ID: 904546475

View in Genome Browser
Species Human (GRCh38)
Location 1:31277635-31277657
Sequence TTCTGCCAATGCTTCATTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904546475_904546477 -1 Left 904546475 1:31277635-31277657 CCGAAAATGAAGCATTGGCAGAA 0: 1
1: 0
2: 0
3: 33
4: 415
Right 904546477 1:31277657-31277679 AAAATTTGAATGTTTGTGGACGG 0: 1
1: 0
2: 1
3: 38
4: 471
904546475_904546476 -5 Left 904546475 1:31277635-31277657 CCGAAAATGAAGCATTGGCAGAA 0: 1
1: 0
2: 0
3: 33
4: 415
Right 904546476 1:31277653-31277675 CAGAAAAATTTGAATGTTTGTGG 0: 1
1: 0
2: 6
3: 47
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904546475 Original CRISPR TTCTGCCAATGCTTCATTTT CGG (reversed) Intronic
902204855 1:14860832-14860854 TTCTTCCAATAATTTATTTTAGG - Intronic
904546475 1:31277635-31277657 TTCTGCCAATGCTTCATTTTCGG - Intronic
909508590 1:76424296-76424318 AACTGCCAATGGTTCACTTTTGG - Intronic
910722905 1:90307060-90307082 TTGTGCCAGAGCTTCATTGTTGG - Intergenic
910899349 1:92102931-92102953 CTCTGCCAAAGCTTCTTTATTGG - Intronic
910901540 1:92126677-92126699 TGCTGTTACTGCTTCATTTTGGG + Intronic
916156009 1:161849209-161849231 CTCACTCAATGCTTCATTTTAGG + Intronic
916972752 1:170042016-170042038 TTCTGCTAATGTTTCCTTCTGGG - Intronic
918632342 1:186732642-186732664 TGCATCCAAAGCTTCATTTTAGG - Intergenic
919120898 1:193339129-193339151 TTTTGCGAAAGCTCCATTTTTGG + Intergenic
919808775 1:201396527-201396549 TTCTGTCTATGATTCAATTTGGG - Intronic
920037856 1:203077144-203077166 GTCTGCCTATGCTTCTTATTAGG - Exonic
920654725 1:207867162-207867184 TTCTTCCACTGCAACATTTTGGG + Intergenic
921642439 1:217571394-217571416 GTCTAACAATGCTTCATTTTGGG - Intronic
921760014 1:218902300-218902322 TTCTGCCACAGCTCCACTTTGGG + Intergenic
922093753 1:222423179-222423201 TCCTGCCAATGCTACATCTCTGG + Intergenic
1062819111 10:520711-520733 TGCTGCCAAAGTTTCACTTTAGG + Intronic
1063658613 10:8016786-8016808 TTCAGCCCATGCTACATTTAAGG + Intergenic
1064359412 10:14650110-14650132 TTTTGTCAATGCTACATTTGAGG + Intronic
1064406164 10:15065606-15065628 TTCTGACAATTCATCATCTTTGG - Exonic
1064628990 10:17290074-17290096 TTCTGCTAATCCTTCATTTCAGG + Intergenic
1065620583 10:27576995-27577017 TTCTTAAAATACTTCATTTTAGG + Intergenic
1070268368 10:74926890-74926912 CTGTGTCAATCCTTCATTTTCGG + Intronic
1072482564 10:95823333-95823355 TTCTGGCAATGCTTTGTTCTGGG - Exonic
1072600769 10:96925954-96925976 TTCTGTTAATGTTTCATATTTGG + Intronic
1073421715 10:103429304-103429326 TACTGCCAACCCTTCTTTTTTGG + Intronic
1074790270 10:116879600-116879622 TTCTGGCCTTTCTTCATTTTAGG - Intronic
1075708175 10:124515198-124515220 TTCTGCCTCTGTTTCATTTTGGG + Intronic
1079941693 11:26688601-26688623 TTCTGCAAATAATTCACTTTAGG + Intronic
1080041454 11:27763721-27763743 TTCTGTTGATGGTTCATTTTGGG + Intergenic
1081396355 11:42590788-42590810 TTCTGTCAATGATTAAATTTGGG - Intergenic
1082330995 11:51215767-51215789 TTCTGAGAATGCTTCAGTCTAGG - Intergenic
1082355827 11:51576548-51576570 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082366022 11:51725324-51725346 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082366729 11:51735524-51735546 TTCTGATAATGCTTCTTTCTAGG - Intergenic
1082373757 11:51837535-51837557 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082436659 11:52749069-52749091 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1082437253 11:52757568-52757590 TTCTGAGAATGCTTCAGTCTAGG - Intergenic
1082438564 11:52776444-52776466 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1082452658 11:52980267-52980289 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1082454623 11:53009169-53009191 TTCTGACAATGCTTCTGTCTAGG - Intergenic
1082476032 11:53318989-53319011 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1082485702 11:53458243-53458265 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082499206 11:53652503-53652525 TTCTGAGAATGCTTCAGTCTAGG - Intergenic
1082502865 11:53705736-53705758 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1082515224 11:53884287-53884309 TTCTGAGAATGCTTCGGTTTAGG - Intergenic
1082519967 11:53953164-53953186 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082520515 11:53960821-53960843 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1082532450 11:54133572-54133594 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082538491 11:54221145-54221167 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1082542319 11:54276579-54276601 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1085173781 11:74469453-74469475 TTCTCCCATTTCTTTATTTTTGG + Intergenic
