ID: 904542065

View in Genome Browser
Species Human (GRCh38)
Location 1:31239811-31239833
Sequence CCCGCCAGCCGCCCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904542065_904542072 -8 Left 904542065 1:31239811-31239833 CCTGCCCCGGGGCGGCTGGCGGG 0: 1
1: 0
2: 2
3: 53
4: 444
Right 904542072 1:31239826-31239848 CTGGCGGGGAGCGCGGAGCAAGG 0: 1
1: 2
2: 3
3: 25
4: 313
904542065_904542073 12 Left 904542065 1:31239811-31239833 CCTGCCCCGGGGCGGCTGGCGGG 0: 1
1: 0
2: 2
3: 53
4: 444
Right 904542073 1:31239846-31239868 AGGAGAGCGAGCCCCGAGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904542065 Original CRISPR CCCGCCAGCCGCCCCGGGGC AGG (reversed) Intergenic
900100816 1:961224-961246 CCCCCCAGCGGCTCCAGGGCGGG + Intronic
900115407 1:1025879-1025901 CCCACCAGGAGCCCCGGGGTTGG - Intronic
900176088 1:1292053-1292075 CCCTCCAGCCGCCCCGCGCCCGG + Intergenic
900283988 1:1890684-1890706 GCCGCCCGCCGCACCCGGGCGGG + Intronic
900330433 1:2131652-2131674 CCCGGCAGCCAGCCAGGGGCAGG + Intronic
900339169 1:2179734-2179756 CCCACCAGCAGCCCTGGGCCCGG - Intronic
900363926 1:2302905-2302927 CCCTCCACCAGCCCCGTGGCTGG - Intronic
900366822 1:2314933-2314955 CGGACCAGCCGCCCCCGGGCCGG - Intergenic
900408473 1:2502605-2502627 TTCGCCAGCAGCCCCGGGCCCGG + Intronic
900417250 1:2540772-2540794 CCCCCCGTGCGCCCCGGGGCAGG + Intergenic
900580067 1:3404468-3404490 GCCTCCAGCCGCCCTGGGGGTGG + Intronic
900630651 1:3633429-3633451 CCTTCCCGCCGCCCCGGGCCGGG - Exonic
900934923 1:5759094-5759116 CCCGCCAGCCGCTCTTGGGGGGG + Intergenic
901049911 1:6420818-6420840 CCCGCCAGCCGGTCGGGGGAGGG - Intronic
901642105 1:10697895-10697917 CCCTCCATCGGCCCCGGAGCGGG - Intronic
901662998 1:10810437-10810459 CCCACCAGCTGCCCGGAGGCTGG + Intergenic
902049905 1:13554998-13555020 CCCGCCTCCCGCCCCGTGCCCGG + Intergenic
902235987 1:15057781-15057803 CCCTCCTGCTGCCCTGGGGCTGG - Intronic
903792821 1:25906276-25906298 CCCGCCCGCCGCCCTGCAGCAGG + Intronic
903807816 1:26017865-26017887 CCAGCCAGCATCCCCAGGGCTGG + Intergenic
904031608 1:27536805-27536827 CCCTCCAAGGGCCCCGGGGCAGG + Intronic
904171092 1:28592607-28592629 CGCGCCTGGCGCCCCGGAGCCGG + Intronic
904542065 1:31239811-31239833 CCCGCCAGCCGCCCCGGGGCAGG - Intergenic
904591557 1:31618063-31618085 CCCGCCAGCCCCCGAGGTGCAGG + Intronic
904618649 1:31763041-31763063 CCCTCCCGCAGCCCCAGGGCCGG - Intronic
905038124 1:34930213-34930235 CCTGCCAGCGGCTCCGAGGCCGG - Intergenic
905395391 1:37663387-37663409 CCCACCAGCCACCATGGGGCTGG - Intergenic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
905847166 1:41242370-41242392 CCGGCCTGCCGACCCGGGTCCGG + Intergenic
906365417 1:45205967-45205989 GCCGCCAGCAGCGCCGGCGCCGG + Exonic
906411777 1:45584493-45584515 CCGGCCAACCGCCCCGGGCTGGG - Intronic
906411850 1:45584736-45584758 CCCGCCCCCTGCCCCAGGGCCGG - Intronic
906659024 1:47569264-47569286 CCCACCAGCAGTCCAGGGGCTGG - Intergenic
906695271 1:47819241-47819263 CCCTCCAGTCGCTCCAGGGCGGG + Intronic
909957771 1:81800989-81801011 CCCGCCGGCGGAGCCGGGGCCGG + Intronic
910000043 1:82330808-82330830 CCGGCCTGCAGCTCCGGGGCTGG + Intergenic
910237125 1:85048042-85048064 CCCGCCCGGAGCCCCTGGGCTGG - Intronic
910892203 1:92029956-92029978 AACGCCGGCCGCCCCGGGCCGGG + Intergenic
914702995 1:150150514-150150536 CTCGCCCGGCGCCCGGGGGCGGG - Intronic
915439146 1:155933779-155933801 CCCGCCAGCGGCCCCAGGTGGGG - Exonic
915937549 1:160098281-160098303 ACCTCCAGCCTCCCCGGGGTCGG - Intronic
916605298 1:166336323-166336345 CCAGCCAGCCGCCCTGGAGAAGG - Intergenic
917846733 1:179026135-179026157 CCCGCCCGCCGCGCCGGGGGCGG - Intronic
918046027 1:180941492-180941514 CCCGCCAGCCGCCCAGGCCTGGG + Intronic
918064172 1:181088620-181088642 GCCGCCAACCGTTCCGGGGCTGG - Intergenic
920117277 1:203629636-203629658 CCCGCCAGCCTCTCCGCCGCTGG + Intronic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
920655185 1:207869086-207869108 CCCGCCAAGCGCCCCGCTGCAGG + Intergenic
920756757 1:208740090-208740112 TCCACCAGCAGCCCCGGTGCGGG + Intergenic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
922116476 1:222618366-222618388 CCCGCCTGCGACCCCCGGGCCGG - Intronic
923299711 1:232630044-232630066 CCCGCCGGCCGCCCGAGCGCAGG - Intergenic
923611987 1:235504149-235504171 CCCGCCTGCGCCTCCGGGGCCGG - Exonic
924198980 1:241640258-241640280 CCCGCCAGGCGCGCCGGCGCCGG - Exonic
924306012 1:242689828-242689850 TCCGCCTGTGGCCCCGGGGCAGG + Intergenic
924502807 1:244653006-244653028 GGCGCCAGGCGCCCCGGGGGCGG - Exonic
