ID: 904550149

View in Genome Browser
Species Human (GRCh38)
Location 1:31309600-31309622
Sequence CTCAAAACTCAGGCTGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904550149_904550153 20 Left 904550149 1:31309600-31309622 CCATACCCAGCCTGAGTTTTGAG 0: 1
1: 0
2: 1
3: 49
4: 431
Right 904550153 1:31309643-31309665 CTAGTGCTTAGCACAGTGCCTGG 0: 2
1: 22
2: 237
3: 1155
4: 3788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904550149 Original CRISPR CTCAAAACTCAGGCTGGGTA TGG (reversed) Intronic
900096846 1:943241-943263 CCCACAACTCAGGCGCGGTAGGG + Exonic
900097072 1:944132-944154 CTCAACACAGAGGCTGGGAAGGG - Exonic
901499261 1:9641504-9641526 CTCAAAACCCAGGCTACCTAGGG - Intergenic
901974490 1:12933289-12933311 CTCACAGCTCAGGCTGGGGGAGG + Intronic
902010682 1:13268478-13268500 CTCACAGCTCAGGCTGGGGGAGG - Intergenic
902448388 1:16482146-16482168 GTGAAAATTCAGGCTGGGTGTGG - Intergenic
902506392 1:16941191-16941213 GTGAAAATTCAGGCTGGGTGTGG + Intronic
903295884 1:22342882-22342904 CTGCAAACTCTGGCTGGGTCAGG - Intergenic
903836190 1:26204633-26204655 CTCCTAACTCAGGCTCAGTAAGG - Intergenic
904228011 1:29040843-29040865 ATAAAAATTCAGGCTGGGTGCGG + Intronic
904550149 1:31309600-31309622 CTCAAAACTCAGGCTGGGTATGG - Intronic
904907714 1:33910512-33910534 CCCAAAACTCAGGCTGGGAGTGG - Intronic
905264938 1:36745605-36745627 CATAAAAATCAGGCTGGGCACGG - Intergenic
905610361 1:39345318-39345340 ATCAAAATTTAGGCTGGGCATGG + Intronic
905738865 1:40351926-40351948 CTTAAGAATCTGGCTGGGTACGG - Intronic
906164907 1:43678874-43678896 TTAAAAACACAGGCTGGGTGTGG - Intronic
906649784 1:47504419-47504441 ATCTACACTCAGGCTGGGTGTGG - Intergenic
906726947 1:48051092-48051114 CACCAAACCCAGGCTGGGTTAGG - Intergenic
907228782 1:52975466-52975488 CTAAAAATACAGGCTGGGTGCGG - Intronic
908730206 1:67218631-67218653 TCCAAAATTAAGGCTGGGTATGG + Intronic
908812980 1:68003057-68003079 GTTAAATCTCAGGCTGGGAAAGG + Intergenic
908974506 1:69881586-69881608 ATAAAAAGGCAGGCTGGGTATGG + Intronic
909000066 1:70207180-70207202 TTTAAAACTCAGGCTGGGCACGG - Intronic
909539518 1:76775544-76775566 CCTGAAACTCAGGCTGGGAATGG - Intergenic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
910791895 1:91060175-91060197 CAAAAAATTCAGGCTGGGTGTGG - Intergenic
911588187 1:99715145-99715167 TTTAAATCTCAGGCTGGGTGTGG - Intronic
912856979 1:113178072-113178094 CACAAAAATCAGTCTGGGAAGGG + Intergenic
912965668 1:114235145-114235167 CTGAAAACTCAGGCTGACTTAGG + Intergenic
914216733 1:145637879-145637901 ATAAAAATTCAGGCTGGGCATGG + Intronic
914469301 1:147960560-147960582 ATAAAAATTCAGGCTGGGCATGG + Intronic
915209960 1:154301142-154301164 ATCAAAAGTCAGACTGGGTGTGG + Intergenic
916024347 1:160820860-160820882 TTCAAAAGTCAGACTGGGCACGG + Intronic
916208945 1:162342938-162342960 TTCAGAGCTCAGGCTGGGAAGGG - Intronic
916553764 1:165875314-165875336 CTTTAAAGTCAGGCTGGGCAGGG - Intronic
916601371 1:166296909-166296931 CTCAAAGCCTAGGCTGGGAAAGG + Intergenic
917735403 1:177915560-177915582 GTAATAACTCAGGCTGGGCAGGG - Intergenic
917860999 1:179143984-179144006 TTTAACACTCAGGCTGGGCATGG - Intronic
918930057 1:190843338-190843360 CTCACAATTCAGGATGGCTAAGG - Intergenic
919945416 1:202315740-202315762 CTGAAAACTCGGGCTGGGCAAGG - Intronic
920140570 1:203809118-203809140 AAGAAAACTCAGGCTGGGTGTGG - Intronic
920146877 1:203868957-203868979 CTAAAAAACCCGGCTGGGTATGG - Intronic
920281954 1:204850210-204850232 GTAAAATCTCAGGCTGGGAAAGG - Intronic
921374028 1:214454956-214454978 TTCAAAAATCAGGGTGGGGATGG - Intronic
921630243 1:217424240-217424262 CTGAAATATCAGGCTGGGCACGG - Intergenic
922172029 1:223163517-223163539 CTCAAAACTTAGGCAAGGAAAGG + Intergenic
922682855 1:227615408-227615430 CCCAAAACTCAGGCTTGATCGGG + Intronic
922851778 1:228738837-228738859 AACAAAAATCAGGCTGGGTGTGG + Intronic
923824884 1:237489364-237489386 TTAAAAAGTCAGGCTGGGCACGG + Intronic
923825748 1:237498154-237498176 TTAAAAATTGAGGCTGGGTACGG - Intronic
924183679 1:241464768-241464790 CTCAAAGCTCAGGCAGGAAAGGG - Intergenic
924310246 1:242734016-242734038 TTAAAAACTTAGGCTGGGCATGG + Intergenic
924364970 1:243283136-243283158 CCCAAAAATCAGGCCGGGTGCGG - Intronic
924447473 1:244146781-244146803 ATCAAAACTCTGGCTGGGCGTGG - Intergenic
1062894455 10:1092214-1092236 CTCAGACCTCTGGCTGGGTGCGG + Intronic