1086144772 11:83539600-83539622 TTCTGCCAAATTTTCTTTTTAGG - Intronic
1087802003 11:102514658-102514680 TTTTGTCTATTCTTCATTTTTGG + Intergenic
1088303725 11:108386313-108386335 TTCTGCCCATGCTTTAAATTTGG - Intronic
1092315668 12:7410921-7410943 TTATGGCAATGCTTGAATTTTGG - Intronic
1095037317 12:37401190-37401212 TTCTGAGAATGCTTCAGTCTAGG - Intergenic
1095037467 12:37403910-37403932 TTCTGAGAATGCTTCAGTCTAGG - Intergenic
1096863454 12:54546946-54546968 TACTGCCAAAGCATCATTTTTGG + Exonic
1097127392 12:56785476-56785498 TTCTGGGAATGCTTTATTTAAGG - Intronic
1097785478 12:63754101-63754123 GTCTGCCAATTCTCCATTTAGGG - Intergenic
1097809707 12:64005012-64005034 TTCTGCAAATGCATATTTTTAGG - Intronic
1099156453 12:79182391-79182413 TTCAGGAAATGCTTAATTTTAGG - Intronic
1099899185 12:88685701-88685723 TTTTGCTTTTGCTTCATTTTTGG + Intergenic
1100702942 12:97167104-97167126 TTCTTCCAATCCTCCATTTAGGG - Intergenic
1100904236 12:99279194-99279216 TTCTGCCAACCCTTCTTTTCAGG + Intronic
1101076771 12:101138162-101138184 TCCTGCAAATACTTCATTTTTGG - Intergenic
1104343051 12:127969218-127969240 TTCTCTCAATGTTCCATTTTGGG - Intergenic
1104830190 12:131745290-131745312 TTCTGGCAATTGTTCGTTTTAGG - Intronic
1105091055 13:16289671-16289693 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1106885813 13:34183066-34183088 TTCTGTCAATGCTTCATGTGAGG + Intergenic
1107418192 13:40220748-40220770 TTCTGAGAATTCTTTATTTTTGG + Intergenic
1110068594 13:71143242-71143264 TTCTGCTTATGTTTCATTTTAGG + Intergenic
1110173878 13:72534079-72534101 TTCTTAAAATGCATCATTTTTGG - Intergenic
1110493507 13:76137044-76137066 TGCTGCCACTGCTCAATTTTAGG - Intergenic
1111325280 13:86686304-86686326 TTCTGCCAAAGCATCATTCTGGG - Intergenic
1112940958 13:104861289-104861311 TTCTGGTAATGCTTCAGTTTGGG + Intergenic
1117910693 14:60636005-60636027 TTCTACCACTGCATCATTCTAGG + Intergenic
1119203043 14:72772716-72772738 TTATATCAATGCTCCATTTTTGG - Intronic
1119565575 14:75626345-75626367 TTGTGCCAGAGTTTCATTTTAGG + Intronic
1120496030 14:85236879-85236901 TTCTGCCTCTTCTTCAATTTGGG + Intergenic
1122051705 14:99065371-99065393 TTCTGCCAAGGCTCCATCCTGGG + Intergenic
1123148781 14:106160740-106160762 TTCTGTCATTGCTTCTGTTTAGG + Intergenic
1125445308 15:39748158-39748180 TTCTTCCAGTTCTTCTTTTTTGG + Intronic
1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG + Intergenic
1126846096 15:52761703-52761725 TTCTGCCATTGTCTAATTTTGGG - Intronic
1127730707 15:61799468-61799490 TTCTCTCAATGTTTCATTTCTGG + Intergenic
1127762998 15:62158422-62158444 TTCAGCCTATGTCTCATTTTAGG - Intergenic
1127975460 15:63993762-63993784 TTGGTCCAATCCTTCATTTTTGG - Intronic
1128377691 15:67089067-67089089 TTGTGCAAATGCTTTATTTGGGG - Intronic
1129087047 15:73104998-73105020 TTCTGCCTATGATACAGTTTGGG - Intronic
1130367817 15:83256251-83256273 TGCTGCAAATGCTGAATTTTAGG + Exonic
1133302362 16:4790431-4790453 TTCTGCCAGTTCTTCCTTCTGGG + Intronic
1135113110 16:19705916-19705938 ATCTGCCATTGATTCATTTGCGG + Exonic
1135866797 16:26110629-26110651 TTCTGCAATTGCTTCCTTGTGGG + Intronic
1137839298 16:51625221-51625243 TTTTGCCATAGCCTCATTTTGGG + Intergenic
1145448700 17:23213182-23213204 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145467259 17:23483626-23483648 TTCTGACAATGCTTCCATCTAGG - Intergenic
1145482155 17:23699930-23699952 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145503948 17:24017335-24017357 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145516685 17:24202417-24202439 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145553350 17:24736089-24736111 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1145575782 17:25062262-25062284 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1145582334 17:25157273-25157295 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145600078 17:25416013-25416035 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1145610407 17:25566175-25566197 TTCTGACAATGCTTCTGTTTTGG - Intergenic
