ID: 904551771

View in Genome Browser
Species Human (GRCh38)
Location 1:31324887-31324909
Sequence CAGGGATGGCCTAAAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 18, 3: 82, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904551762_904551771 22 Left 904551762 1:31324842-31324864 CCTGGGTGGAAAGGGGCAGGTCT 0: 2
1: 19
2: 59
3: 150
4: 479
Right 904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG 0: 1
1: 0
2: 18
3: 82
4: 307
904551766_904551771 -9 Left 904551766 1:31324873-31324895 CCGCACCTTCAAGCCAGGGATGG 0: 36
1: 107
2: 196
3: 300
4: 492
Right 904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG 0: 1
1: 0
2: 18
3: 82
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904551771 Original CRISPR CAGGGATGGCCTAAAGCATA GGG Intronic
900774903 1:4575612-4575634 CAGTGTTGGCCTAAGGCAGAGGG - Intergenic
904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG + Intronic
905001279 1:34671703-34671725 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
905215190 1:36401687-36401709 CAGGGGTGGCCTGAAGCCTGGGG - Intergenic
906906944 1:49905269-49905291 CATGGGTGGATTAAAGCATAGGG + Intronic
907540076 1:55207631-55207653 TAGGGATGACTTAAAGTATACGG + Intronic
908938904 1:69409285-69409307 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
909054629 1:70806937-70806959 CAGGGATGGCCTAAAGTCTGGGG - Intergenic
909599630 1:77448190-77448212 CAGGGATGGCCTGAAGCATGGGG + Intronic
911025874 1:93435101-93435123 CAGGGATGGCCTGAAGGCTGTGG - Intergenic
911266936 1:95753806-95753828 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
911275544 1:95853728-95853750 CAGGGAGAGCCTAAAGCCTGGGG + Intergenic
911295143 1:96106045-96106067 AAGGGATGGACTGAACCATAGGG - Intergenic
915828792 1:159105895-159105917 CAAGGATGGCCCGAAGCATGGGG - Intronic
917848821 1:179042989-179043011 CAGGGATGGCCTGAAGCATGGGG - Intronic
918820623 1:189250002-189250024 GAGGGATGGCCTGAAGCTTGGGG + Intergenic
919168793 1:193928047-193928069 CAGGGACAGCCTAAAGCCTGGGG - Intergenic
919253881 1:195096532-195096554 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
919453977 1:197801438-197801460 CAGGGAGGGCCTGAGGCCTAGGG + Intergenic
919513452 1:198494201-198494223 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
922141689 1:222894206-222894228 CAGGGACGGCCTGAAGCCTGGGG - Intronic
923328150 1:232898650-232898672 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
923917968 1:238530225-238530247 CAGGGATGACCTGAAGCCTGGGG - Intergenic
1062768373 10:82017-82039 CAGGGATGCCCTAGGGCACAGGG + Intergenic
1064834181 10:19506852-19506874 CAAGGATGGCCTAATACACATGG - Intronic
1065201467 10:23316966-23316988 CAGGGGTGGCCTGAAGCCTGGGG - Exonic
1065830316 10:29608851-29608873 CAGGGATGGCCTGAAGCCTGGGG + Intronic
1065906201 10:30254826-30254848 AAGGGATGGCCTAAAGTTGAAGG - Intergenic
1066508215 10:36066741-36066763 CAGGGATGGACTGAAGCCTGGGG + Intergenic
1068222745 10:54064434-54064456 CAGGGATGGCCTGAAGCCTGGGG - Intronic
1068283692 10:54909215-54909237 CAGGGAAGGCCTGAAGCCTGGGG - Intronic
1068300455 10:55131889-55131911 CAGGGATAGCCTGAAGCCTAGGG - Intronic
1068474412 10:57507086-57507108 CAGGGATGGCCTAAACCATTGGG + Intergenic
1068584254 10:58778716-58778738 TAGGGAAGGCCTAGAGCAGATGG + Intronic