924560552 1:245154356-245154378 CCCCCCGGCCGGCCCGGGGTCGG + Intergenic
1063423987 10:5937184-5937206 CCTGACAGCCTCCCCGGAGCAGG + Exonic
1063929807 10:11017899-11017921 GCAGCCGGCCGCCCCGGCGCTGG + Intronic
1065024210 10:21526071-21526093 CCCGCCGCCAGCCCCGGGGGAGG + Intergenic
1065239643 10:23693590-23693612 CCCGCCCGCCGCCTCCCGGCTGG - Intergenic
1065367868 10:24952706-24952728 CCCGCCGGCGGGCCCGGGGCGGG - Intergenic
1067113957 10:43420569-43420591 CCCGGCACCCGCCCCGCCGCCGG - Intergenic
1069186535 10:65429671-65429693 CCCGCCAGCCCCGCCGGCCCCGG - Intergenic
1069705735 10:70458333-70458355 CCGGCCAGGCGCGGCGGGGCGGG - Intergenic
1069748989 10:70733820-70733842 CCTGCCTGCCTTCCCGGGGCAGG + Intronic
1070653122 10:78252280-78252302 ACTGTCAGCTGCCCCGGGGCTGG + Intergenic
1071563542 10:86660213-86660235 CCCCCCACCCACCCCGGGGCTGG - Intronic
1071603335 10:86969544-86969566 CCTGTCAGCCCCCCCGGGGCTGG + Intronic
1072591521 10:96832427-96832449 CCCTCCGGCCGCCCCGCCGCCGG + Intronic
1072591586 10:96832614-96832636 TCCGCGCGCCTCCCCGGGGCTGG + Intronic
1075419179 10:122288237-122288259 CCTGCCATCCACCCCGTGGCAGG - Intronic
1075539346 10:123299388-123299410 CCCACCACCCACCCCGGGGCTGG - Intergenic
1075631465 10:124003227-124003249 CACGCCAGCCAGCCCAGGGCAGG + Intergenic
1076035721 10:127196869-127196891 CCCGCCAGCTGCTCCGGAGGCGG - Intronic
1077143905 11:1036414-1036436 CCCCCCAGCAGCCGCGGTGCTGG - Intronic
1077158845 11:1103525-1103547 CTGGCCACCCGCCCTGGGGCAGG - Intergenic
1077504146 11:2922419-2922441 CCCGCCTGCCGTCCCAGGCCTGG + Exonic
1077510554 11:2958987-2959009 CTCGCCAGCATCCCTGGGGCTGG - Intronic
1077839668 11:5961022-5961044 CCCGGCAGCCGCCCCCCGTCTGG + Intergenic
1079362000 11:19777278-19777300 CGCAGCAGCGGCCCCGGGGCGGG + Intronic
1080406897 11:31987567-31987589 CGCGCCCGCCACCCCGGGGCTGG - Intronic
1083335149 11:61917666-61917688 CCGGCCCGCCGCGCCGGGACAGG + Intronic
1083823099 11:65183413-65183435 CCCGCTTCCCCCCCCGGGGCAGG + Intronic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1084020475 11:66414251-66414273 TCCTCCAGCCTCCCCAGGGCAGG + Intergenic
1084225000 11:67710547-67710569 CACGCCAGCAGGCCCGGGGCTGG - Intergenic
1084262821 11:67990390-67990412 CACCCCAGCAGGCCCGGGGCTGG - Intergenic
1084491955 11:69483815-69483837 CCCGCCAGCCGGGCCGGCCCGGG - Intergenic
1084492586 11:69486804-69486826 CCAGGCAGCCGTCCTGGGGCTGG - Intergenic
1084810572 11:71608715-71608737 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
1085266681 11:75241610-75241632 GCCGCCAGCCGCCCTGCGCCTGG + Exonic
1085477966 11:76799469-76799491 GCCTCCAGCCGCCCCGGTCCTGG - Intergenic
1085525306 11:77160398-77160420 GCCGACTGCAGCCCCGGGGCAGG - Intronic
1086064904 11:82733805-82733827 CGCGCGCGCCGCGCCGGGGCGGG - Exonic
1089585431 11:119507589-119507611 CCGGGCAGCCGCCCCGTGCCGGG - Intergenic
1090352537 11:126116367-126116389 CCCCCCACCCCCCCCGGGACTGG - Intergenic
1091550040 12:1530258-1530280 CCCGACAGCCGCGCCGGCCCCGG - Intronic
1091915421 12:4269492-4269514 CCCTCCAGGCGCCCCCGGGAGGG - Intergenic
1092291642 12:7162921-7162943 CGCGCCAGCCTCCACGGTGCTGG + Intergenic
1093894669 12:24562719-24562741 CCCGCCGCACCCCCCGGGGCGGG - Intergenic
1094607325 12:31959728-31959750 TCTGCCCGCCGCACCGGGGCCGG + Intronic
1095964341 12:47857048-47857070 CCATCCAGCAGCCCCAGGGCAGG + Intronic
1096251024 12:50032836-50032858 CCCGCTTGCCGCCCCCGCGCGGG - Intronic
1096714664 12:53483821-53483843 CCTTCCACCCGCCCTGGGGCTGG + Intronic
1096840924 12:54378977-54378999 CCCGCCCGCCCCTGCGGGGCTGG - Intronic
1097251196 12:57632996-57633018 CCCGCCAACCGCCCCCGGGCAGG - Exonic
1097830760 12:64222201-64222223 CCCGCTGGCCGCCCCGGTCCCGG - Exonic
1098278288 12:68835629-68835651 CCAGCCAGCCATCCCGGAGCCGG - Intronic
1098369263 12:69739286-69739308 CCCACCAGCAGCCCAGGGGGCGG - Intronic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1101441591 12:104708322-104708344 CCCCACAGCCGCCCCCGGGAAGG - Intronic
1102111767 12:110370706-110370728 CCCTCCTGCTGCCCTGGGGCAGG + Intergenic
1102197112 12:111033873-111033895 CCCGGCTGCCTCCCCCGGGCGGG + Intergenic
1102197196 12:111034075-111034097 GCCGGCGGCGGCCCCGGGGCTGG + Exonic
1103364057 12:120369449-120369471 CCCCCCACCCACCCCGGCGCGGG + Intergenic
1104376255 12:128267318-128267340 CCCGCCGGCCGCCCCATGCCCGG - Intergenic
1104697160 12:130872204-130872226 TCCGCCACCCGCCCCGGCCCTGG - Intronic
1104729558 12:131097509-131097531 GCAGCCAGCCTCCCCCGGGCTGG - Intronic