1145612611 17:25598258-25598280 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145617985 17:25676990-25677012 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145639891 17:25994529-25994551 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1145652914 17:26183718-26183740 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145653477 17:26191860-26191882 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145658874 17:26270250-26270272 TTCTGACAATGCTTCTATCTAGG - Intergenic
1145673987 17:26490228-26490250 TTCTGTGAATGCTTCTGTTTTGG - Intergenic
1145682225 17:26609521-26609543 TTCTGAGAATGCTTCTCTTTAGG - Intergenic
1145707262 17:26883552-26883574 TTCTGAGAATGCTTCTGTTTAGG + Intergenic
1146099935 17:29971455-29971477 TTCTGTTACTGCTTCATTATGGG + Intronic
1148511757 17:48176943-48176965 TTCTGCTAATCCTCCCTTTTGGG - Intronic
1150628586 17:66859687-66859709 TTCTGCTGATTCTTCCTTTTGGG - Intronic
1150755996 17:67914426-67914448 TTCTGCAAATCCTTCATTGCAGG - Intronic
1153109894 18:1573673-1573695 TTCTGCCAAATCTTGATTTTTGG + Intergenic
1154556352 18:15759935-15759957 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1154557934 18:15782368-15782390 TTCTGCGAATGCTTCTGTCTAGG - Intergenic
1154916316 18:20732785-20732807 TTCTGAGAATGCTTCTTTCTCGG - Intergenic
1154923221 18:20840638-20840660 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1154923427 18:20844040-20844062 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1154923633 18:20847443-20847465 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1154923885 18:20851329-20851351 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1154924092 18:20854730-20854752 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1156560479 18:38119770-38119792 TTCTGCCAGTCTTTCAATTTGGG - Intergenic
1156661053 18:39347121-39347143 TGCAGCCAATTCTTCATTCTGGG + Intergenic
1156742774 18:40352563-40352585 TTCTACCAATGCTTAAATATTGG + Intergenic
1157068952 18:44383663-44383685 TTCTGGGGCTGCTTCATTTTAGG - Intergenic
1157295342 18:46438121-46438143 TTGTGCCAATGTGTCATTTTTGG - Intronic
1159295616 18:66483091-66483113 TTCAGCAAATGTTTCAATTTAGG + Intergenic
1159567045 18:70063260-70063282 TACTGCCAATACTTAATTGTTGG + Intronic
1160055377 18:75474039-75474061 TTCTCCCAAAACTTCATTTTTGG + Intergenic
1162132061 19:8532261-8532283 TTCTGCAAAAGCTTCCTTTCTGG - Intronic
926564394 2:14453867-14453889 TTCTGCCCTTGTGTCATTTTAGG - Intergenic
930841988 2:55857337-55857359 TTCTGCCCCTGCTTGATATTTGG + Intergenic
931007337 2:57866650-57866672 CTCTGCCAATAATTCACTTTGGG + Intergenic
931926243 2:67075542-67075564 TTCTACCAGTACATCATTTTGGG - Intergenic
933286018 2:80385435-80385457 GTCTGCCAATGCTTTAATCTAGG + Intronic
933793044 2:85898585-85898607 TTCTGTCAGTGTTGCATTTTGGG - Intergenic
937575921 2:123421941-123421963 TTCAGCAAATGCTTGATGTTTGG + Intergenic
938053647 2:128197114-128197136 TTCTGCTAAGCCTTCATTTTAGG - Intergenic
939057956 2:137385389-137385411 TTCTTGCTATGCTTCATTTTTGG + Intronic
939530658 2:143356603-143356625 TGGGGCCAATGCTTTATTTTGGG - Intronic
939780521 2:146441024-146441046 TTCTGCTAATGACTCATATTAGG - Intergenic
940246831 2:151628176-151628198 TACTGCCATTTCTTCATCTTGGG + Intronic
940797335 2:158094496-158094518 TTCTGTAAATGCTTCACCTTAGG - Intronic
940912218 2:159218752-159218774 ATCCGCCAATGCTGCATCTTAGG + Intronic
941201517 2:162517069-162517091 TTCTGCCACTGCTTTTTTTAAGG + Intronic
941767734 2:169316489-169316511 TTCTGCCAGTGCCTCATAGTGGG + Intronic
943914226 2:193607519-193607541 TTCTGCCAAGGTTTCTTTCTAGG - Intergenic
944475663 2:200102701-200102723 TTTTGCCAATGTTTTATTTAGGG + Intergenic
944685726 2:202116180-202116202 TTATGCCAATGATTCAGGTTGGG + Intronic
945377050 2:209091017-209091039 ATATGTTAATGCTTCATTTTGGG - Intergenic
945413152 2:209536331-209536353 TTATCTCTATGCTTCATTTTGGG + Intronic
945731414 2:213541114-213541136 TTCTGTCATTGTTTCATTTACGG + Intronic
945956989 2:216095709-216095731 TTCTTGCAATACTTTATTTTGGG - Intronic
947145537 2:227060678-227060700 TTTTGCCTATACTTCATTTAAGG - Intronic
1171285750 20:23936993-23937015 TTTTCACAATGCCTCATTTTGGG + Intergenic
1174117383 20:48236228-48236250 TTTTGCCAATGCAGCATTTGGGG - Intergenic
1174225949 20:49000161-49000183 ATATGACAATGCTTCATTTCAGG - Intronic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1174995671 20:55565650-55565672 TTCCTCAAATGTTTCATTTTTGG - Intergenic
1175332108 20:58172340-58172362 TTCTACCATTGCTAAATTTTGGG + Intergenic