1063701351 10:8388081-8388103 CTAATAACTCAGGCTGGGCATGG - Intergenic
1064065171 10:12175353-12175375 TGAAAAACTCAGGCTGGGTGTGG + Intronic
1065087529 10:22194457-22194479 TTCAAGGCTCAGGCTGGGCATGG + Intergenic
1069972339 10:72182683-72182705 ATAAAAACTTAAGCTGGGTATGG + Intronic
1070230428 10:74560207-74560229 ATCAACAGACAGGCTGGGTATGG - Intronic
1071501576 10:86207941-86207963 TTCAAAACACAGGCTGTGAATGG + Intronic
1072693583 10:97587221-97587243 CCCAACACTCAGGCTGAGGAGGG + Intronic
1072701689 10:97646505-97646527 CTTAAAAATTAGGCTGGGTGTGG - Intronic
1073209898 10:101791503-101791525 CTCACAAGTCAGTCTGGGGAGGG + Intronic
1073389981 10:103166941-103166963 ATCAAAACTGTGGCTGGGTGTGG - Intronic
1073393795 10:103201343-103201365 CTAAAGCCTCAGGCTGGGCATGG + Intergenic
1074505605 10:114067721-114067743 CTCAAAAAAAAGGCTGGGCATGG - Intergenic
1075319060 10:121475137-121475159 ATCAAAATGCAGGCTTGGTAAGG + Intergenic
1076271982 10:129161684-129161706 CTAAAAACACAGGCTGGGCACGG + Intergenic
1079390738 11:20019792-20019814 CTGAAAACTCAAGTAGGGTAAGG + Intronic
1080000482 11:27343108-27343130 ATCAAAGCTCAGGATGGGCATGG + Intronic
1080401699 11:31942192-31942214 AAAAAAACTCAGGCTGGGCACGG - Intronic
1080626986 11:34039461-34039483 CACAAAAATTAGGCTGGGCATGG + Intergenic
1081546874 11:44077936-44077958 ATCAAACCTGAGGCTGGGTGTGG + Intronic
1081954111 11:47074535-47074557 ATCAAAACTAAGGTTGGGGAAGG + Intronic
1082078472 11:47993581-47993603 CTACAGACGCAGGCTGGGTACGG - Intronic
1083019495 11:59492324-59492346 CTCAAGTCTCAGGCAGGATAGGG + Intergenic
1083397131 11:62399852-62399874 CTCAAAAGCCAGGCTGTGTGTGG - Intergenic
1083398741 11:62409582-62409604 CTCCAAGAACAGGCTGGGTATGG + Intronic
1084119621 11:67061340-67061362 TACAAAAATTAGGCTGGGTACGG + Intronic
1084334799 11:68450422-68450444 ATCAAAATATAGGCTGGGTACGG + Intergenic
1084616506 11:70239973-70239995 CTAAAAATTGAGGCTGGGTGTGG + Intergenic
1084746624 11:71174389-71174411 ATCAAAAATCAGGCCGGGTGTGG + Intronic
1084900551 11:72306941-72306963 CTCAAGAGTCAGGCAGGGCAAGG + Intronic
1084940835 11:72612318-72612340 CACAGAACTCAGGCTCGGGATGG + Intronic
1085685153 11:78614993-78615015 ATCCAAAGACAGGCTGGGTACGG - Intergenic
1086450858 11:86915262-86915284 CAGAAAACTCAGGGTGGGTTAGG + Intronic
1086591617 11:88521801-88521823 CTCAACCCTCATGCTGGGAAAGG - Intronic
1088362831 11:109009062-109009084 CCCAAAATTCAGGCCGGGCACGG - Intergenic
1089546520 11:119231110-119231132 CTCAAACCCCAGGTTGGGTGCGG + Intronic
1089995089 11:122898987-122899009 CTCAGAACTAAGGCTGAGAAGGG - Intronic
1090411646 11:126513457-126513479 CTCCACACTCAGGCAGGGAAGGG + Intronic
1091100141 11:132864226-132864248 ATAAAAAATCAGGCTGGGTGCGG - Intronic
1091438264 12:491617-491639 ATCACAAATCAGGCTGGGTGTGG - Intronic
1091747817 12:3003818-3003840 CTGAGAACACAGGCTGGGGAAGG - Intronic
1092885153 12:12918384-12918406 ATAAAATCTCAGGCTGGGCATGG - Intergenic
1094691582 12:32774747-32774769 TACAAAACTTAGGCTGGGTGCGG - Intergenic
1096255455 12:50059349-50059371 CTCATACCTCAGGCTGGGTGGGG - Intronic
1096722103 12:53530897-53530919 CTCAAAAAATAGGCTGGGTGAGG - Intronic
1100291502 12:93219052-93219074 ATCATAACTCAGGCTGGGCATGG - Intergenic
1101038193 12:100725989-100726011 CTCAGAACCCAGCCTGGGTTTGG + Intronic
1101198462 12:102409726-102409748 AGGAAAACTCAGGCTGAGTATGG - Intronic
1101917866 12:108910250-108910272 TTAAAAACTCCTGCTGGGTATGG - Intergenic
1104940733 12:132393460-132393482 CTCAAAACACCGGATGGGGAAGG + Intergenic
1105350043 13:19606724-19606746 CTCAGACCTGAGGCTGGGCAAGG + Intergenic
1106037934 13:26061849-26061871 CTCAAAAATTAGGCTGAGTTTGG - Intergenic
1107362626 13:39636749-39636771 TTAAAAAATCAGGCTGGGTGCGG + Intergenic
1107905466 13:45057280-45057302 TACAAAACTTAGGCTGGGTGTGG - Intergenic
1108798651 13:54065886-54065908 ATAAAAAATCAGGCTGGGTGCGG + Intergenic
1108823007 13:54376723-54376745 ATAAAAAATCAGGCTGGGCATGG + Intergenic
1109308226 13:60663380-60663402 CCCAAGACTCAGGCAGGGTGAGG - Intergenic
1109395714 13:61755524-61755546 ATCAAAACACAAGCTGGGCACGG - Intergenic
1109556316 13:63980885-63980907 CTCAAAAATAAGGCCGGGCATGG + Intergenic
1110622022 13:77607339-77607361 CGCAACACTCTGGCTGGGCATGG - Intronic
1112180594 13:97075738-97075760 TTAAAAACTTGGGCTGGGTATGG + Intergenic