1104729697 12:131098040-131098062 CGCGCCAGCCTCACCTGGGCAGG + Intronic
1105294447 13:19075650-19075672 CCCCTCAGCGGCCTCGGGGCAGG + Intergenic
1105492606 13:20902930-20902952 CCCGGCCGCCGCGCTGGGGCGGG + Intronic
1105557354 13:21459402-21459424 CCCGCCAGCCCGCCCGCCGCGGG + Intergenic
1105559459 13:21476958-21476980 CCCGCCACCCGCCCAGGCACTGG - Intergenic
1106303909 13:28494318-28494340 CCTGCCAGGCTGCCCGGGGCTGG - Intronic
1106922519 13:34578735-34578757 CCCACAAGCAGCCCCGGGCCTGG - Intergenic
1112344010 13:98576286-98576308 CCCGCCCGCCTGCCCGGGGGTGG + Intronic
1113082748 13:106535262-106535284 CCCGCCAGCCGCGGCCGGCCCGG - Intergenic
1113231627 13:108218535-108218557 GCCGGCAGCGGCCCCTGGGCTGG + Exonic
1113779595 13:112968694-112968716 ACCTCCGGCCGCCCCGTGGCAGG - Intronic
1113839554 13:113351029-113351051 CCCTCCAGCTGCCCCGAGGGTGG + Intronic
1118148843 14:63166211-63166233 CCGGCCAGCCGCCCCGTCTCCGG + Intergenic
1118627814 14:67674880-67674902 CCCGCCGGCCGGCGAGGGGCGGG + Intronic
1118992540 14:70809412-70809434 CCCGCTCGCCCCCCCGGGGGCGG + Exonic
1119601921 14:75982348-75982370 CCCGCGGGCGGCCCCGGGACCGG - Intronic
1119793709 14:77376982-77377004 GCCGCCAGCCGACCCTGGGCGGG + Exonic
1121535717 14:94689604-94689626 CCGGCCAGCCGCGCCCAGGCTGG - Intergenic
1122130864 14:99604075-99604097 CGCGCCAGGCGGCGCGGGGCGGG - Intergenic
1122410158 14:101521658-101521680 CCCGCCAGCCCTCCCACGGCAGG + Intergenic
1122771490 14:104099826-104099848 CCCTGGAGCCTCCCCGGGGCTGG - Intronic
1123024660 14:105419175-105419197 CCCGCCAGCCCCAACAGGGCTGG - Intronic
1123026330 14:105425970-105425992 CCCGGCAGCCTCCCTGGGGCGGG + Intronic
1123036644 14:105474504-105474526 CCTGCCCGCCGCCCCGGGGACGG + Intronic
1124247270 15:28081704-28081726 CCCGGCAGCCCCCCTGGGGCAGG + Exonic
1125536159 15:40441871-40441893 CCCCCCTGCCGCCCCCGGCCCGG - Intronic
1126150928 15:45522920-45522942 CCCGCCTCTCGCCCCGAGGCTGG + Intergenic
1126517034 15:49550079-49550101 CCGGCCAGCCGCCCCCGTCCAGG - Intronic
1127433292 15:58933204-58933226 CCCGCCCCGCGCCCCGGGCCGGG - Intronic
1128247795 15:66144672-66144694 TCCCCCAGCCACCCCGGGGCTGG + Intronic
1128344019 15:66842544-66842566 CCCGCCACCCGCCCCGCCGAGGG + Intergenic
1128745502 15:70111478-70111500 CCAGCCAGCCTTCCCTGGGCAGG + Intergenic
1129110131 15:73332359-73332381 CCCACCAGCAGCTCCAGGGCAGG - Intronic
1129356495 15:74995571-74995593 GCCGCGAGCCGCTCCGGGGCTGG - Intronic
1130370970 15:83284839-83284861 GCCGCCTCCCGCCCCGGGACCGG + Intergenic
1130407291 15:83613214-83613236 CCCTCCAGCCACCACTGGGCTGG - Intronic
1131992316 15:98104213-98104235 TCCACCTGCCGCCCCGGTGCAGG - Intergenic
1132252016 15:100341473-100341495 GCCGCCAGCCGCGCCAGCGCGGG + Intronic
1132549925 16:550145-550167 GCCGTCATCCGCCTCGGGGCAGG + Intronic
1132556100 16:573339-573361 CCCCACAGCCACCCCAGGGCAGG - Intronic
1132656689 16:1044472-1044494 CCCCCCAGGCGGCCCCGGGCGGG - Intergenic
1132833003 16:1938631-1938653 CCTGCCAGCCGCCCTGGCCCTGG - Exonic
1132851526 16:2026972-2026994 CCCACCGGCCGCCCGCGGGCAGG - Exonic
1133156489 16:3880226-3880248 CCCGGCCGCCCCCCCGGGCCCGG + Exonic
1133784268 16:8963088-8963110 CCCGGCGGCCGCCCGGGGCCTGG + Intronic
1134092643 16:11399701-11399723 CCTGGCCGCCTCCCCGGGGCAGG - Exonic
1135032504 16:19049726-19049748 CCCGCCGGCTGCCCCGAGGCTGG + Intronic
1135134260 16:19876096-19876118 CCTCCCAGCCACCCTGGGGCTGG - Intronic
1135298284 16:21301778-21301800 ACCACCAGCCGCCCGCGGGCAGG - Intronic
1137300503 16:47143911-47143933 TCCGCCCGCGGCCCCGGCGCGGG + Exonic
1137734214 16:50712077-50712099 CCCGCCAGCTGCACCGGGTGAGG + Exonic
1138023210 16:53503064-53503086 GCCGCCAGCCTCCACGGGCCCGG - Intronic
1138179753 16:54933253-54933275 TCCGCCAGCCGCGCCGCCGCTGG - Exonic
1138619141 16:58197885-58197907 CCCGCCCGCCCCCGCGGGCCCGG - Exonic
1138619165 16:58197940-58197962 CCCGCCGGCCGCTCCAGGGCCGG - Intergenic
1139140909 16:64261204-64261226 CCCGCCCGCGGCCCAGGCGCAGG + Intergenic
1139448616 16:67013876-67013898 CCTGCCAGCCGGGCCGGGCCGGG + Intergenic
1139700180 16:68703349-68703371 CCCCCCAGCAGTCCCCGGGCTGG - Intronic
1139705558 16:68738160-68738182 CCAGCCCGCAGCCCCGGGACGGG - Intronic
1141132158 16:81444398-81444420 CACCCCCGCCGCCCCCGGGCCGG - Intergenic
1141418829 16:83898897-83898919 GCCGCCAGCCGCGCGGGAGCAGG + Intergenic
1141445214 16:84053501-84053523 GCCGCCAGCAGCCTAGGGGCAGG + Intergenic
1141623124 16:85247665-85247687 CCGGCCAGCTGGCCCTGGGCAGG + Intergenic
1142000534 16:87661731-87661753 CCCGCAGGCCGCCACGGGGCGGG + Intronic