1177745108 21:25202855-25202877 CTCTGCCAATCCTTGATTTTGGG + Intergenic
1177796248 21:25781161-25781183 TTGTCCCAATGCGTCATATTAGG - Intergenic
1178060029 21:28842719-28842741 TTTTGCCAATGATTTATTTCAGG + Intergenic
1179335971 21:40454352-40454374 TTTTGACAATCCTTCAATTTGGG - Intronic
1179766850 21:43580849-43580871 TTCTGACAATGCCACATATTTGG + Intronic
1181368783 22:22399823-22399845 ATCTCACAATGCTTCATCTTGGG + Intergenic
1182096965 22:27632540-27632562 TACTTCCAATGCTTCCTTTACGG - Intergenic
1182326809 22:29519387-29519409 TTCTGCTCATGCCTCATATTTGG + Intronic
1182652196 22:31861118-31861140 TTCTGCTAATGCTTCGCATTTGG + Intronic
1184935924 22:47720449-47720471 TGCTGTCAATGTTTCATTTTGGG - Intergenic
1184956983 22:47894981-47895003 TTCTGCCTAGGTTTCATGTTTGG - Intergenic
952240729 3:31529286-31529308 TTCTGTAAATGCTTCCTTATTGG + Intergenic
953137826 3:40198680-40198702 TTCCTCCAATGTTTCATTTTTGG + Intronic
955242812 3:57194376-57194398 TTCTGCCTATGCTTTAATCTTGG - Intergenic
956292390 3:67675078-67675100 ATATGCCAATGATTCATTTCTGG + Intergenic
956998995 3:74862686-74862708 TCCTGCCATAGCTTCATATTTGG + Intergenic
957538359 3:81534989-81535011 TTATTCCTAAGCTTCATTTTGGG - Intronic
958215920 3:90575673-90575695 TTCTGACAATGCTTCTGTCTAGG + Intergenic
958216573 3:90588767-90588789 TTCTGACAATGCTTCTGTCTAGG + Intergenic
958615771 3:96492241-96492263 TTCTGCCAAAGGTTCATCATTGG + Intergenic
960375350 3:116893643-116893665 ATCTGCCAGTGCTTCAATCTTGG - Intronic
960473784 3:118098978-118099000 TTTTGCCAGTGCATTATTTTGGG + Intergenic
963006634 3:140732321-140732343 TTGTGCCAATGATTTGTTTTGGG - Intergenic
963115033 3:141720817-141720839 TTGGGCCAATGCATCATCTTGGG + Intergenic
964039317 3:152239963-152239985 TTCTCCCCATCCTCCATTTTAGG - Intergenic
964298460 3:155260160-155260182 TCCTGGAAATGCCTCATTTTGGG - Intergenic
964603762 3:158535717-158535739 TGCTTCAATTGCTTCATTTTTGG - Intronic
964700830 3:159564318-159564340 CTCTCCCCATGCTCCATTTTGGG + Intronic
965709432 3:171542300-171542322 TTCTCCCTGTGCTTCATTTTGGG + Intergenic
966046227 3:175553620-175553642 TCCTGAAAATGATTCATTTTGGG + Intronic
968261512 3:197328590-197328612 TTGTGCTAATGCTTAATTTTTGG - Intergenic
968374179 4:24243-24265 TTATCCCAAGCCTTCATTTTGGG - Intergenic
970037485 4:11754417-11754439 TTCTGCTTCTGCTTCATTTTTGG - Intergenic
970468736 4:16354088-16354110 TTGTCCCAATGCTGCCTTTTTGG + Intergenic
971503680 4:27343638-27343660 TGCTGCCAAGGCTTAATTCTTGG - Intergenic
973425284 4:50055336-50055358 TTCTGAGAATGCTTCCTTTCTGG - Intergenic
973462638 4:50672911-50672933 TTCTGACAATGCTTCCGTCTAGG - Intergenic
973473946 4:50859069-50859091 TTCTGACAATGCTTCCCTCTAGG - Intergenic
973488887 4:51106469-51106491 TTCTGACAATGCTTCCGTCTAGG - Intergenic
976027538 4:80708223-80708245 TTCAACCAATTCTTCCTTTTGGG + Intronic
977213060 4:94243417-94243439 TGCTGCCAATGCTCCGTTTTAGG + Intronic
977958066 4:103053310-103053332 TTCAGATAATGCTTCAGTTTTGG + Intronic
978026599 4:103883233-103883255 TTATGACAATGCTTTATTTCTGG + Intergenic
978423505 4:108558959-108558981 TTCTGCCACTGCCTTATTCTTGG + Intergenic
978818703 4:112938563-112938585 TTTTGCCATTACTTGATTTTTGG - Intronic
979274180 4:118796521-118796543 TGCTGCCAACACTTCCTTTTGGG - Intronic
979389463 4:120110662-120110684 TTCTGCCAAGATTTCATATTTGG - Intergenic
980141765 4:128925757-128925779 TTCTCACTATGTTTCATTTTTGG + Intronic
980252177 4:130331616-130331638 TTCTGCCAATCATTGAGTTTTGG - Intergenic
981828706 4:148975773-148975795 TTCTGCCAATACTCTATTTTTGG + Intergenic
981943931 4:150318590-150318612 TTAAGTCTATGCTTCATTTTAGG - Intronic
983927217 4:173415100-173415122 TTCTGCCAACTCTCCAATTTGGG - Intergenic
984030136 4:174594051-174594073 TGCTGCCAATGAGTCAATTTAGG - Intergenic
985321773 4:188720850-188720872 ATCTGTCTATGCTTCATTTTTGG - Intergenic
985460551 4:190102020-190102042 TTATCCCAAGCCTTCATTTTGGG + Intergenic
987844697 5:23267760-23267782 TCCTGCCAAGGCTTCATTCAGGG + Intergenic
988058076 5:26126386-26126408 TTTTGGCAATGTATCATTTTGGG + Intergenic
988520434 5:31940550-31940572 TTCTACCAATGAGTCACTTTTGG - Intronic
989214017 5:38885035-38885057 GCCTGCCAATGTTTCATTTCGGG - Intronic
989921665 5:49812795-49812817 TTCTGACAATGCTTCTATCTAGG - Intergenic
989930424 5:49942754-49942776 TTCTGACAATGCTTCTATCTAGG - Intergenic
992535201 5:77694246-77694268 TTATCCTCATGCTTCATTTTAGG + Intronic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