1069553975 10:69384606-69384628 CAGGCATGGCAAAAAGCATCTGG - Intronic
1069561783 10:69435879-69435901 CATGGACGGCCTAAAGCACAGGG - Intergenic
1069864995 10:71496779-71496801 CAGGGAGGGACTCAAGCATCGGG - Intronic
1070159885 10:73859953-73859975 CAGGCATGGCCTAAATCTCAGGG - Intronic
1070201194 10:74207786-74207808 CAGGGACAGCCTGAAGCATGGGG - Intronic
1070401390 10:76056368-76056390 CAGAGGTGGCCTAAAGCATAGGG - Intronic
1070428781 10:76315751-76315773 CAGGGATGGCTTGAAGCCTGGGG + Intronic
1071119545 10:82261680-82261702 CAGGGATGGGCTGAAACAAAGGG + Intronic
1071310043 10:84334831-84334853 TAAGGATGGCCTGAAGCAAATGG - Intronic
1071819409 10:89264806-89264828 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1072226867 10:93378536-93378558 CAGGGCTGGACCAAAACATATGG - Intronic
1072871352 10:99124353-99124375 CAGGAATTGCCTGAAGCATGGGG - Intronic
1074028756 10:109663731-109663753 CAGGGAGGGCCTAAAGGCTTGGG + Intergenic
1075711166 10:124531143-124531165 CAGGGAAGGCCTTGAGGATATGG - Intronic
1076655157 10:132019143-132019165 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1079996964 11:27305094-27305116 CAGGGACGGCCTGAAGCCTGGGG + Intergenic
1080416288 11:32072758-32072780 TGGGGGTGGCCTAAAACATATGG - Intronic
1080485715 11:32704644-32704666 CAGGGATAGCCTGAAGCCTGGGG + Intronic
1080706689 11:34701750-34701772 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1081127926 11:39342493-39342515 CAGGGATGGCCAAAGGCATATGG + Intergenic
1081237155 11:40659408-40659430 CAGGGATGTCCTGAAGCCTGGGG + Intronic
1082000630 11:47392017-47392039 CAGGGTTGGCCTGAAGCTCAAGG - Intergenic
1082687718 11:56260467-56260489 CAGGGATGGCCTGAAGCCTAGGG - Intergenic
1083422298 11:62560921-62560943 CAGAGATGGACTAAAGGACATGG - Intronic
1085181864 11:74543050-74543072 CAGGGGTGGCCAAAGGCATATGG - Intronic
1085349758 11:75790897-75790919 CAGGGCTGGCCCAAAGAAGATGG - Intronic
1085435179 11:76493429-76493451 CAGGGATGGCCTGAAGCATGGGG + Intronic
1085984390 11:81768166-81768188 GAGGGAAGTCCTAAAGTATAGGG - Intergenic
1086453354 11:86938520-86938542 CTGGGATTGGCTAGAGCATAGGG + Intronic
1087221530 11:95551443-95551465 CAGGGTTGTCCTGAAGGATAAGG + Intergenic
1087338932 11:96878303-96878325 CAGGGGTGGCCTGAAGCCTGGGG - Intergenic
1087453436 11:98353444-98353466 CAGGGATGGCCTGAAGTCTGGGG - Intergenic
1088597364 11:111450370-111450392 CAGGGATGGCCCACAGCACGTGG - Intronic
1091325944 11:134687779-134687801 CAGTGATGGCCTAACACATATGG - Intergenic
1093525724 12:20102150-20102172 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1095603184 12:44037565-44037587 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
1097536157 12:60873043-60873065 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
1098093666 12:66931254-66931276 CAGGGATGCCCTGAGGCAGAGGG + Intergenic
1098803012 12:74985658-74985680 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1099002724 12:77199657-77199679 CAGGGAAAGCCTAAAGCTGAAGG - Intergenic
1099033720 12:77560058-77560080 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1099560968 12:84173866-84173888 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1101580895 12:106040183-106040205 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1102305894 12:111804195-111804217 CACTGATGGCCTCAAGCATGAGG - Intronic