1112283782 13:98085896-98085918 TTAAAAATTCAGGCTGGGCACGG + Intergenic
1114268698 14:21088387-21088409 GGCAAAACTCAGGCCAGGTAAGG + Intronic
1116076887 14:40122107-40122129 CACAAAACTCAGTCTGGGACTGG + Intergenic
1117020433 14:51565076-51565098 CTCAAAACCCAGACCGGGTTTGG + Intronic
1118065554 14:62186678-62186700 CTCTAAAGTCAGACTGGGTTCGG + Intergenic
1119533500 14:75380408-75380430 CTCAAAACTCAGGTTCTTTATGG - Intergenic
1120907431 14:89632731-89632753 GTCAAATCTGAGGCTGGGCATGG + Intronic
1121275266 14:92663099-92663121 TACAAAAGTCAGGCTGGGTGTGG - Intronic
1121862379 14:97330534-97330556 CCCAAATCTCGGGCGGGGTATGG + Intergenic
1122406018 14:101501496-101501518 CCCAAAGCACAGGCTGGGGAGGG + Intergenic
1123788234 15:23693653-23693675 TTTAAAACTCAGACTGGGTGTGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124703870 15:31943940-31943962 CTCATAATTCAGTCTTGGTAAGG - Intergenic
1125007203 15:34830791-34830813 CTTACAAATCAGGCTGGGCAAGG - Intergenic
1125325216 15:38529546-38529568 GAGAAAACTCAGGCAGGGTAAGG - Intronic
1125404065 15:39334759-39334781 CATAAAATTCAGGCTGGGCATGG - Intergenic
1125650819 15:41316153-41316175 CTAAAAATTGAGGCTGGGCATGG + Intronic
1125695843 15:41636703-41636725 TACAAAAATTAGGCTGGGTATGG - Intronic
1126039204 15:44574292-44574314 TTTAAAAATCAGGCTGGGCATGG - Intronic
1126092844 15:45067069-45067091 TTTAAAAATCAGGCTGGGCATGG + Intronic
1126616466 15:50586726-50586748 ATAAAAACTCAGACTGGGCATGG + Intronic
1127770702 15:62228027-62228049 AACACAACTCAGGCCGGGTAGGG + Intergenic
1127797277 15:62449528-62449550 CTTTAAAAACAGGCTGGGTATGG + Intronic
1128103672 15:65027486-65027508 ATGAAAACTGAGGCTGGGCACGG - Intronic
1128737858 15:70063469-70063491 TTAAAAAGTCAGCCTGGGTAGGG + Intronic
1130514349 15:84614773-84614795 CTCTATATTCAGGCTGGGTGTGG - Intronic
1131654016 15:94435153-94435175 ATGAAAATGCAGGCTGGGTACGG - Intronic
1131707724 15:95016070-95016092 ATGAAAACTCAGGCTGGGCACGG - Intergenic
1132150946 15:99458412-99458434 AAGAAACCTCAGGCTGGGTATGG + Intergenic
1133024917 16:2984729-2984751 ATCAAAACACAGGCTGGGCGCGG - Intergenic
1133141469 16:3747797-3747819 CTAAAAATACAGGCTGGGTGCGG + Intronic
1133848440 16:9478975-9478997 CTCAAAGCCCAGCCAGGGTAGGG - Intergenic
1134113838 16:11533421-11533443 TACAAAACTCAGGCTGGGTGCGG + Intergenic
1134113899 16:11533880-11533902 ATAAAAACGCTGGCTGGGTAGGG + Intergenic
1134141670 16:11725196-11725218 CACAATATTCAGGCAGGGTATGG - Intronic
1135010706 16:18875298-18875320 CTCCAAAATCCGGCTGGGCATGG + Intronic
1135317593 16:21462894-21462916 TTCCAAACTCCGGCTGGGCATGG + Intergenic
1135370485 16:21894698-21894720 TTCCAAACTCCGGCTGGGCATGG + Intergenic
1135441300 16:22476005-22476027 TTCCAAACTCCGGCTGGGCATGG - Intergenic
1135683660 16:24480142-24480164 ATCAAAACTCCTGCTGGGTGGGG - Intergenic
1135744570 16:25005204-25005226 AACAATATTCAGGCTGGGTATGG - Intronic
1137272230 16:46909439-46909461 CTCAGTACTTAGGCTGGGCACGG - Intronic
1137644534 16:50062610-50062632 TTCAAAACTCAGGCTGGGCGCGG - Intergenic
1138227093 16:55305202-55305224 CTCACAAGTCATGCTGGGAAAGG + Intergenic
1138388437 16:56652398-56652420 CTCTCCACTCAGGCTGGGAAGGG - Intronic
1139273413 16:65704550-65704572 CACAAAAATAAGGCTGGGCATGG + Intergenic
1139776147 16:69318261-69318283 CTCACAGCCCAGGCTGGGTGCGG - Intronic
1139947288 16:70650087-70650109 CCCACAACACAGGCTGGGCACGG - Intronic
1140103929 16:71942022-71942044 TTCAAAATTCTGGCTGGGCACGG + Intronic
1141077252 16:81018462-81018484 TTAAAAATTCAGGCTGGGTGCGG - Intronic
1141897577 16:86968368-86968390 AATAAAACTCAGGCTGGGTGTGG - Intergenic
1141941646 16:87279941-87279963 CTAATAACACAGGCTGGGCATGG - Intronic
1143559365 17:7683384-7683406 TACAAAAATCAGGCTGGGCACGG - Intronic
1143581059 17:7826317-7826339 AGTAAAACTCAGGCTGGGCACGG - Intronic
1144451258 17:15381176-15381198 CTCAAGATTCAGGCAGGGCACGG - Intergenic
1144513774 17:15900738-15900760 ATAAAAAGTCAGGCTGGGCACGG - Intergenic
1144887815 17:18475869-18475891 CCCAGAACTCAAGCTGGGGATGG - Intergenic
1145144398 17:20468432-20468454 CCCAGAACTCAAGCTGGGGATGG + Intergenic
1145175844 17:20699835-20699857 CCCAGAACTCAAGCTGGGGATGG + Intergenic
1145791473 17:27630338-27630360 CCCAGAACTCAAGCTGGGTAGGG - Exonic
1146189113 17:30749366-30749388 ATAAAAATTCAGGCTGGGCATGG - Intergenic