993719385 5:91307251-91307273 TTGTGTCATTGCTTCATTTTTGG + Intergenic
994951220 5:106465748-106465770 CTGTGCCAATGCTTCTCTTTTGG - Intergenic
995074753 5:107969510-107969532 TTCTGCCAGTGAATAATTTTGGG - Intronic
995274930 5:110267295-110267317 TTGTACCAAATCTTCATTTTGGG - Intergenic
996757481 5:126949845-126949867 TTCTGCCACTCCTTATTTTTTGG - Intronic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
998047911 5:139004546-139004568 TTCTGTCTATGCTGCACTTTAGG + Intronic
999450224 5:151672333-151672355 TCCTCGCAATGCTTTATTTTGGG + Intronic
999616743 5:153433031-153433053 TTCTCCCAGTCCTTCACTTTGGG - Intergenic
1001116862 5:168947487-168947509 TTCTTCCTATGCCTCCTTTTTGG - Intronic
1002755112 6:151574-151596 TTATTCCAAGCCTTCATTTTGGG - Intergenic
1003656362 6:8014024-8014046 TACTGTCAAAGCTTCATTCTTGG - Exonic
1004277226 6:14248505-14248527 TTATGCCTATGATCCATTTTAGG - Intergenic
1006776441 6:36596396-36596418 TTCTAGAAATGCTTTATTTTGGG + Intronic
1008006576 6:46416300-46416322 TTCTGCCATTCCTTCATTATTGG - Intronic
1008825082 6:55684432-55684454 TCCTTCTATTGCTTCATTTTAGG + Intergenic
1008847047 6:55979762-55979784 CTTTGTCAATGCTTCCTTTTTGG + Intergenic
1009980907 6:70724550-70724572 TTCCATTAATGCTTCATTTTAGG + Intronic
1012185736 6:96214111-96214133 TTCTCCCAAAACTTTATTTTTGG + Exonic
1012569752 6:100709201-100709223 TTCTGCCAAAAGTCCATTTTAGG + Intronic
1014597954 6:123369041-123369063 TCCTGCCAATGCCTGAATTTTGG - Intronic
1016098688 6:140070292-140070314 TTCTGCATATACTTCATATTTGG + Intergenic
1016653315 6:146487941-146487963 TTCTGCCATTGAATTATTTTGGG + Intergenic
1017220228 6:151957796-151957818 TTATGCCAAGGCTTTATCTTGGG - Intronic
1017591392 6:155981410-155981432 TTCTGCCACTCCTTCATAGTTGG - Intergenic
1018359847 6:163056400-163056422 TTCAGCCATTGTTTCATTGTGGG + Intronic
1019985475 7:4652313-4652335 TTCTGCTTTTGTTTCATTTTTGG + Intergenic
1020497203 7:8870768-8870790 TTTTGCCAATTCTACCTTTTGGG - Intergenic
1021702494 7:23333520-23333542 TTATGCTTAAGCTTCATTTTGGG - Intronic
1021791142 7:24206979-24207001 TCCTGCCAATACTTGGTTTTGGG - Intergenic
1022158100 7:27680520-27680542 TTCTTCCACTGGTTAATTTTAGG + Intergenic
1022958370 7:35401920-35401942 TTCTGCAAATGTTTCCTTCTTGG - Intergenic
1023283439 7:38594550-38594572 ATCTGCCAAGGCTTCATCTGGGG + Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024959016 7:54955980-54956002 CTCTGCCTATTCTTCATTTTGGG + Intergenic
1025147527 7:56517744-56517766 TGCTGCCATTTCTTCATTCTGGG - Intergenic
1026364275 7:69632001-69632023 TTCTGGTAATGCTGCATTTTAGG + Intronic
1027342232 7:77221862-77221884 TTCTGCAAGTGTTTCGTTTTGGG - Intronic
1027689325 7:81322524-81322546 TTCTGCCAAAAGTTTATTTTTGG + Intergenic
1028039484 7:86031495-86031517 TTCCCCAAATGCTTCATATTTGG - Intergenic
1030109264 7:106012687-106012709 TTCTGCCCTTGCTACCTTTTGGG - Intronic
1030700398 7:112632063-112632085 TTCTACCTATGCTGCCTTTTTGG + Intergenic
1030869786 7:114741037-114741059 TTCTGAAAATGCTGCATATTTGG + Intergenic
1031841432 7:126744360-126744382 TTCTGCCAATGATAAAATTTGGG + Intronic
1034196495 7:149252368-149252390 TCTTGCCAATGCTTCCTTTCAGG - Intronic
1037097301 8:15001019-15001041 TTTTGCCAGAGCTTCAGTTTTGG - Intronic
1037110236 8:15157107-15157129 TTCTGCCTCTGCATCATTTTAGG - Intronic
1037210678 8:16383205-16383227 TGCTGCTTTTGCTTCATTTTTGG + Intronic
1037568908 8:20141905-20141927 ATCTGCCACTGGCTCATTTTGGG - Intergenic
1042639842 8:70921763-70921785 TTCTGCTAATTATACATTTTAGG + Intergenic
1044279380 8:90338515-90338537 TTCTGCTAATGCCTCGGTTTTGG - Intergenic
1046199558 8:110906265-110906287 TTCTGCAAATGCCTATTTTTTGG + Intergenic
1050187974 9:2995325-2995347 TTCTGCCAATGCTACCTACTTGG - Intergenic
1052712941 9:32078947-32078969 TTCTCACAAAGCTTCATTTAAGG - Intergenic
1052966885 9:34347079-34347101 CTCTGCCGATGCTGCACTTTGGG + Intergenic
1053124735 9:35571268-35571290 TTCTGCCAAAGCTTCAGATGAGG + Intergenic
1053440514 9:38112392-38112414 TTCTGTCCATGCTTCATTAGGGG - Intergenic
1054926005 9:70589385-70589407 TTTTGACAATGCCACATTTTGGG - Intronic
1055477912 9:76681656-76681678 TTCCACCACTGCTTCAATTTAGG + Intronic
1055577607 9:77675943-77675965 TGCTGCCAAGGCTTCTTTCTTGG - Intergenic
1057626411 9:96681632-96681654 TCCTGCCCATGCTTTATTTTAGG - Intergenic
1058695427 9:107555034-107555056 TCTTGCTAATGCTTCATCTTTGG + Intergenic
1058856012 9:109063054-109063076 TTCTGACTATGCTTCATGCTTGG - Intronic