1142271899 16:89094126-89094148 CCCGCGAGCCGCCTGGGGCCGGG + Intronic
1142292934 16:89201116-89201138 GCCGGCGGCCGCCCCGGAGCAGG + Exonic
1142614242 17:1125563-1125585 CCTCCCAGCAGCCCCGGAGCGGG - Intronic
1142664772 17:1456277-1456299 CCCGGCAGCCTCCCTCGGGCAGG - Intronic
1142851591 17:2707312-2707334 GCAGCCAGTCGGCCCGGGGCTGG + Intronic
1143897149 17:10145182-10145204 ACAGCCAGCAGCACCGGGGCAGG + Intronic
1146057725 17:29589510-29589532 CCAACCGTCCGCCCCGGGGCTGG + Exonic
1147644380 17:42025077-42025099 CCCTCCAGCCACCAGGGGGCAGG + Exonic
1148122574 17:45221722-45221744 CCAGCCCGCCCCCCTGGGGCTGG + Intronic
1148226481 17:45901270-45901292 CCCGCCAGCCATCCCGGGCAGGG + Intronic
1148722512 17:49763969-49763991 CCCGCCGGCTCCCCCCGGGCTGG - Exonic
1148806016 17:50264406-50264428 CCCGCCAGCAGCCGGGGAGCAGG - Intergenic
1148848441 17:50542208-50542230 CCCGCCTCCGGACCCGGGGCTGG + Exonic
1149491260 17:57086210-57086232 CCCGCCTGCGGCCCAGGGCCCGG + Intronic
1150128447 17:62653370-62653392 CCCGCCCCCACCCCCGGGGCGGG + Intronic
1150549040 17:66192104-66192126 CCGCCCAGCAGCCCGGGGGCGGG + Intergenic
1151327423 17:73387892-73387914 CCCGCGAGCTGCCCAGCGGCAGG - Exonic
1151370740 17:73644880-73644902 CTCCCCCGCCGCCCCGCGGCTGG - Intergenic
1151761138 17:76103785-76103807 CCGCCCAGGCGTCCCGGGGCGGG - Intronic
1151961848 17:77409717-77409739 CCCGGCAGCTGTCCCGGGCCTGG - Intronic
1152222139 17:79074803-79074825 CCGGCCAGCGGCCGCGCGGCGGG - Intergenic
1152517529 17:80834546-80834568 CCCGCCTCCCACCCCGGGGCTGG + Intronic
1152617815 17:81345971-81345993 CCGGGCAGGAGCCCCGGGGCGGG + Intergenic
1152640066 17:81445582-81445604 CCTGCCAGCAGCCCCGGGCCTGG + Exonic
1152735347 17:81994535-81994557 CCTGCCAGCGGCCCCGAGACTGG + Intronic
1153480588 18:5543401-5543423 CCCGCCAGCCGCCACCCGCCCGG + Intronic
1154057166 18:11023597-11023619 TCCACCTGCCGCCCCGGTGCGGG - Intronic
1155152898 18:23136235-23136257 CCCCCGCGCCACCCCGGGGCCGG - Exonic
1155284265 18:24272053-24272075 CCCGCCAGCGGCGCTGGGGAAGG - Intronic
1156502313 18:37567339-37567361 CCCGCCAGGCCCACTGGGGCTGG + Intergenic
1157276213 18:46312759-46312781 CCTGCCAGCCTCCCCTGGGCAGG - Intergenic
1157464301 18:47930795-47930817 CCCGCCAGCCGCCGGGAGGTGGG - Intronic
1157749270 18:50163571-50163593 CCCACCAGCAGCCCAGGTGCTGG + Intronic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1160528855 18:79552176-79552198 CCCTCCAGCCTCCCTGGGCCTGG + Intergenic
1160706565 19:532629-532651 CGCGCCAGCCACCCCCAGGCTGG - Intronic
1160736085 19:663018-663040 GCCGCCCGCCGCCCCGGCCCGGG + Intronic
1160768783 19:821367-821389 CCCGGCAGTGGCCTCGGGGCGGG - Intronic
1160775428 19:853103-853125 CCCGCCAGCAGCCCCGGCCCCGG - Intronic
1160836292 19:1126336-1126358 CCCGCCAGCCCCACCGGGAATGG - Intronic
1160916541 19:1499389-1499411 CCGGCCAGCCGCCCCCGTCCGGG - Intergenic
1160922075 19:1525704-1525726 GCCGCCAGGTGCCCAGGGGCGGG + Exonic
1161266361 19:3366522-3366544 CCCCCCCCCCGCCCCGCGGCCGG - Intronic
1161401587 19:4067948-4067970 CCAGCCAGCCCTCCCCGGGCCGG - Intergenic
1161495832 19:4585061-4585083 ACCGCCTGGAGCCCCGGGGCTGG + Intergenic
1161621286 19:5298669-5298691 CCCGCCAGCCGCACCGCAGCGGG + Intronic
1161790352 19:6355866-6355888 CCGGCCAGCCGCCTCGGTCCGGG + Intergenic
1161852785 19:6746237-6746259 CCCGCCACCCGCCGCTGGGCAGG - Intronic
1162022578 19:7874423-7874445 CCCGCCCGCGGCCGAGGGGCGGG - Exonic
1162149314 19:8633635-8633657 CCCTCCAGCCGCCCTGAGGATGG + Intergenic
1162775361 19:12975666-12975688 CCCGCCAGCCGGCCAGGCGGGGG + Intergenic
1162810916 19:13163975-13163997 CCGGCCAGCCGCCGAGGTGCGGG - Intergenic
1162909834 19:13842812-13842834 TCCGGCCGCCGCCCCGGGCCGGG + Intergenic
1162914209 19:13865545-13865567 CCTGCTCGCAGCCCCGGGGCGGG + Intronic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1163123498 19:15232043-15232065 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163497667 19:17656013-17656035 CCCGCCAGCTGCCCCAGGGAAGG - Exonic
1163667656 19:18610798-18610820 CCCGCCTGCCGCCCCCAGCCAGG + Intronic
1163677212 19:18661080-18661102 TCCTCCAGCGGCCCTGGGGCTGG + Intronic
1164069171 19:21750675-21750697 CCCGCGACCCGCCCCGGGCAGGG - Intronic
1164813633 19:31177430-31177452 ACGGCCAGCAGCCCCGAGGCTGG - Intergenic
1165900778 19:39168332-39168354 CACCCCAGCTGCCCCGGGCCTGG - Intronic
1166204438 19:41259868-41259890 CTCCCCAGCAGCCCCAGGGCAGG + Exonic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
1167041076 19:47022707-47022729 GATGCCAGCCGCTCCGGGGCAGG - Intronic