1146776171 17:35619350-35619372 TTAAAAATTCAGGCTGGGTATGG + Intronic
1147674718 17:42197070-42197092 CCCCAAACTCAGGCTGGGCGTGG + Intergenic
1148330579 17:46811662-46811684 CTAGAAACTCTGGCTGGGTGCGG + Intronic
1148776121 17:50096561-50096583 CTCAAGACTCAGGCAGGGCAGGG - Intronic
1149446034 17:56714166-56714188 CTCAAAAAAGGGGCTGGGTATGG - Intergenic
1149538768 17:57452908-57452930 CTCTAACCTCAGACTGGGGAAGG + Intronic
1150019395 17:61595524-61595546 TTCAAAACTGAGGCTCAGTAAGG + Intergenic
1150262135 17:63802618-63802640 AACAAAATTCAGGCTGGGTATGG + Intronic
1152656451 17:81521660-81521682 TTCAAAACAAAGGCTGGGTGTGG - Intronic
1152727330 17:81954066-81954088 ATTAAGACTCAGGCTGGGTGCGG - Intronic
1152847796 17:82613319-82613341 CGCCAAACACAGGGTGGGTATGG + Intronic
1154945435 18:21157617-21157639 CCCAAAACAGAGCCTGGGTAAGG + Intergenic
1154977969 18:21477494-21477516 TTCAAAAATCTGGCTGGGTGCGG + Intronic
1155046464 18:22107798-22107820 GTCAAAACTTAGGCTGGGGCAGG + Intergenic
1155067287 18:22279007-22279029 CTCATATCTCAGGGTGGTTAAGG + Intergenic
1155148721 18:23105560-23105582 CTTCAAACTCATGCTGTGTAAGG - Intergenic
1155214376 18:23630132-23630154 CACAAAAATTAGGCTGGGCACGG + Intronic
1155291926 18:24351055-24351077 ATAAAAAATCAGGCTGGGCACGG + Intronic
1156282783 18:35657382-35657404 TTCCAAACTCAGGTTGGGTGCGG - Intronic
1156435805 18:37128176-37128198 ATCACAACTTAGGCTGGGCATGG + Intronic
1157433231 18:47647633-47647655 TTCAAAAATCAGGCTGGGCACGG + Intergenic
1157676215 18:49570538-49570560 AACAAAACTCAGGCTGGGTGTGG + Intronic
1158124652 18:54087819-54087841 CTCAAACAACAGGCTGGGGATGG + Intergenic
1158128462 18:54127167-54127189 TTTAAAAGACAGGCTGGGTATGG + Intergenic
1158981218 18:62763870-62763892 CTTAAAAATCAAGCTGGGTGCGG + Intronic
1160040885 18:75344712-75344734 CTGCAAACTCAGGCTGGGTGTGG - Intergenic
1160530416 18:79559116-79559138 CCCAAATCTCAGGCAGGGGATGG + Intergenic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1161318398 19:3629781-3629803 AACAAAACACAGGCTGGGTGCGG + Intergenic
1161508879 19:4659512-4659534 TTTAAAAATCAGGCTGGGTGCGG - Intronic
1162574857 19:11493346-11493368 CCCAAAACAAAGGCTGGGCACGG - Intronic
1162752076 19:12835038-12835060 CCCAAGATTCAGGCTGGGGATGG - Intronic
1163018127 19:14469331-14469353 CTCACACATCAGGCTGGGGAGGG - Exonic
1163135339 19:15307065-15307087 CTCAAAATTCAGGATGGGCAAGG + Intronic
1163326375 19:16606007-16606029 CTCAAAACTGAGGCCTGGCAAGG + Intronic
1163743463 19:19031241-19031263 CAAAAAATTCAGGCTGGGTGTGG + Intronic
1165638101 19:37360784-37360806 CTGAAAATTAAGGCTGGGCACGG - Intronic
1165686426 19:37824998-37825020 CCCAAAAGGCAGGGTGGGTAAGG - Intergenic
1166174174 19:41053961-41053983 CTAAATAATCAGGCTGGGTGCGG - Intergenic
1167132166 19:47594053-47594075 CCCAAACCCCAGGCTGGGTCAGG + Intergenic
1167232690 19:48295420-48295442 CTAAAAATTCAGGCTGGGCGTGG - Intergenic
1167595309 19:50424354-50424376 ATCAACACACAGGCTGGGTGTGG + Intronic
1167595332 19:50424490-50424512 CACAAAAATTAGGCTGGGCATGG + Intronic
1168361910 19:55748445-55748467 CTCAACACTCAGGCAGGGACGGG - Intergenic
1168396021 19:56049469-56049491 CTAAAAATACAGGCTGGGCACGG - Intronic
925538806 2:4944280-4944302 CACAAAATGTAGGCTGGGTAGGG + Intergenic
926164253 2:10508938-10508960 TACAAAAATCAGGCTGGGCACGG + Intergenic
926889769 2:17629145-17629167 CTGAAAACTCAGTCTGGGTGTGG - Intronic
927032777 2:19140120-19140142 CTCTGTACTCAGGCTGGGTGAGG + Intergenic
927151139 2:20196865-20196887 CTGGAAACACCGGCTGGGTAGGG + Intergenic
927605864 2:24486095-24486117 TTTAAAAATCAGGCTGGGTGCGG + Intergenic
927656759 2:24954645-24954667 ATCAATAGTCAGGCTGGGTGCGG + Intronic
927796708 2:26055677-26055699 CACAAAAATTAGGCTGGGCAGGG - Intronic
928046397 2:27937414-27937436 TTCAAAAAACAGGCTGGGTGCGG - Intronic
928535052 2:32231848-32231870 GTCAAAACTAAGGCTGGGTGTGG - Intronic
928657219 2:33464759-33464781 CACAGATCACAGGCTGGGTATGG - Intronic
929042175 2:37755709-37755731 CTCATAAAACAGGCTGGGCATGG + Intergenic
929101915 2:38323492-38323514 CTTAAACTTCAGGCTGGGCATGG - Intronic
929974595 2:46620156-46620178 CTTAAAAATTCGGCTGGGTAAGG + Intronic
931218987 2:60272042-60272064 CTTACACCTCAGGCTGGGCAGGG + Intergenic
931252655 2:60547760-60547782 CTCAATATTCAGCCTGGGTAGGG - Intronic
931571213 2:63671048-63671070 CTCAAAGCTGAGCCTGAGTAGGG - Intronic