1186849493 X:13566671-13566693 TTCTGACAATGCTTTGCTTTTGG + Intergenic
1186932457 X:14409551-14409573 ATCTTCCAATGCTTCCCTTTAGG + Intergenic
1187806235 X:23124240-23124262 TTCAGCCAATGCTTCTTTCATGG + Intergenic
1189804772 X:44724373-44724395 TTCTGCCAATTCTTCCAATTAGG + Intergenic
1191278664 X:58633860-58633882 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191281096 X:58666609-58666631 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191281251 X:58668666-58668688 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191282011 X:58678958-58678980 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191284315 X:58709814-58709836 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191285633 X:58727311-58727333 TTCTGAGAATGCTTCCGTTTAGG - Intergenic
1191286145 X:58734159-58734181 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191288268 X:58762845-58762867 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191289502 X:58779299-58779321 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191294195 X:58841454-58841476 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191294344 X:58843511-58843533 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191301275 X:58936076-58936098 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191302945 X:58958357-58958379 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191308748 X:59035438-59035460 TTCTGAGAATGCTTCCGTTTAGG - Intergenic
1191308797 X:59036116-59036138 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191309574 X:59046406-59046428 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191312020 X:59079174-59079196 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191313102 X:59093578-59093600 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191313717 X:59101808-59101830 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191318605 X:59167105-59167127 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191318915 X:59171220-59171242 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191319677 X:59181503-59181525 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191319984 X:59185618-59185640 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191320442 X:59191790-59191812 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191320908 X:59197957-59197979 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191324584 X:59247324-59247346 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191327650 X:59288456-59288478 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191327960 X:59292570-59292592 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191332069 X:59347774-59347796 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191333895 X:59372293-59372315 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191336525 X:59407262-59407284 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191337445 X:59419601-59419623 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191337913 X:59425776-59425798 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191341299 X:59471033-59471055 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191341762 X:59477205-59477227 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191342442 X:59485877-59485899 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191343353 X:59498165-59498187 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191344424 X:59512564-59512586 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191353444 X:59633225-59633247 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191355441 X:59659970-59659992 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191356520 X:59674374-59674396 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191356988 X:59680545-59680567 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191360655 X:59729407-59729429 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191362799 X:59758211-59758233 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191363561 X:59768322-59768344 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191363848 X:59772095-59772117 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191364004 X:59774152-59774174 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191364621 X:59782379-59782401 