1167614473 19:50524822-50524844 CCAGCCAGCAGCCCCGATGCTGG + Intronic
1168297305 19:55383741-55383763 CGCGCCCGCCGCCCCGGGCCCGG + Exonic
1168588552 19:57614381-57614403 CCCGCCTGCGCCCCCGGGGACGG + Exonic
925923443 2:8653641-8653663 CCCGGCAGCAACCCCGTGGCGGG + Intergenic
927492082 2:23527320-23527342 CCCCCCAGCCACCCCAGGGTGGG + Intronic
931106954 2:59067011-59067033 CCGGCCAGCCGCTCCGAGGGCGG - Intergenic
932152721 2:69387449-69387471 CCCGCGGCTCGCCCCGGGGCGGG - Intergenic
932416507 2:71576655-71576677 CCTGCCAGGCGGCCCAGGGCAGG + Intronic
933684728 2:85133746-85133768 TCCGCCGGCCGCCCCGGCGCTGG - Exonic
934753098 2:96806926-96806948 CCAGCCAGCCTGGCCGGGGCGGG - Intronic
936485008 2:112918038-112918060 ACCGCCACCCGCCCAGGGCCAGG - Intronic
937283507 2:120736139-120736161 CCAGCCAGCCGGGGCGGGGCGGG - Intronic
937991385 2:127664275-127664297 CCCGCCACCCGCCCCGCCCCTGG + Intronic
938109317 2:128553407-128553429 CCCGCAAGCCCCCCTGGGGTGGG + Intergenic
938949781 2:136245471-136245493 CCCGCCGTCCGCTCTGGGGCAGG + Intergenic
941814429 2:169785677-169785699 CCGGCCAGCCGCCCCCGTCCGGG - Intergenic
942368587 2:175256949-175256971 CTCGCCTGCCGCCCCAGCGCGGG - Intergenic
942630515 2:177946476-177946498 CCGGCCAGCCGCCCCGTCCCGGG + Intronic
942890517 2:180981087-180981109 TCCGCGAGCCGCGGCGGGGCCGG + Intronic
944221895 2:197311021-197311043 CCCGCGATCCGCCCAGGGCCCGG - Intronic
944615077 2:201451686-201451708 CCCGCCTCCCTCCCCGGGGCTGG - Exonic
946354581 2:219176919-219176941 CCAGCCTGCCTCCCCGGGGCGGG + Intronic
946404056 2:219483520-219483542 CCCGCGGCCCGGCCCGGGGCAGG - Exonic
947635995 2:231681046-231681068 GCCGCCATCTGCGCCGGGGCGGG - Intergenic
947741739 2:232487861-232487883 CCCGCCTGCCGGCCCGAGGGAGG + Intergenic
947992306 2:234497160-234497182 CCCGCCCGCCGCCGGGGGTCAGG + Intergenic
948050742 2:234977546-234977568 CCTGCCAGTCGCCCCAGAGCTGG - Intronic
948335597 2:237204726-237204748 CCCACCAGCTACCCCGGGTCAGG + Intergenic
948963311 2:241356601-241356623 CCCGCCTGCCCCCACGCGGCAGG - Intronic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1170629649 20:18056494-18056516 CCTGGCCGCCGCCCAGGGGCAGG + Intronic
1171452836 20:25248022-25248044 CCTGCGCGCCGCGCCGGGGCGGG - Intergenic
1171567550 20:26208917-26208939 CCCGCCAGCCGCCCCTCGTGGGG + Intergenic
1171866393 20:30489472-30489494 CCCGCCAGTCGCCCCTCGTCGGG + Intergenic
1172015285 20:31869647-31869669 CCCCCCAGCTGCCCTGGGGGTGG - Intronic
1172118310 20:32584170-32584192 CCGCCCAGCCGGCCCGGGGGCGG + Intronic
1172296023 20:33811696-33811718 CCCCCCAGGCTCCCCGGGCCCGG + Intronic
1172474506 20:35226807-35226829 CCCGCCAGCGGCTCCAGCGCGGG - Exonic
1173166096 20:40688279-40688301 CCCACTAGCCACCCCGGGCCCGG - Exonic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1173875975 20:46371776-46371798 CCCGCCAGCCTCCCCTGAGATGG + Intronic
1174747755 20:53080768-53080790 CCGGCCCGCGGCCCAGGGGCTGG + Intronic
1175254221 20:57629201-57629223 TCCACCTGCAGCCCCGGGGCAGG + Intergenic
1175366811 20:58461443-58461465 CCCACCAGCCGCCCAGGTGCAGG + Exonic
1175714638 20:61247321-61247343 CCCGCCCGCCTCCCCGGCGTGGG - Intergenic
1176549147 21:8214011-8214033 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176550082 21:8217174-8217196 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1176557040 21:8258232-8258254 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176568079 21:8397049-8397071 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176569009 21:8400209-8400231 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1176575982 21:8441269-8441291 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176576923 21:8444444-8444466 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1176869556 21:14074296-14074318 CCTGCCAGCAGACCCTGGGCCGG - Intergenic
1178843732 21:36157293-36157315 CCCGCGCGCCCTCCCGGGGCCGG + Intronic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1178992371 21:37366685-37366707 CCCGCCCGCCGGCTCGGGGCTGG + Intronic
1179209531 21:39313494-39313516 CCCGCCTCCCGCCCCGCGCCCGG - Exonic
1179411837 21:41168314-41168336 CCTGCGCGCCGCCCCGGAGCTGG + Exonic
1179573823 21:42294449-42294471 CACGCCAGCTTCCCCCGGGCAGG - Intronic
1179655082 21:42839776-42839798 CCTGCCAGACACCCCTGGGCTGG - Intergenic
1179726665 21:43344826-43344848 CCTGCCTGCCGCCCCCGGGTGGG - Intergenic
1179800557 21:43809798-43809820 TCTGCCAGCAGCCCCGGGGTTGG + Intergenic
