349-50782371 GCGCGAGCCGGGGCGGCGGGCGG - Intronic
1024866705 7:53911578-53911600 GCGTGTGTCGGGGGGTGGGGTGG - Intergenic
1025044594 7:55682094-55682116 GCGTGTGCGTGTGCGGGGGTGGG + Intergenic
1025087547 7:56035256-56035278 GCTTGAACCCGGGTGGGGGGAGG + Intronic
1028222986 7:88219061-88219083 GAGTGTGCCCGGTGGTGGGGAGG - Intronic
1028326069 7:89526067-89526089 GCCTGTTGCCGGGTGGGGGGAGG + Intergenic
1029537092 7:101163297-101163319 GCGGGAGCGGGGGCGGGGGGCGG + Exonic
1032017670 7:128390043-128390065 GTGTGTGCCAGGGAGGGGTGAGG + Intergenic
1032194194 7:129780248-129780270 GCGGGGCCCGGGGCGGGGGGCGG - Intergenic
1032716756 7:134515369-134515391 GTGTGTGTCGGGGCGGGGGGTGG + Intergenic
1033159175 7:138981490-138981512 GCGCGGGCCCGGGCGCGGGACGG + Intergenic
1033165612 7:139036143-139036165 GCGGGAGGCCGGGCGAGGGGCGG + Intergenic
1033220387 7:139523626-139523648 CCGTGGACCCGGGCGGGGCGGGG - Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034159643 7:148983359-148983381 GGGTGGGGCCGGGCGGGCGGGGG - Intergenic
1034266912 7:149785483-149785505 GCGTGTGCCGGGGCCGGCAGTGG + Intergenic
1034312453 7:150100785-150100807 GCTTGAGCCCGGGGAGGGGGAGG - Intergenic
1034441073 7:151086393-151086415 GCGTGTGCCGGAGCCGGCGGGGG + Intronic
1034634125 7:152553909-152553931 GCGTGGGGCGGGGCGCGGGGGGG - Intergenic
1034794400 7:153999874-153999896 GCTTGAGCCCGGGGAGGGGGAGG + Intronic
1035235966 7:157497861-157497883 GGCTGTGCCAGGGCTGGGGGTGG + Intergenic
1035259685 7:157653493-157653515 GTGTGTGCCAGGGAGGGTGGCGG + Intronic
1035272761 7:157730185-157730207 CCGAGTGCCCGGGGGGGGGCAGG - Intronic
1035630185 8:1101511-1101533 GGGGGTGCCGGGGCTGGGGGTGG + Intergenic
1036359134 8:8065350-8065372 GCGACTGCCTGGGCGGGGGCAGG + Intergenic
1036390291 8:8318857-8318879 GCGGGAGCCGGGGCGGGGGCGGG + Exonic
1036891824 8:12601602-12601624 GCGACTGCCTGGGCGGGGGCAGG - Intergenic
1037807579 8:22067027-22067049 GCGTGTGTGCGGGAGCGGGGCGG - Intronic
1037826792 8:22164835-22164857 GCGTGTCCCGCGGCGGGGCGGGG + Exonic
1038045960 8:23765643-23765665 GGGTGGGGGCGGGCGGGGGGGGG + Intergenic
1038184309 8:25259034-25259056 GCTTGAGCCCGGGGGGGCGGAGG + Intronic
1038452208 8:27646970-27646992 GTGTGTGTGCGGGGGGGGGGCGG - Intronic
1038540175 8:28385400-28385422 GCGGGTGCCCGGGGGGGGGGCGG - Intronic
1038780390 8:30564822-30564844 GGGTTTACCTGGGCGGGGGGAGG - Intronic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1042858903 8:73294494-73294516 GGGTGCGCCCGGGGGCGGGGAGG + Intronic
1043053191 8:75407229-75407251 GCGTGACCCGGGGCGGGGGAGGG + Intergenic
1043532048 8:81161646-81161668 GGGTGTGCCTGGGTTGGGGGAGG + Intergenic
1045320865 8:101080574-101080596 GGGCGTCCCGGGGCGGGGGGGGG + Intergenic
1047097856 8:121642853-121642875 GTGTGTGGCGTGGCGGGGGGGGG - Intergenic
1047124780 8:121948347-121948369 GCGGGGGCGGGGGCGGGGGGCGG - Intergenic
1047315307 8:123727636-123727658 GTGTGTGTGTGGGCGGGGGGAGG - Intronic
1047969533 8:130072817-130072839 GTGTGTGTGCGCGCGGGGGGGGG + Intronic
1048308149 8:133297555-133297577 GCGTGTGCCCTGCCCGGAGGAGG + Exonic
1049396350 8:142402953-142402975 GCGGGAGGCCGGGCGGGGGGCGG - Intronic
1049639343 8:143707603-143707625 GCTGGTGGCCGGGCCGGGGGCGG - Intronic
1049708290 8:144052658-144052680 ACGGGTGCTGGGGCGGGGGGTGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050620020 9:7442543-7442565 GTGTGTGTCAGGGCGGGGGGGGG - Intergenic
1050932281 9:11345612-11345634 GCTTGTACCCGGGTGGTGGGAGG - Intergenic
1051055370 9:12978941-12978963 GTGTGTGGCAGGGCGGGGGTGGG + Intergenic
1051695219 9:19760905-19760927 GCCTGTTGCCGGGTGGGGGGAGG + Intronic
1052904101 9:33818126-33818148 GCGGGGGCTCGGGCGGGGGCGGG + Intronic