932339976 2:70957388-70957410 TACAGAACTCAGGCTGGGTGTGG - Intronic
933486532 2:82931871-82931893 CACCCAACTCAGGCTGGGTGTGG + Intergenic
934869093 2:97843628-97843650 GTCAGGACTAAGGCTGGGTATGG - Intronic
936026744 2:109036851-109036873 TACAAAAATCAGGCTGGGCAAGG + Intergenic
936041969 2:109156731-109156753 CTTAAAATTCAGGCCGGGCACGG - Intronic
936467837 2:112769336-112769358 ATCAAAATACAGGCTGGGTACGG + Intergenic
937409132 2:121657500-121657522 CACAGAACGCAGGCTGGGCATGG - Intergenic
937853660 2:126657198-126657220 CTCCAAGCTCAGGCGGGGTGAGG - Intronic
938304536 2:130243029-130243051 ATAAAAAATCAGGCTGGGCACGG - Intergenic
938507164 2:131898414-131898436 CTGTAAATTCTGGCTGGGTACGG + Intergenic
938835850 2:135103325-135103347 CACAAAAATAAGGCTGGGCACGG - Intronic
938897731 2:135768855-135768877 ATAAAAAATCAGGCTGGGCACGG - Intronic
940247604 2:151636487-151636509 CTCAAAAATGAGGCTAGGTGTGG + Intronic
940941608 2:159567681-159567703 TTTAAAAATCAGGCTGGGTGTGG + Intronic
940962601 2:159801730-159801752 CTAAGATCCCAGGCTGGGTATGG + Intronic
941827488 2:169916645-169916667 ATCAAAATCCAAGCTGGGTAAGG - Intronic
941914410 2:170800547-170800569 TTCAAAACTCATGCTGGGCTGGG - Intergenic
942034400 2:171996586-171996608 TTGAAAACACAGGCTGGGTGTGG - Intronic
942100254 2:172573917-172573939 CTAAAAACTTTGGCTGGGTGTGG - Intronic
944472288 2:200066797-200066819 CTGCAAACCCAGGCTGGGAAGGG - Intergenic
944607667 2:201367491-201367513 AACAAAAATCAGGCCGGGTAGGG + Intergenic
946843796 2:223841393-223841415 GTCAAGACTAAGGCTGGGTGTGG - Intergenic
947434074 2:230057734-230057756 ATCAGAACTCAGGCTGGGCATGG + Intronic
947565838 2:231192434-231192456 CTCAAAACTCATGATGTGTGGGG - Intergenic
947626846 2:231624791-231624813 CACAAAAATTAAGCTGGGTATGG + Intergenic
947960701 2:234234407-234234429 CACAATACTCAGGGTTGGTAAGG + Intergenic
948301002 2:236907351-236907373 CTCAAAGCTCTGGCTGGGTGCGG + Intergenic
948471822 2:238186959-238186981 TGCAAATCCCAGGCTGGGTATGG + Intronic
948604661 2:239127137-239127159 CTCACAACTCAGGCTGTCTTTGG - Intronic
948790686 2:240375152-240375174 CTCGACACCCAGGCTGGGGAGGG - Intergenic
948872073 2:240806384-240806406 CTCAAAACTCACACAAGGTAAGG + Intronic
1168889681 20:1286817-1286839 CTCTGATCTCAGGCTGGGTGGGG + Intronic
1169444055 20:5656899-5656921 CTTAAACCTGAGGCTGAGTATGG + Intergenic
1170925133 20:20715706-20715728 GTCAAAATTCTGGCTGGGTGTGG - Intergenic
1171355964 20:24545588-24545610 CTCAAGACTCAGCCGGGGGAGGG - Intronic
1171373434 20:24676120-24676142 CTCACAACTCAGGCATGGCAGGG - Intergenic
1172010310 20:31842555-31842577 CTCAGAACCCAGGCTGGGAAGGG + Intergenic
1172637638 20:36420681-36420703 CACAAAAATTAGGCTGGGTGTGG + Intronic
1172764188 20:37342422-37342444 CTCAACACACATGCTGGGTTGGG + Intergenic
1174359292 20:50017788-50017810 CTCAAAAACTAGGCTGGGTGAGG - Intergenic
1174484538 20:50852883-50852905 CTCAAATGCCAGGCTGGGCAGGG - Intronic
1174620849 20:51873508-51873530 CTAAAAATACAGGCTGGGCACGG - Intergenic
1174802356 20:53575051-53575073 CTCAAGAATAAGGCTGGGTATGG + Intronic
1175189838 20:57204009-57204031 CTCAAAACTCAGGATCCGAAAGG + Intronic
1175458155 20:59130707-59130729 CCCCAAACTCACCCTGGGTATGG + Intergenic
1178854911 21:36242463-36242485 ACCAAAACTAAGGCTGGGCATGG - Intronic
1180644447 22:17327043-17327065 ATAAAAACTAAGGCTGGGTGTGG + Intergenic
1180671874 22:17560039-17560061 GTGAAAAATCAGGCTGGGCACGG + Intergenic
1181083025 22:20426473-20426495 CTCTGAACTCAGGCTGTGCAAGG + Intronic
1181518534 22:23432212-23432234 CTCAAAACCCAGGCTCTGGAAGG - Intergenic
1184380054 22:44139744-44139766 CTCAAAACACAGGCTGGGCCGGG - Intronic
1184469491 22:44688063-44688085 CTAGAAACTCAGGCCGGGTGCGG - Intronic
1184590594 22:45479806-45479828 TTCAAAATTCTGGCTGGGCATGG + Intergenic
1185179993 22:49353893-49353915 CTCAACATTCAGGATTGGTAGGG - Intergenic
1203294379 22_KI270736v1_random:27211-27233 CTCATAAAACAGGCTGGGCATGG + Intergenic
950208723 3:11100906-11100928 TTAAAAACTAAGGCTGGGCACGG - Intergenic
950659366 3:14457269-14457291 CTCAAAACCCTGGCAGGGCAGGG + Intronic
952425719 3:33172484-33172506 TTAACAACTCAGGGTGGGTATGG + Intronic
952473671 3:33683651-33683673 TTAAATACACAGGCTGGGTACGG + Intronic
953813526 3:46134291-46134313 CTCAAAAGTGTTGCTGGGTAGGG - Intergenic