1179893747 21:44350430-44350452 CCCTGCAGCAGCACCGGGGCCGG - Intronic
1179986028 21:44920700-44920722 CCTGCCAGACACCCCTGGGCCGG + Intronic
1180177411 21:46097617-46097639 CCCGCGAGAGGCCCCGGGTCAGG - Intergenic
1180831645 22:18909903-18909925 CCCTCCAGCTGCCCTGGGTCTGG + Intronic
1181670652 22:24424161-24424183 GCCGGCAGCCGCCGCGGGGCAGG - Intronic
1181811113 22:25404627-25404649 CCGGGCAGCCGACCCGGGGAGGG + Intronic
1182294901 22:29306973-29306995 CCCGCCCGCCCCCTCCGGGCAGG + Intronic
1183299569 22:37052178-37052200 CTCTCCAGCCGCCCCGGATCGGG + Intronic
1183486232 22:38089064-38089086 CCCTCCTGCCGCCCCGGGGCGGG + Intronic
1183739536 22:39662291-39662313 CCCTCCAGGCGGCCCGGGGGTGG - Exonic
1184017926 22:41800035-41800057 CCCGGCAGGGGCCCCGGGCCCGG + Intergenic
1184523630 22:45009360-45009382 CTCGCCCCCCGCCCCCGGGCAGG + Intronic
1184677894 22:46053636-46053658 CCCGCAGGCCGGCCAGGGGCTGG + Intronic
1184679421 22:46062081-46062103 CGCACCTCCCGCCCCGGGGCCGG + Intronic
1184680735 22:46071186-46071208 CCCGCCGCCCGCCCCGGGCAAGG - Intronic
1184697883 22:46150156-46150178 CCAGCCCGGCGCACCGGGGCGGG - Intergenic
1185037865 22:48489260-48489282 GCCGCCCGCCGACCCGGGCCTGG - Intergenic
1185259590 22:49854038-49854060 CCCGCGGACCGCGCCGGGGCCGG + Intronic
1203254032 22_KI270733v1_random:130327-130349 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203254972 22_KI270733v1_random:133500-133522 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1203262088 22_KI270733v1_random:175406-175428 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203263028 22_KI270733v1_random:178579-178601 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
950365945 3:12484358-12484380 CCCGCCAGCCGGCCGTGCGCAGG + Intergenic
951333524 3:21393840-21393862 CCCCCCAGCCCCTCTGGGGCAGG - Intergenic
952241286 3:31533155-31533177 CCGGACAGCCCCGCCGGGGCCGG - Exonic
953124432 3:40077856-40077878 CCCACCTGCAGCCCCGGTGCGGG - Intronic
953485105 3:43287019-43287041 CCCGCGCCCCGCCCCGGAGCGGG + Intronic
953614480 3:44477750-44477772 GCCGCCCGCCGCACCGGAGCCGG - Intergenic
953980197 3:47409813-47409835 CCCGCCAGCAGCTCCTGGACAGG + Exonic
954325222 3:49859765-49859787 CCCACCTGCAGCCCCGGGGGTGG + Exonic
954356024 3:50084476-50084498 CCGGCCAGCCGCCCCTGTCCGGG - Intronic
954664782 3:52245949-52245971 GGCGTCGGCCGCCCCGGGGCTGG - Intronic
954800349 3:53183593-53183615 CCCTCCTGCAGCCCAGGGGCGGG - Intronic
960868534 3:122227219-122227241 CCCGCCAACCGCCCAAGGGCTGG - Intronic
961305617 3:125958069-125958091 CCCGCCCCCCCCCCCAGGGCGGG + Intergenic
964014357 3:151928238-151928260 CCCGCCCGCTGCTCCGGGGGCGG - Intergenic
966372162 3:179261430-179261452 CCCGCGAGCCGCTCCCCGGCGGG - Intronic
966378703 3:179322913-179322935 CCGGCCCGCAGCCCCGGGGGAGG - Intergenic
966910516 3:184557123-184557145 CCCGCCAGCTGCCTGGGGCCTGG + Intronic
967889226 3:194353280-194353302 CCCCTCAGCGGCCCCCGGGCTGG + Intergenic
968502699 4:958436-958458 CCCGCCAGCCCCCACGGGCCAGG + Exonic
968908759 4:3466235-3466257 CCAGCCATCAGCCCGGGGGCAGG - Intronic
969688445 4:8689952-8689974 GCAGCCAGCAGGCCCGGGGCAGG - Intergenic
969724044 4:8908637-8908659 GCTGGCAGCCTCCCCGGGGCCGG - Intergenic
969732534 4:8965111-8965133 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
969792113 4:9499194-9499216 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
970007291 4:11424092-11424114 CCCGCCTGCAGCCCCTGTGCTGG + Intronic
970615685 4:17766756-17766778 TCCGCCTGCTGCCCCGGTGCGGG - Intronic
972726805 4:41751833-41751855 GCTGCCGGCCGCCCCGGGTCGGG + Intergenic
973317827 4:48780012-48780034 CCCGGCGCCTGCCCCGGGGCTGG + Intronic
973758958 4:54100143-54100165 CCCGCCCGGCGCCCCGGCTCGGG - Exonic
974047289 4:56908404-56908426 CACAGCAGCCGCCCGGGGGCTGG + Intronic
974877401 4:67716125-67716147 CCCGACTGCTGCCCCAGGGCTGG - Intergenic
979278194 4:118836198-118836220 GCCACCGGCCGCCGCGGGGCGGG + Intronic
980027195 4:127781703-127781725 CTCGGCAGCTCCCCCGGGGCTGG + Intergenic
981128402 4:141132623-141132645 GCCGCCCGCCGCCCCGGCCCCGG + Exonic
982053486 4:151526406-151526428 CCGGCCAGCCACCCCGGTCCGGG - Intronic
984803754 4:183735864-183735886 CCGGCCGGCCGCCCCGGGCCGGG - Intergenic
984992556 4:185395996-185396018 CCCGACAGCACCCGCGGGGCCGG + Intergenic
985068444 4:186144973-186144995 CGCCCCCGCGGCCCCGGGGCTGG - Exonic
985634477 5:1028994-1029016 CTGGCCAGCGGCCCGGGGGCAGG + Intronic
985781848 5:1875729-1875751 CCCGCCAGGCTGCCCGCGGCCGG + Intergenic
985820369 5:2156052-2156074 CCCTCCAGCGGCTCCAGGGCAGG + Intergenic