1053157525 9:35791483-35791505 CCGAGCGCCCGGGTGGGGGGTGG + Intergenic
1053179893 9:35959990-35960012 GTGTGTGTTGGGGCGGGGGGGGG + Intergenic
1053545665 9:39020700-39020722 GCGTGAACCCGGGAGGCGGGAGG - Intergenic
1055744422 9:79427112-79427134 GCGTGTGTCCTGGTTGGGGGTGG + Intergenic
1055925698 9:81507784-81507806 TCCTGTGCCAGGGCGGCGGGTGG - Intergenic
1056447182 9:86677364-86677386 GTGTGTGTCGGGGCGGGGCGGGG - Intergenic
1056879294 9:90375295-90375317 GCTTGAACCCGGGCAGGGGGAGG - Intergenic
1057245601 9:93451874-93451896 GCGCGGGTGCGGGCGGGGGGCGG - Exonic
1057442513 9:95092305-95092327 GGGTGGGCCCAGGCGGGGGTGGG - Intergenic
1057544382 9:96006493-96006515 GCGCGCGCCCTGGCGGGAGGTGG + Intronic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1059230675 9:112718302-112718324 GCGTGGCCCGGGGCGGGGGAGGG + Intergenic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060662893 9:125414639-125414661 GCGTGGGCCAGAGCGGGAGGCGG + Intergenic
1060734634 9:126059196-126059218 GCGTGTGCCCGGGAAAGGGATGG - Intergenic
1061181376 9:129026977-129026999 GGGAGTGCCCGGGTTGGGGGTGG + Intronic
1061287867 9:129634422-129634444 GGGTGGGCCTGGGCGGGGTGGGG - Intronic
1061379190 9:130243937-130243959 GGGTGTGCCCGGGCTGGGAGGGG - Intergenic
1061506226 9:131033401-131033423 GCGTGTGCCTGGGGTCGGGGAGG + Intronic
1061831254 9:133296741-133296763 GCATGAACCCGGGAGGGGGGAGG - Intergenic
1062272120 9:135714432-135714454 GCGGGCGGCCGGGCGGGGGCGGG - Intronic
1062277959 9:135739540-135739562 GCGTGTGCCCGGGGTGAGGGGGG - Intronic
1062435787 9:136546085-136546107 GGGTGGGGCCGGGCGGGGCGGGG - Intergenic
1062440460 9:136567274-136567296 GGGTCTGCCAGGGCTGGGGGGGG + Intergenic
1062440503 9:136567371-136567393 GGGTCTGCCCGGGCTGGGTGGGG + Intergenic
1062440525 9:136567420-136567442 GGGTCTGCCCGGGCTGTGGGGGG + Intergenic
1062440538 9:136567444-136567466 GGGTCTGCCAGGGCTGGGGGGGG + Intergenic
1062450637 9:136614359-136614381 GCGGGAGCCGGGGCGGAGGGTGG - Intergenic
1062467639 9:136688031-136688053 GCGTGTGTCTGGGCGGGGCTGGG + Intergenic
1062579261 9:137222295-137222317 GCGGGTCCCCAGACGGGGGGTGG - Intergenic
1203562683 Un_KI270744v1:71730-71752 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1185431639 X:14746-14768 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185432902 X:19761-19783 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185440963 X:227465-227487 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1185442254 X:232583-232605 TCGTGGGCCCGGGCGCTGGGTGG - Intergenic
1186244907 X:7608914-7608936 GCGGCTGGCCGGGCAGGGGGCGG + Intergenic
1186422862 X:9440114-9440136 GCTTTTGGCGGGGCGGGGGGAGG - Intergenic
1186455603 X:9707794-9707816 GCGAGAGCCCGGGAGGGTGGAGG - Intronic
1189324984 X:40106527-40106549 GCGGGAGCGCGGGCGGGGGAGGG - Intronic
1189825219 X:44911106-44911128 GCGGCTGGCCGGGCGGGGGCTGG + Intronic
1189911135 X:45811520-45811542 GGGTGGGCGGGGGCGGGGGGGGG - Intergenic
1190008139 X:46759221-46759243 ACAGGTGCGCGGGCGGGGGGCGG - Intergenic
1190680908 X:52826944-52826966 GCGGCTGGCCGGGCGGGGGGTGG + Intergenic
1191850353 X:65581522-65581544 GGGTGGGGCGGGGCGGGGGGTGG + Intergenic
1192533962 X:71911979-71912001 GGGAGTGGCCGGGAGGGGGGAGG + Intergenic
1195060754 X:101191635-101191657 GCCGCTGCCCGGGCGGGAGGAGG + Intergenic
1196819573 X:119692468-119692490 GTGTCTTCCCGGGCGGGCGGCGG - Intronic
1198962103 X:142194196-142194218 GTGTGTGGGCGGGGGGGGGGGGG - Intergenic
1199491336 X:148403662-148403684 TCGGGTGGCGGGGCGGGGGGGGG - Intergenic
1200057805 X:153470721-153470743 GGTGGTGCCGGGGCGGGGGGTGG - Intronic
1200092954 X:153644288-153644310 GCGGGTGCGGGGGCGGGGGCGGG + Intronic
1200148816 X:153941645-153941667 GCGTGTGGCCTGGTGAGGGGTGG + Exonic