1102366237 12:112338296-112338318 CAAGAATGGCCTAACACATATGG - Intronic
1103173667 12:118843712-118843734 CAGGGATGGCCTGAAACTTGGGG + Intergenic
1104123816 12:125824428-125824450 CAGGGAATGACTAAAGCTTAGGG + Intergenic
1104208796 12:126666855-126666877 CAGTGATAGTCTAAAGTATAAGG + Intergenic
1104742516 12:131188803-131188825 CAGGGATGGCTGGAAGCATGGGG + Intergenic
1106325427 13:28684497-28684519 CAGGGATGGCCTGAAGCGTGGGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108445012 13:50499393-50499415 TAGGGATGATTTAAAGCATATGG + Intronic
1109348465 13:61145509-61145531 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
1109438897 13:62343529-62343551 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1109652881 13:65352917-65352939 CAGGGCAGGCCAAAAGCCTAGGG - Intergenic
1110132052 13:72021491-72021513 CAGGGGTGGCCAAAGGCATATGG - Intergenic
1110143349 13:72158815-72158837 AAGTGATGGACCAAAGCATAAGG - Intergenic
1110342916 13:74413870-74413892 CAGAGATGACCTAAAGTATGGGG + Intergenic
1110439134 13:75507963-75507985 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1110777992 13:79432488-79432510 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1110810648 13:79807859-79807881 CAGGGAAGGCCTGAAGCCTGGGG + Intergenic
1111141658 13:84127394-84127416 CAGGGATGGCCTGAAGCGTGGGG - Intergenic
1111268821 13:85853755-85853777 CAGGGATGGCCTGAAGCCCGGGG + Intergenic
1111485699 13:88895873-88895895 CAGGGATGGTCTTGAGCATGGGG + Intergenic
1111597288 13:90427951-90427973 CAGGGATGGCCTAATGCCTGGGG + Intergenic
1112910934 13:104483386-104483408 CAGGGATGGCCTGATGCCTGGGG - Intergenic
1113229305 13:108195024-108195046 CAGGGATGGCCTGAAACCTGGGG + Intergenic
1113503063 13:110793456-110793478 CAGGGATAGCCTGAAGCATGGGG + Intergenic
1115173038 14:30529841-30529863 CAGGGGTGGCCAAAAGCACATGG + Intergenic
1115310585 14:31974664-31974686 TAGGGACTGCCTAAAGCACAGGG - Intergenic
1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG + Intergenic
1116019292 14:39441480-39441502 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1116083391 14:40204525-40204547 CTGGGATGGCCTGAAGCCTGGGG - Intergenic
1116313757 14:43360248-43360270 CAGGGACAGCCTGAAGCATGGGG - Intergenic
1116918433 14:50548047-50548069 CTTGGATGGCCTAAAGAACAGGG + Intronic
1116961650 14:50973456-50973478 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1117904382 14:60569102-60569124 CAGGGATGGCAGAGAGCAGAAGG + Intergenic
1117941649 14:60973197-60973219 CAAGAATGGCCTAAAACACAAGG - Exonic
1119271412 14:73308289-73308311 CAGGGTTTGGCTAGAGCATAGGG + Intronic
1120567910 14:86082144-86082166 CAAGAATGGCCTAATACATATGG - Intergenic
1120592305 14:86390538-86390560 CAGGGATGGCCAGAAGCCTTGGG + Intergenic
1121368603 14:93337028-93337050 CAGAGATGGCCTAAAGCCTGGGG + Intronic
1122386073 14:101349177-101349199 CAGGGAAGACCTGAAGCATGGGG - Intergenic
1122699734 14:103580040-103580062 CAGGGATGACTTAAAGCATATGG + Intronic
1123155687 14:106223184-106223206 CAGTGGAGGCTTAAAGCATATGG - Intergenic
1124254673 15:28131005-28131027 GAGGGATGGCCAAAAGCACTGGG + Intronic
1125718100 15:41831015-41831037 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1125794315 15:42393185-42393207 CAGAGATGACTTAAAGTATATGG - Intronic