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191365384 X:59792499-59792521 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191369569 X:59848720-59848742 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191370340 X:59859004-59859026 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191370953 X:59867230-59867252 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191371870 X:59879575-59879597 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191377977 X:59961003-59961025 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191382112 X:60016220-60016242 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191382421 X:60020335-60020357 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191385940 X:60067286-60067308 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191387009 X:60081689-60081711 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191387457 X:60087689-60087711 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191389872 X:60119915-60119937 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191390937 X:60134142-60134164 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191391860 X:60146483-60146505 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191392631 X:60156770-60156792 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191394313 X:60179394-60179416 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191395702 X:60197912-60197934 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191399217 X:60245211-60245233 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191399891 X:60254289-60254311 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191404462 X:60315305-60315327 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191404613 X:60317362-60317384 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191406119 X:60337586-60337608 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191409921 X:60389009-60389031 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191410454 X:60396031-60396053 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191414906 X:60455675-60455697 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191419394 X:60515329-60515351 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191421236 X:60540020-60540042 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191421841 X:60548080-60548102 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191422779 X:60560658-60560680 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191423088 X:60564772-60564794 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191423690 X:60572999-60573021 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191424151 X:60579170-60579192 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191430735 X:60667616-60667638 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191431034 X:60671731-60671753 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191431188 X:60673787-60673809 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191432548 X:60692293-60692315 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191435123 X:60726404-60726426 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191439279 X:60781950-60781972 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191440122 X:60793425-60793447 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191444905 X:60857211-60857233 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191445823 X:60869552-60869574 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191446602 X:60879841-60879863 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191446761 X:60881897-60881919 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191450898 X:60937283-60937305 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191452126 X:60953740-60953762 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191452967 X:60964876-60964898 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191453268 X:60968991-60969013 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191454040 X:60979277-60979299 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191459084 X:61046996-61047018 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191460312 X:61063453-61063475 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191460930 