954318698 3:49815932-49815954 TTCAAGAATCAGGCTGGGCATGG - Intergenic
954658904 3:52215905-52215927 TTCTAAATTCAGGCTGGGCATGG + Intergenic
954883752 3:53854185-53854207 TTCCAAAATAAGGCTGGGTACGG - Intronic
955361743 3:58281823-58281845 ATTAAAACTCAGGCCGGGTGCGG + Intronic
955692667 3:61605861-61605883 TTCACAAGTCAGGCTGGGTGTGG - Intronic
955828586 3:62976412-62976434 ATAAAAATGCAGGCTGGGTAAGG + Intergenic
956777112 3:72574455-72574477 ATAAAGACTCAGGCTGGGCATGG + Intergenic
959133523 3:102388148-102388170 CTCAGAACTGAGGCCGGGCATGG - Intronic
959714830 3:109421406-109421428 CTTACAACTCAGGCCGGGCACGG - Intergenic
960181272 3:114582668-114582690 TTTAAAACACAGGCTGGGCATGG - Intronic
960667965 3:120129480-120129502 CTCCAAACTCAGGCTAGGCAAGG - Intergenic
962779304 3:138696474-138696496 GTTAAAATTTAGGCTGGGTATGG - Intronic
963923802 3:150930313-150930335 CCCAAAGGTCAGGCTGGGTTTGG + Intronic
964492120 3:157248126-157248148 TTCATAACTCTGGCTGGGCATGG + Intergenic
965481808 3:169227884-169227906 CCCAAAACAAAGGGTGGGTATGG + Intronic
965842973 3:172928515-172928537 CTCAAACATCAGGCTGGTTTTGG - Intronic
966007425 3:175033080-175033102 CTCAAAGCTCAAGCGGGGGATGG + Intronic
966165297 3:177010002-177010024 CTTCACACTCAGCCTGGGTAAGG + Intergenic
967179504 3:186891420-186891442 GTCAATACTGAGGCTGGGTGCGG + Intergenic
967607423 3:191464332-191464354 ATCAAAAATCAGGCCGGGCAAGG - Intergenic
967904782 3:194490853-194490875 CTGTAAACTGAGGCTGGGCATGG + Intronic
968036692 3:195553780-195553802 CTCCTAAATCAGGCTGGGCATGG + Intergenic
968406208 4:341349-341371 CTCACAAAACAGGCTGGGCACGG - Intronic
970123944 4:12788578-12788600 CTCAACACTCAGGCTAGGCGTGG + Intergenic
970893179 4:21070963-21070985 CTCACAACTCAGGCCAGGCATGG - Intronic
970918703 4:21367514-21367536 ATCAAAACCAAGGCTGGGTCAGG + Intronic
973901628 4:55480554-55480576 CTAGAAAATGAGGCTGGGTACGG - Intronic
974130784 4:57753214-57753236 GTAAAAACTCAGGCTGGGCGTGG + Intergenic
974884192 4:67795988-67796010 CTCCAAACTCAGGCTGTGCTAGG - Intergenic
980819813 4:137999483-137999505 CTCCAAACTCAGGGTCGTTAGGG - Intergenic
980928873 4:139166045-139166067 CTCTAAAAACAGGCTGGGCATGG + Intronic
981786011 4:148480438-148480460 CTGGAAATTCAGGCTGGTTATGG - Intergenic
984038344 4:174697265-174697287 CTCAAAAGTTAGGCAGGGTTAGG + Intronic
984539262 4:181017280-181017302 CTCAAAATTCAGGCCGGGCATGG - Intergenic
985036028 4:185840893-185840915 CTCCAAACTCAGTTTGGGTGGGG + Intronic
985658201 5:1142863-1142885 CTCAGAACTCAGGGGAGGTAAGG + Intergenic
985869431 5:2542559-2542581 TTCAGAACCCAGGGTGGGTATGG - Intergenic
986208550 5:5648595-5648617 CTCAAAACTCAGGCCAGGCATGG + Intergenic
988782372 5:34533882-34533904 CTTAAAGCTCAGGCTGGGGTGGG - Intergenic
989772642 5:45163114-45163136 CTCACAGCTCAGTCTGGGCATGG + Intergenic
990206154 5:53431697-53431719 TTAAAAATTCAGGCTGGGCACGG - Intergenic
990224563 5:53634896-53634918 CTGAAAAATCTGGCTGGGTGTGG + Intronic
990432219 5:55747090-55747112 CAGAAAATTTAGGCTGGGTATGG + Intronic
991099939 5:62781151-62781173 CTTAAAATTCAGGCTAGGAATGG - Intergenic
991294287 5:65064383-65064405 ATCAAACCCCTGGCTGGGTAAGG + Intergenic
991761229 5:69918707-69918729 TTCAGAACTGGGGCTGGGTATGG - Intergenic
991786100 5:70199393-70199415 TTCAGAACTGGGGCTGGGTATGG + Intergenic
991840457 5:70793758-70793780 TTCAGAACTGGGGCTGGGTATGG - Intergenic
991878544 5:71199781-71199803 TTCAGAACTGGGGCTGGGTATGG + Intergenic
992044742 5:72875273-72875295 CTTAAAAATCAGGGTTGGTAGGG + Intronic
992150568 5:73898364-73898386 ATCAAAAATGAGGCAGGGTAGGG - Intronic
992661588 5:78967382-78967404 TTCAAATCTCAGGCTGGGCGCGG + Intronic
992965491 5:81995431-81995453 TTAAAAACTCAGGCTGGGCATGG - Intronic
995555508 5:113324064-113324086 TTCCAAACTCAGGCCTGGTATGG + Intronic
996746753 5:126852757-126852779 CTCCAAAATCAGGCTGGGCGCGG - Intergenic
997133733 5:131302467-131302489 CACAAAAATTAGGCTGGGCACGG - Intronic
997301180 5:132806746-132806768 ATAAAAACTCAGGCCGGGCACGG + Intronic
997591271 5:135074048-135074070 CTCAGAAGTCAGGCCGGGTGAGG + Intronic
998019341 5:138756319-138756341 TTAAAAAATCAGGCTGGGCACGG - Intronic
998356414 5:141540568-141540590 TACAAAACTTAGGCTGGGTGTGG - Intronic
998414181 5:141933571-141933593 CTCAAAATTCAGGGAGGGCAGGG + Intronic
999538293 5:152542895-152542917 TGCAAAACTCAGGCTGTGTGTGG + Intergenic