1125862063 15:43008614-43008636 CAGGAATGGCCTGAAGCCTGGGG + Intronic
1126215214 15:46146396-46146418 CAGGGATGGCCTCAGGCCTGGGG + Intergenic
1126608409 15:50504184-50504206 CAGAGATGACTTAAAGTATATGG + Exonic
1126958393 15:53961099-53961121 CAGGGATGAAGGAAAGCATAAGG - Intergenic
1128965269 15:72051906-72051928 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1130698818 15:86158366-86158388 CAAGGCTAGCCTAAAGCACAAGG + Intronic
1130738187 15:86571817-86571839 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1131842426 15:96451750-96451772 CAGTGATGTCCTACAGCAGACGG - Intergenic
1131999306 15:98163326-98163348 CAGGGATGGCCTGAAGTATGGGG - Intergenic
1135057090 16:19240639-19240661 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1137343887 16:47636849-47636871 CAGGGATGACCTGAAGCCTGGGG + Intronic
1137692932 16:50441730-50441752 TAGGGATGGCCTGAAGCCTGGGG + Intergenic
1137721377 16:50629584-50629606 CAGGGAAGCCCAAAAGCACAAGG + Intronic
1138925104 16:61581395-61581417 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1139138520 16:64233619-64233641 CAGGGATAACCTGAAGCATGGGG + Intergenic
1142940681 17:3378087-3378109 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1144096893 17:11907839-11907861 CAGAAATGGACAAAAGCATAGGG - Intronic
1144826301 17:18107548-18107570 CAGCCAGGGCCTAAAGCAGATGG + Exonic
1146901124 17:36589616-36589638 AAGAGATGGCTTAAATCATATGG - Exonic
1147093529 17:38126916-38126938 CAGGGATGGTCTAATGTCTACGG - Intergenic
1147103678 17:38193572-38193594 CAGGGATGGTCTAATGTCTACGG + Intergenic
1148077765 17:44948941-44948963 GAAGGATGGCTTACAGCATAAGG + Intergenic
1151260674 17:72913537-72913559 AAGGAAAGGCCTAAAGGATAAGG + Intronic
1151517460 17:74605639-74605661 CAGGGATGGCCTGAGGGAAAGGG + Intergenic
1151772750 17:76175972-76175994 CAGGGAGAGCCTAAAGTATAGGG - Intronic
1152961256 18:81842-81864 CAGGGATGCCCTAGGGCACAGGG + Intergenic
1153428799 18:4993038-4993060 CAGGGATGGCTTGAAGCCTAGGG - Intergenic
1153664055 18:7352262-7352284 CAAGGATGGCCTGGAGCACAGGG - Intergenic
1154073432 18:11176676-11176698 CAGGGATGGTCTGAGTCATATGG - Intergenic
1154357533 18:13633341-13633363 CAGGAATGGCCTAAAGCATGGGG - Intronic
1155819184 18:30352943-30352965 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1157147982 18:45185328-45185350 CAGGGAAGATCTAAAGCATGAGG + Intergenic
1157177789 18:45467104-45467126 CAGGGACGGCACAGAGCATATGG + Intronic
1158774106 18:60555708-60555730 CAGGGGTGGCCTGAAGCCTGGGG + Intergenic
1159096337 18:63906488-63906510 CAAGAATGGCCTAATACATAGGG + Intronic
1159292441 18:66439942-66439964 CTGGGAAGGCCTAAAGCCTGGGG + Intergenic
1159458550 18:68693772-68693794 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1160040554 18:75341353-75341375 CAGGGCTGGCCTTGAGCATCTGG - Intergenic
1160083583 18:75753832-75753854 CAAGGATGGCCTGAAGCCTGAGG - Intergenic
1160116624 18:76085009-76085031 CAGGGATGGCCTGAAGCTGGGGG - Intergenic
1161570995 19:5030878-5030900 CAGGGATGGCCTCAGGCCTTTGG + Intronic
1161780172 19:6286477-6286499 CAGGGAGGGCCTGAAGGCTAGGG + Intergenic
1164984426 19:32638107-32638129 CAGGGACAGCCTAAAGCCTGGGG + Intronic
1166799202 19:45445562-45445584 CAGGGAAGGCCTAAATGAGAAGG + Intronic