987132414 5:14871869-14871891 ACCGCCAGCGGCCCCGGGGGCGG + Intergenic
989178790 5:38556413-38556435 TCCCACAGCCGCCCGGGGGCAGG + Intronic
990278933 5:54229355-54229377 CCCACCAGCCACCAGGGGGCAGG - Intronic
992542222 5:77776384-77776406 CCCGCCACGCCCCGCGGGGCGGG + Intronic
994670251 5:102755116-102755138 CCCGGGAGCCGCCCCCGGGGAGG + Intronic
996373212 5:122775003-122775025 CCCGCCAGCCTCCCCGCCCCCGG - Exonic
997228760 5:132228164-132228186 CTCTCCAGACGCCCAGGGGCTGG - Intronic
998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG + Exonic
999767913 5:154755231-154755253 CCCGCCCGTCGCCCAGGGCCCGG + Intronic
1000052684 5:157575885-157575907 CCCTCCAGCCCCCTCCGGGCTGG - Intergenic
1001381893 5:171310983-171311005 CCCGCACGACGCCCGGGGGCTGG - Intronic
1001382135 5:171311868-171311890 CCCGCCCGCACCCCCCGGGCCGG + Exonic
1002055669 5:176596828-176596850 CCCGCGAGCAGCACCGCGGCCGG + Exonic
1002167854 5:177359231-177359253 CCAGCCGGCCAGCCCGGGGCTGG - Intronic
1002521803 5:179796439-179796461 GCCTCCAGCTGCCCCGGGGAGGG + Exonic
1002559375 5:180071426-180071448 ACCGCCCGCCGCCCCCGGGCCGG + Intronic
1002789306 6:426147-426169 TCCGCCTGCAGCCCCGGTGCGGG - Intergenic
1004216996 6:13711983-13712005 CCCGCCAGTCGCTCGTGGGCAGG + Intergenic
1004518285 6:16339213-16339235 CCTGCCAGCCACCAGGGGGCTGG + Intronic
1004690200 6:17987204-17987226 CCCGCCAGCCGCGCCGAGCGGGG + Intronic
1004865980 6:19854380-19854402 TCCGCCTGCAGCCCCGGTGCGGG - Intergenic
1005512292 6:26521785-26521807 CTCACCCGCCGACCCGGGGCCGG - Intergenic
1006008384 6:31021134-31021156 TCCACCTGCGGCCCCGGGGCGGG + Intronic
1006425205 6:33959231-33959253 CCCGTCTGTCGCCCCGGGGGCGG + Intergenic
1007162577 6:39803843-39803865 CTCTCCAGCAGCCCCTGGGCAGG - Intronic
1007451272 6:41941602-41941624 CCCGGCACGCGCCCCGGGCCGGG - Exonic
1007633491 6:43285223-43285245 CCGGCGGGACGCCCCGGGGCGGG - Exonic
1011640374 6:89412002-89412024 CCGGCCGGCCGGCCCGGGGACGG + Exonic
1013155746 6:107490069-107490091 CCCGCGAGCCGAGCCGGGGGCGG - Exonic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1016328177 6:142926823-142926845 CCCGGCGGCCGCCGCAGGGCCGG - Intronic
1017163767 6:151390270-151390292 CGTCCCACCCGCCCCGGGGCGGG + Intronic
1017731812 6:157323637-157323659 CCCTCCTCCCGCGCCGGGGCCGG + Intergenic
1017747859 6:157462779-157462801 CCCGCCAGGCCCTCCAGGGCTGG - Intronic
1017843878 6:158240540-158240562 CCGGCCAGCCGCCCCCGTCCGGG - Intronic
1018393083 6:163355618-163355640 CCCGCCAGCCTCTCAGGGGGAGG + Intergenic
1019360424 7:601875-601897 CTCCCCAGCCCCCCCGGGTCAGG - Intronic
1019415685 7:925622-925644 CCCACCAGCAGCTCCTGGGCAGG + Intronic
1019437145 7:1028168-1028190 CCCACCTGTCGCCGCGGGGCGGG + Intronic
1019530278 7:1499694-1499716 CCCGCCTGCTGCCCGGGGACTGG + Intronic
1019587748 7:1814227-1814249 ACCGCCAGCAGCCCCGGTGACGG - Intergenic
1019989673 7:4682618-4682640 CCCTCCAGCCGCGCCAGCGCCGG - Exonic
1020012685 7:4815344-4815366 CTCTCCAGCCGCCCCGAAGCCGG + Exonic
1020308751 7:6854334-6854356 CACCCCAGCAGGCCCGGGGCCGG - Intergenic
1020383004 7:7566829-7566851 CCCGGGAGGCGCCTCGGGGCGGG - Intergenic
1020796799 7:12686830-12686852 CCCGCGCGCCGCCCGGGCGCCGG - Intergenic
1021452854 7:20798287-20798309 CAAGACAACCGCCCCGGGGCGGG - Intergenic
1021868345 7:24980109-24980131 CCCGCCAGCCGGCCCGGGAGAGG - Exonic
1024275180 7:47671537-47671559 CCCGCCTAACCCCCCGGGGCTGG + Intergenic
1024281589 7:47723537-47723559 CCAGCCCGCAGCCCAGGGGCTGG - Intronic
1024748129 7:52431188-52431210 TCCGCCTGCGGCCCCGGCGCGGG - Intergenic
1027390182 7:77696420-77696442 TCCGCTAGCCGGCGCGGGGCAGG - Intergenic
1029460617 7:100692106-100692128 CCCTCCAGCAGGCCTGGGGCTGG - Intergenic
1030292720 7:107888232-107888254 TCCGCCTGCCGCCCCAGCGCAGG + Intergenic
1031011192 7:116526251-116526273 CCCGCCCGCCGCCAGGGGTCAGG - Intronic
1031406719 7:121395923-121395945 CCCGGCCGCCGCCCCGGCGTGGG - Intronic
1031406898 7:121396478-121396500 CCCGCCCACCGCCCCCGGCCAGG + Intergenic
1032090865 7:128910824-128910846 ACCTCCACCCGCCCCGGGCCCGG + Intergenic
1032306121 7:130733804-130733826 CCCGCCCCCAGCCCCGGCGCGGG - Exonic
1033306833 7:140231244-140231266 CCCGGCAGCCGTCCCAGGCCGGG - Intergenic
1034179645 7:149126973-149126995 CCCGCAGGCGGCCCCGAGGCCGG - Intronic
1034324662 7:150219982-150220004 CCCGCCGGCCACCCTGGGGCTGG - Intergenic
1034509248 7:151520556-151520578 CGCACCAGCCGCCCCGGTGCTGG - Intergenic
1034618067 7:152436018-152436040 CCCGCCCGCCGCCCCCCGCCCGG - Intergenic