X:61071683-61071705 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191463405 X:61104598-61104620 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191464490 X:61118994-61119016 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191469352 X:61184467-61184489 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191471743 X:61216351-61216373 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191473421 X:61238981-61239003 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191475704 X:61269662-61269684 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191476773 X:61284061-61284083 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191477240 X:61290236-61290258 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191479865 X:61325040-61325062 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191481387 X:61345443-61345465 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191482584 X:61361561-61361583 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191483060 X:61367732-61367754 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191488541 X:61441460-61441482 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191489898 X:61459636-61459658 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191492505 X:61494616-61494638 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191493125 X:61502845-61502867 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191495388 X:61532999-61533021 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191497219 X:61557339-61557361 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191500577 X:61602264-61602286 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191500730 X:61604321-61604343 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191503188 X:61636888-61636910 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191503953 X:61647178-61647200 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191507180 X:61690373-61690395 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191512827 X:61766285-61766307 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191516632 X:61817204-61817226 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191519104 X:61850129-61850151 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191520186 X:61864528-61864550 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191525975 X:61942184-61942206 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191528873 X:61980935-61980957 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191529029 X:61982992-61983014 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191530493 X:62002542-62002564 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191530646 X:62004600-62004622 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191532970 X:62035459-62035481 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191535881 X:62074437-62074459 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191536809 X:62086782-62086804 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191537726 X:62099125-62099147 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191550635 X:62271955-62271977 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191554329 X:62321160-62321182 TTCTGAGAATGCTTCTGTTTAGG - Intergenic
1191554935 X:62329388-62329410 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191557989 X:62370179-62370201 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191559839 X:62394865-62394887 TTCTGAGAATGCTTCTTTCTAGG - Intergenic
1191560095 X:62398302-62398324 TTCTGAGAATGCTTCCGTTTAGG - Intergenic
1191681674 X:63847051-63847073 CTCTGACAAAGTTTCATTTTGGG - Intergenic
1193114416 X:77762926-77762948 TTTTGCAAATAGTTCATTTTAGG + Intronic
1193633296 X:83916805-83916827 TTCTGAAAATGTGTCATTTTTGG - Intergenic
1195684491 X:107573247-107573269 TACTGCCACTGCTTCATTTCAGG - Intronic
1196126432 X:112105504-112105526 TTCTTCCAATGCATGATTGTTGG + Intergenic
1196605576 X:117654025-117654047 TTTTGCCAATTTTTCCTTTTTGG - Intergenic
1196713768 X:118791674-118791696 TAGTGCCAATGCTTATTTTTAGG - Intronic
1198089071 X:133309866-133309888 TTCTCCCATGGCTTCATTCTGGG + Intronic
1201648191 Y:16258739-16258761 TTCTCCTAGTGCTTGATTTTCGG + Intergenic
1201654619 Y:16326562-16326584 TTCTCCTAGTGCTTGATTTTCGG - Intergenic