1167960204 19:53098991-53099013 CAGGGAAGACCAAAAGGATAGGG - Intronic
1168320830 19:55508642-55508664 CAGGGATGGCCTCATCCACAGGG + Intronic
1168320852 19:55508716-55508738 CAGGGATGGCCTCATCCACAGGG + Intronic
1168320874 19:55508790-55508812 CAGGGATGGCCTCATCCACAGGG + Intronic
1168320895 19:55508863-55508885 CAGGGATGGCCTCATCCACAGGG + Intronic
1168320917 19:55508937-55508959 CAGGGATGGCCTCATCCACAGGG + Intronic
925515295 2:4674727-4674749 CAGGGAAGGCCTGAAGCCTGGGG + Intergenic
927337513 2:21941982-21942004 CAGGGATGCCCCAGAGCATGTGG - Intergenic
927743197 2:25590804-25590826 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
928637876 2:33266450-33266472 CAGGAATGGCCTGAAGCCTGGGG + Intronic
929694277 2:44100832-44100854 CAGTGCTGGCTTAAAGCATTTGG - Intergenic
931300473 2:60973724-60973746 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
932398280 2:71462993-71463015 CAGGGATGGCCTGAAGCCTGGGG - Intronic
933090147 2:78108370-78108392 CCGGGGTGGCCAAAGGCATATGG + Intergenic
933606513 2:84389800-84389822 CAGGGATAGCCTGAAGTATGGGG - Intergenic
935680075 2:105628436-105628458 CAAGAATGACCTAATGCATATGG - Intergenic
935965042 2:108464672-108464694 CAAAAATGGCCTAAAACATAAGG - Intronic
937167790 2:119837050-119837072 CAGGGATGACCAGAAGCATGGGG + Intronic
937370840 2:121296278-121296300 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
937735260 2:125280213-125280235 CAGGGATAGCCTAAGACAGAAGG - Intergenic
938732559 2:134158154-134158176 CAGGGATGGCCTGAGGCCTGGGG - Intronic
939138388 2:138323923-138323945 CAGGGATGGCTGAAAGCTGAGGG - Intergenic
939189281 2:138897307-138897329 CAGGGGTGGCCATAGGCATAGGG + Intergenic
939932987 2:148256369-148256391 CGGGGGTGGCCAAAGGCATATGG + Intronic
940046829 2:149418669-149418691 CAGAGAAGGCCTAGAGCATTTGG + Intronic
940398719 2:153222477-153222499 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
940422828 2:153499453-153499475 CAGTGACGGCCTGAAGCATGGGG - Intergenic
940711199 2:157165274-157165296 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
941131051 2:161650958-161650980 CAGAGATGGCCTGAAGCCTGGGG + Intronic
941395126 2:164964636-164964658 CAGGGATGACATAATGCAAATGG - Intergenic
941404805 2:165074848-165074870 CAGGGATGACCTGAAGCCTGAGG + Intergenic
941998868 2:171626854-171626876 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
943190008 2:184663597-184663619 CAGGGATGGCCGGAAGCAATGGG + Intronic
943345679 2:186734699-186734721 CAGGTATGGCCTGAAGCACGGGG - Intronic
943950490 2:194128737-194128759 CAGAGAAGGCCTGAAGCATTGGG - Intergenic
943960213 2:194254436-194254458 CAGGGATGACCTGAAGCCTGGGG + Intergenic
944391848 2:199226483-199226505 CAGGGGTGGCCAAAGACATATGG + Intergenic
945721296 2:213421535-213421557 CAGGCATGGCCTAAAGCCTGGGG + Intronic
946208546 2:218128855-218128877 CAGAGATGGACTAAAGCTTCTGG - Intronic
947385460 2:229586473-229586495 CAGGGGAGGCCTGAAGCATTGGG - Intronic
948434526 2:237944106-237944128 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
1168945232 20:1748784-1748806 AAGGGAAGACCTAAAGCAGAGGG + Intergenic
1168983578 20:2027670-2027692 CAGAGATGACTTAAAGCATATGG - Intergenic
1169632348 20:7647583-7647605 CCAGGATGGCCTGAAGCCTAGGG - Intergenic
1169880498 20:10341654-10341676 CAGGGATAGCCTGAAGACTAGGG + Intergenic