1034768530 7:153749249-153749271 CCCGCCGGCCACCCTGGGGCTGG + Intergenic
1035361408 7:158316094-158316116 TCAGCCAGCCGCCGGGGGGCAGG + Intronic
1036650304 8:10637944-10637966 CCTGCCTGCAGCCCCAGGGCTGG + Intronic
1038534255 8:28342747-28342769 CCAGCCAGTAGACCCGGGGCTGG + Intronic
1039936564 8:42051573-42051595 CCCGCCGGCTCCCCCAGGGCGGG + Intronic
1042903061 8:73747085-73747107 CCCGGCAGCCGCCAGGGGGCGGG - Intronic
1045298653 8:100892628-100892650 CCGGCCAGCCGCCCCGGTCCGGG - Intergenic
1045336011 8:101205283-101205305 CCCGCGGCCCGCCCCGGGCCGGG + Exonic
1045510699 8:102810402-102810424 CCCGCCCGCCGTCCCAGGCCGGG + Intergenic
1046249563 8:111612120-111612142 CCAGCCTGCAGCCCCTGGGCTGG + Intergenic
1047097425 8:121640058-121640080 CCCGCCGGCCGCCCGGAGGCAGG - Intronic
1048980722 8:139702355-139702377 CCCACCCACCGCCCCGGCGCGGG - Intronic
1049427067 8:142542418-142542440 CCCGCCAGCCCCCCAGCGGCGGG + Exonic
1049429201 8:142551339-142551361 CCCCACAGCAGCCCCGGGGTGGG - Intergenic
1049471208 8:142775775-142775797 CCCGTCACCTTCCCCGGGGCAGG + Intronic
1049554720 8:143276084-143276106 CGCGCCAGGCGCCCCGCGGCTGG - Exonic
1049600462 8:143505146-143505168 CCCGCCAGCCCCTCCAGGGATGG + Intronic
1049769851 8:144374712-144374734 CCCGCCCGCCGCCTCAGGGCAGG - Intronic
1049788494 8:144462544-144462566 CCCGGCGGCCGCCCCGGGCCCGG + Intronic
1049788533 8:144462628-144462650 CCCGCCGGCCTCCTCGGCGCCGG + Intronic
1051723518 9:20064899-20064921 CCTGCCAGTCACCCTGGGGCAGG + Intergenic
1054274210 9:63052597-63052619 CCCCCCCCCCGCCCCCGGGCAGG + Intergenic
1054400631 9:64712372-64712394 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054434237 9:65196687-65196709 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1057139685 9:92718905-92718927 CCGGCCACGCGCCTCGGGGCTGG + Exonic
1057488613 9:95506050-95506072 CCCGAGAGGCGCCCCGGGGCTGG - Intronic
1057596458 9:96418894-96418916 CCCACCACCCGCCCGGCGGCTGG + Intergenic
1059061374 9:111038192-111038214 CTCTCCTGCCGCCCCCGGGCTGG + Intronic
1059123276 9:111661545-111661567 CGCGGGTGCCGCCCCGGGGCGGG - Exonic
1060407906 9:123381869-123381891 CCCTCCAGCTTCCCTGGGGCCGG - Exonic
1060523509 9:124307852-124307874 ACCGCCAGCCGCCGAGGGGTGGG + Intronic
1060555377 9:124504981-124505003 CCAACCCGCCGCGCCGGGGCCGG + Intronic
1060590684 9:124814458-124814480 CCCCCCAGGAGCCCCGAGGCCGG + Exonic
1060974291 9:127755327-127755349 CCCTCCAGCCGGCCAGGGGAGGG + Intronic
1061415665 9:130445575-130445597 GCCGCCAGCCCCACCGGGGAGGG - Intronic
1061828264 9:133275074-133275096 CCCGACAGCCGGGCCGGGGTGGG - Intronic
1061856663 9:133445327-133445349 CCCGCCTGGCGTCCAGGGGCTGG + Intronic
1062008089 9:134251563-134251585 GCCTCCAGCGGCCCCGGGGCCGG - Intergenic
1062281775 9:135755050-135755072 TCCCCCAGCCACCCTGGGGCTGG - Intronic
1062373189 9:136250809-136250831 CTAAGCAGCCGCCCCGGGGCTGG + Intergenic
1062478952 9:136742694-136742716 CCCGGCAGCCGCCCAGGAGCAGG - Intronic
1062491734 9:136808157-136808179 CTCGCCGGCCGCGCCCGGGCTGG + Exonic
1062542040 9:137045832-137045854 GCCGCGGGGCGCCCCGGGGCCGG - Intronic
1062548938 9:137077278-137077300 CCCCCCAGCCCCCCCGCGTCCGG - Intergenic
1062696193 9:137877607-137877629 CGCGCCTCCCACCCCGGGGCTGG - Intergenic
1203792686 EBV:160154-160176 GCCTCCGGCCGCCCCGGGCCCGG + Intergenic
1203470433 Un_GL000220v1:113471-113493 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203471374 Un_GL000220v1:116646-116668 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1203478254 Un_GL000220v1:157443-157465 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203479195 Un_GL000220v1:160618-160640 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1185469431 X:373778-373800 CCCGCCAGGCGCTCTGGGGCCGG + Intronic
1186350119 X:8731941-8731963 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1192204722 X:69088374-69088396 CCAGCCAGCTGTCCCAGGGCAGG - Intergenic
1194127753 X:90040989-90041011 CCCCGCAGCCGCCAGGGGGCGGG - Intergenic
1197147450 X:123185284-123185306 CCCTCCAGGCGCCCAGGAGCCGG - Intronic
1198005462 X:132489300-132489322 CCCGCCGGCCGGCCCCGGGAAGG - Intronic
1198276315 X:135098318-135098340 CCCGCGACCCGGCCGGGGGCGGG + Intergenic
1200056284 X:153463089-153463111 CCTGCCAGCAGCCCTGGGGGTGG + Intronic
1200107807 X:153724500-153724522 CCGGCCCTCCGCTCCGGGGCGGG - Intronic
1200224759 X:154411447-154411469 ACTTCCCGCCGCCCCGGGGCTGG + Intronic
1200231624 X:154446585-154446607 CCCGCCCGCAGCCCCTGGGGAGG + Intronic