999589827 5:153132721-153132743 CTCTAAAATCTGGCTGGGTGTGG + Intergenic
999673123 5:153974835-153974857 CAGAAAACTCAGGCTGCTTAGGG + Intergenic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
999697021 5:154196211-154196233 CTATAAAATGAGGCTGGGTATGG - Intronic
999796621 5:154994797-154994819 ATGAAAAATCAGGCTGGGCAAGG - Intergenic
1000214937 5:159146223-159146245 TTTAAAAATCAGGCTGTGTATGG - Intergenic
1000748587 5:165066485-165066507 TTCAAAACTGAGGCTGGGCACGG - Intergenic
1001084781 5:168692723-168692745 CTCAGGCCTCAGGCAGGGTAGGG + Intronic
1001750123 5:174122860-174122882 CTAAAATCTCAGGCTTGGCAGGG - Intronic
1001911242 5:175520156-175520178 CTCAAAAGTCAGGCTGGGTGTGG - Intronic
1002656413 5:180751742-180751764 TTAGAAACTCAGGCTGGGCATGG - Intergenic
1003541776 6:7024472-7024494 CGCAGAACTCTGGCTGGGCATGG + Intergenic
1003990766 6:11484154-11484176 ATTAAAAATCAGGCTGGGCACGG + Intergenic
1005054111 6:21713910-21713932 CCCAAAAGTAAAGCTGGGTATGG + Intergenic
1005546799 6:26880850-26880872 TTCAGAACTGAGGCTGGGCATGG + Intergenic
1005834562 6:29698206-29698228 TTCAAAATCCAGGCTGGGTGTGG - Intergenic
1006218863 6:32470838-32470860 AATAAAATTCAGGCTGGGTACGG + Intergenic
1006682958 6:35810424-35810446 CACAAAAAACAGGCTGGGCATGG + Intronic
1008669916 6:53757248-53757270 CTCAAACCATTGGCTGGGTACGG + Intergenic
1008718177 6:54315376-54315398 TTCAAATGTCAGGCTGGGTGTGG + Intronic
1008776662 6:55047574-55047596 CTCAAAACTCTTTCTGAGTAAGG + Intergenic
1009881963 6:69579784-69579806 TTCTGAACTCAGGCTGGGTGTGG + Intergenic
1010340810 6:74750255-74750277 CTCAATTCTCAGGCTGGGAAGGG + Intergenic
1011694752 6:89902239-89902261 TTCAAAAATCAGGCTGGGTGTGG - Intergenic
1012480438 6:99661215-99661237 ATAAAAACACAGGCTGGGCACGG - Intergenic
1013021189 6:106221393-106221415 GTCAAAACTGAGGCCGGGTACGG + Intronic
1013523933 6:110957653-110957675 TCCAAAGCTCAGGCTGGGGACGG + Intergenic
1013551061 6:111208264-111208286 AACACAACTCAGGCTGGGCATGG - Intronic
1013615454 6:111838879-111838901 CTCCAGACTCTGGGTGGGTATGG + Intronic
1014750723 6:125252995-125253017 CTCAGAAATCAGGCTGGGCATGG - Intronic
1014833697 6:126132749-126132771 CTCAGAACTCAGGGTGGGTGTGG + Intergenic
1014935211 6:127378426-127378448 CACAAAACTTAGGCTGGGCGCGG + Intergenic
1015213176 6:130720899-130720921 ATCAAAATTCAGCCTGGGGATGG + Intergenic
1015548726 6:134389731-134389753 CTCAAACCACTGGCTGGGTGTGG - Intergenic
1015604116 6:134937969-134937991 CTCAAAACTGAGGCTGTTTAGGG - Intronic
1016889125 6:148988281-148988303 TTCAAAAAACAGGCTGGGTGCGG + Intronic
1017008391 6:150044764-150044786 CTTAAAACAAAGGCTGGGTGCGG - Intergenic
1017550686 6:155503919-155503941 CTAAAAACTGTGGCTGGGTGTGG + Intergenic
1018260751 6:161968327-161968349 CTCTACACTGAGGCTGGGCATGG - Intronic
1018692717 6:166361880-166361902 GTGAAAACTCAGGCTGGGCGCGG - Intergenic
1018952333 6:168387350-168387372 ATTAAAACTCAGGATGGGAAAGG - Intergenic
1019385258 7:751862-751884 TTCAAAATTCAGGCCGGGCACGG - Intronic
1020091612 7:5345238-5345260 CACAAACCCCAGGCTGGGTCAGG + Intronic
1020425668 7:8063434-8063456 GTCAAAAAACAGGCTGGGTGCGG - Intronic
1022300675 7:29099419-29099441 GTCAAAGCAGAGGCTGGGTATGG + Intronic
1022661579 7:32372342-32372364 GTCAAAAATTAGGCTGGGCATGG - Intergenic
1023122945 7:36927659-36927681 CACAAAAGTAAGGCTGAGTATGG - Intronic
1025767280 7:64467329-64467351 CTCAGAAATCAGGCCGGGTGTGG - Intergenic
1026763473 7:73144136-73144158 CTCAGAAATCAAGCTGGGTGCGG - Intergenic
1027039943 7:74953910-74953932 CTCAGAAATCAAGCTGGGTGCGG - Intergenic
1027083696 7:75248454-75248476 CTCAGAAATCAAGCTGGGTGCGG + Intergenic
1027169660 7:75862418-75862440 CTGAAAACTGGTGCTGGGTACGG - Intronic
1028385293 7:90246410-90246432 CTCAAATCTCAGGCTGCGTCAGG + Intronic
1028458948 7:91070085-91070107 CACAATACACAGGCTGGGTGTGG - Intronic
1029090246 7:98042083-98042105 CAGAAAAATAAGGCTGGGTAAGG - Intergenic
1029178035 7:98678916-98678938 CTCAAAACTTAGACTGGGAATGG + Intergenic
1029350867 7:100011940-100011962 AAGAAAACTCAGGCTGGGCACGG + Intergenic
1029391297 7:100276304-100276326 CTCAGAAATCAAGCTGGGTGCGG + Intergenic
1029498181 7:100909583-100909605 CTCAAAAAAAAGGCTGGGTGTGG + Intergenic
1029801240 7:102949813-102949835 CTCACAATCCAGGCTGGGCATGG + Intronic
1031000116 7:116405269-116405291 CTCCTAAATCAGGCTGGGCACGG - Intronic