1170763667 20:19273117-19273139 AAGGGATGGCCCAAAGCACCTGG - Intronic
1170834189 20:19869557-19869579 AAGGGATGGCCTAAAGTCCAGGG - Intergenic
1172755428 20:37280416-37280438 CAGGGTTGGCCTAAAGCAAAAGG - Intergenic
1175023747 20:55879238-55879260 TAGAGATGACATAAAGCATATGG - Intergenic
1175312644 20:58022625-58022647 CAGGGCTGGAGTAAAGCAAAAGG + Intergenic
1176055552 20:63144867-63144889 TAGGGATGGTTTAAAGTATATGG + Intergenic
1177037427 21:16060952-16060974 CAGAGATGGCCTGAAGCCTGGGG - Intergenic
1177624865 21:23646590-23646612 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1180058473 21:45372709-45372731 CAGAGATGATCTGAAGCATATGG + Intergenic
1181384189 22:22531735-22531757 TAGGGATGATCTAAAGTATATGG - Intergenic
1181424573 22:22825376-22825398 CAGGGATGGCCCACAGGATGTGG + Intronic
1182305778 22:29367071-29367093 CAGGAATGGCCTAGAGCTTGTGG - Intronic
1183818325 22:40322797-40322819 CAGGAAAATCCTAAAGCATACGG - Intronic
949311262 3:2701180-2701202 CAAGGAAGGCCTGAAGCAAAGGG - Intronic
950107161 3:10395584-10395606 CAAGGATGGCACAAAGAATACGG - Intronic
950994451 3:17480353-17480375 CAGGTATGGCCTGAAGCATGGGG + Intronic
951566854 3:24019910-24019932 CAGGGAAGGCCTGAAGCTTGGGG - Intergenic
952263179 3:31760456-31760478 TAGAGATGATCTAAAGCATATGG - Intronic
953377852 3:42443974-42443996 CACGGATTGCCTAAAGCCTTAGG + Intergenic
957614050 3:82505762-82505784 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
957646667 3:82939335-82939357 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
957665338 3:83218541-83218563 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
958467084 3:94472014-94472036 CAGGGAGGGCCTACAGAACAGGG + Intergenic
960781998 3:121330152-121330174 CAGGGAAGGCTTATGGCATAGGG + Intronic
961311394 3:126004174-126004196 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
962020858 3:131500444-131500466 CAAGGATGGTCAAAAGCATGTGG - Exonic
963349898 3:144139280-144139302 CAAGGAGGTCCTAAATCATATGG + Intergenic
964432823 3:156623821-156623843 CAGGGGTGGCCAAAGGCATATGG - Intergenic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
965013918 3:163131622-163131644 CAGGGATTGCCTGAAGTATGGGG + Intergenic
965117869 3:164515114-164515136 CAAGGATGGCCTAAAGTATATGG - Intergenic
965118627 3:164522185-164522207 CTGGGATGGCCTGAGGCATCAGG - Intergenic
965185829 3:165461906-165461928 AAGGGAAGGACTAAAGCACATGG - Intergenic
965774001 3:172209683-172209705 CAGGGAGGGCCTGAAGCCTATGG - Intronic
968142970 3:196273824-196273846 CAGGGATGGCCTGAAGCCTGGGG - Intronic
969179225 4:5424353-5424375 CAGGGATGGTCTGAAGCCTGGGG + Intronic
971092419 4:23360875-23360897 CAGGGAAGGCCTGAAGCATGGGG + Intergenic
971876837 4:32318898-32318920 CAGGGATGGCCTGAAGCATGGGG - Intergenic
972158831 4:36198398-36198420 CAGGGAGGGCCTAAAGGTTAGGG - Intronic
973026922 4:45284401-45284423 CAGGGATGGGCCGAAGCATGAGG - Intergenic
974023434 4:56711544-56711566 CAGGGATGGCCAGAAGCCTAGGG + Intergenic
974178965 4:58360463-58360485 CAGTGATGGCCTGAAGCCTGGGG - Intergenic
974432568 4:61817272-61817294 CAGGGATGGCCTGAAGCCTGTGG + Intronic
974521628 4:62987838-62987860 CAAGGATGGCCTGAAGCCTCTGG - Intergenic
974607698 4:64174061-64174083 CAGGGATGGCCTGAAACCTGGGG + Intergenic