1032462380 7:132121804-132121826 ATAAAGACTCAGGCTGGGTGGGG - Intergenic
1032515938 7:132506237-132506259 CTCCACACTCTGGCTGGGGAGGG + Intronic
1034157848 7:148970055-148970077 TGCAAAACTTAGGCTGGGCATGG - Intergenic
1034283290 7:149868242-149868264 CTCCACTCTCAGGCTGGGCAGGG + Intergenic
1034608716 7:152344695-152344717 CACAAAAGGCAGGCTGGGCATGG + Intronic
1034655550 7:152726906-152726928 CACAAAAATTAGGCTGGGTATGG + Intergenic
1035544979 8:473382-473404 CTCTAAACTCAGGCAGTGTATGG + Intergenic
1036012496 8:4742323-4742345 CTCAAAATTCAGCCTTGGTCAGG - Intronic
1037990912 8:23320615-23320637 CTTAAAAAAGAGGCTGGGTATGG + Intronic
1040790651 8:51225186-51225208 ATAAAAACTCAGGCCGGGCACGG + Intergenic
1041317266 8:56576981-56577003 CACAAAACTATGGCTGGGTGCGG - Intergenic
1041747692 8:61226728-61226750 CTTAACACTGAGGCTGGGGAGGG + Intronic
1042912419 8:73841309-73841331 AACTAAACTCAGGCTGAGTAAGG + Intronic
1043855756 8:85262905-85262927 GTCAAACCTCAGGCTTGGTGGGG + Intronic
1044636945 8:94334874-94334896 CTGTAAACTCTGGCTGGGCATGG - Intergenic
1045123041 8:99059464-99059486 CTCCAAAAAGAGGCTGGGTATGG - Intronic
1045463760 8:102450095-102450117 CACAAATATCAGGCTGGGCATGG - Intergenic
1046120607 8:109841496-109841518 TTCAAAACTAGGGCTGGGTGTGG - Intergenic
1046288235 8:112124524-112124546 CTTAAAATTTAGGCTGGGTAAGG - Intergenic
1049732782 8:144187118-144187140 AACAAAACTCAGGCCGGGCATGG + Intronic
1049862064 8:144905791-144905813 GCCAAAAATCAGGCTGGGCACGG + Intergenic
1050454180 9:5817186-5817208 CTCAAAAAAAAGGCTGGGCACGG - Intronic
1051006655 9:12353351-12353373 TTTAAAAATCAGGCTGGGTGCGG + Intergenic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1052749536 9:32475240-32475262 CACAAAACTGAGGCTGGGCATGG - Intronic
1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG + Intergenic
1052960368 9:34290888-34290910 AAGAAAACTCAGGCTGGGTGTGG - Intronic
1053010484 9:34630051-34630073 TTCATAATACAGGCTGGGTACGG - Intergenic
1055655971 9:78450901-78450923 TTAAAAACCCAGGCTGGGTGCGG + Intergenic
1057494258 9:95547620-95547642 CTCAACATTGAGGCTGGGCATGG + Intergenic
1058855006 9:109053133-109053155 ATCCCAACTCAGGCTGGGTGCGG + Intronic
1059111255 9:111560188-111560210 TACAAAAATCAGGCTGGGCATGG + Intronic
1059488945 9:114651100-114651122 TTAAAAACTCAGGCTGGGCATGG - Intergenic
1060294685 9:122335407-122335429 CTTAAAACACAGCCTAGGTAGGG + Intergenic
1060765324 9:126291448-126291470 CTCCCAAATGAGGCTGGGTAGGG + Intergenic
1060949421 9:127591927-127591949 CTCAAAAAGGAGGCTGGGCATGG - Intergenic
1061014618 9:127974572-127974594 CACTTAACTCAGGCTGGGCATGG - Intronic
1061528324 9:131187675-131187697 AGTAAAACTCAGGCCGGGTACGG - Intronic
1061996549 9:134188990-134189012 CCCACACCTCAGGCTGGGCAAGG + Intergenic
1062521456 9:136959637-136959659 CCCAGGGCTCAGGCTGGGTATGG + Intergenic
1185470778 X:381497-381519 CTACAAACTCTGGCTGGGGAGGG - Intronic
1185789692 X:2919409-2919431 CTAAACACACAGGCTGGGTAAGG + Intronic
1186649093 X:11539963-11539985 AACAAACCTCAGGCTGGGTACGG + Intronic
1187193040 X:17054838-17054860 CACAGAACTCAGGCAGGGTCAGG - Exonic
1187193398 X:17058003-17058025 CAGAAAACTCAGTGTGGGTATGG - Intronic
1187790240 X:22942476-22942498 AACAAAAAACAGGCTGGGTACGG - Intergenic
1188691583 X:33136022-33136044 ATAAAAAATCAGGCTGGGTTTGG + Intronic
1189431822 X:40953820-40953842 TTAAAAAATCAGGCTGGGCATGG + Intergenic
1189993682 X:46618651-46618673 TTAAAAAGTGAGGCTGGGTATGG + Intronic
1190084963 X:47387411-47387433 TACAAAAATCAGGCTGGGCATGG - Intronic
1190471700 X:50786924-50786946 TTAAAAATTCAGGCTGGGCATGG + Intronic
1190883124 X:54507581-54507603 TACAAAAATCAGGCTGGGCACGG - Intergenic
1190893360 X:54591119-54591141 CTAAGACCTCAGGCTGGGGACGG - Intergenic
1191781149 X:64867096-64867118 GTCAAACCTCAGGCAGGGTCAGG + Intergenic
1192130627 X:68546323-68546345 TTATAAACTTAGGCTGGGTATGG + Intergenic
1192179887 X:68909828-68909850 CTCAGAACCCAAGATGGGTAGGG - Intergenic
1192434333 X:71133622-71133644 TTCAAGACTCAGGCTGGGCACGG - Intronic
1193837008 X:86355682-86355704 CTCAAAAAATAGGCTGGGTGTGG - Intronic
1196439473 X:115705212-115705234 CCCAAAGCTAAGGCTGGGCATGG + Intergenic
1196822016 X:119709174-119709196 GTCAAAACTGAGGGTGAGTAGGG + Intergenic
1200143100 X:153911619-153911641 TTCAAAACTCAAGCTGGGTGTGG + Intronic