974697928 4:65398509-65398531 CAGGGATGGCCTGAAGCCTGGGG + Intronic
974818415 4:67035541-67035563 CAGGGATGGGCTAGAGTTTATGG - Intergenic
975762518 4:77633231-77633253 CAGGGGTAGCCAAAGGCATATGG + Intergenic
976124213 4:81816324-81816346 CAGGGATGGATTAAAGTTTAGGG - Intronic
976129678 4:81870975-81870997 CAAGGATGGCCTGAAGCCTGGGG + Intronic
977816242 4:101416873-101416895 CAGGGATGGCCTGAGGCCTGGGG - Intronic
978149369 4:105415177-105415199 CAGGGATGGCCTGAAGCCTGGGG - Intronic
978248571 4:106604311-106604333 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
978347652 4:107788588-107788610 CAGGGAAGGCCTGAAGCCTGGGG - Intergenic
979129456 4:117023263-117023285 AAGGGATTTCCTAAAGCATATGG - Intergenic
979731680 4:124030435-124030457 CAGGGAAGGCCTAAAGGGTGTGG + Intergenic
980495732 4:133586201-133586223 CAGGGAAGGCCTAGAGAATAGGG - Intergenic
980544782 4:134244609-134244631 CAGGGATGGGCTGAAGCTTCGGG + Intergenic
980582711 4:134774219-134774241 CAGGGATGGCCTGAAGCATCAGG + Intergenic
982802613 4:159723104-159723126 CAGGGACGGCCTGAAGCCTGGGG - Intergenic
982856234 4:160385728-160385750 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
982918887 4:161249745-161249767 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
982957699 4:161792452-161792474 CAGGAATGGCCTGAAGCCTGGGG + Intronic
982959880 4:161823189-161823211 GAGGGACGGCCTAAAGCCTGGGG - Intronic
983069713 4:163254104-163254126 CAGGGACAGCCTGAAGGATAGGG - Intergenic
983323786 4:166227524-166227546 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
983494528 4:168428135-168428157 CAGGCTTGGCTTCAAGCATAAGG - Intronic
983715425 4:170776307-170776329 CATGGATGGCCTAATGCCTGGGG + Intergenic
983793028 4:171822319-171822341 CAGGGTTGGCATTAAGCAAAGGG + Intronic
984375325 4:178922281-178922303 CAGGGATGGCCTGAAGCCCAGGG + Intergenic
984451242 4:179905722-179905744 CAGGGATGGCCAGAGGCAGATGG - Intergenic
984763761 4:183384102-183384124 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
985314298 4:188638259-188638281 CAGCAATGGCATAAAGTATAAGG - Intergenic
985315650 4:188656661-188656683 CAGGGAAGACCAAAAGCAAAAGG - Intergenic
985960552 5:3299742-3299764 CAGGGATGGTGTAATGCACAGGG + Intergenic
986950635 5:13080446-13080468 CAGAGATGGCCTGAAGCCCAGGG + Intergenic
987081071 5:14425933-14425955 CAGGAATGGACTAAGACATATGG + Intronic
987451267 5:18086812-18086834 CATTGATGGACTAAAGCAGAAGG + Intergenic
987503386 5:18742498-18742520 GACGGATGGTTTAAAGCATAAGG + Intergenic
987646336 5:20676891-20676913 CAGAGATGACTTAAAGTATACGG - Intergenic
988486613 5:31672823-31672845 CATGAAGGGCCTAAGGCATATGG + Intronic
988714547 5:33811954-33811976 CAGGGATGACATAAACGATAGGG + Intronic
988811222 5:34786950-34786972 AAGGGATGGCCTGAAACAAAGGG + Intronic
989339163 5:40354642-40354664 CAGGGATGGCCTGAGGCCTGGGG + Intergenic
990878761 5:60517384-60517406 CTGGGATGGCCTGAAGCCTGGGG + Intronic
990889919 5:60636793-60636815 CAGGAATGCACTAATGCATATGG - Intronic
991359305 5:65803179-65803201 CAGGGAAGGCCTGAAGCCTGGGG - Intronic
992176696 5:74156424-74156446 TAGAGATGACTTAAAGCATATGG + Intergenic
994451563 5:99950605-99950627 CAGTGATGGCCTGAAGCCTGGGG + Intergenic
995146011 5:108787467-108787489 CAGCGATGGCCTGAAGCCTGGGG + Intronic
995355058 5:111227722-111227744 CAGGGAGGGCATAGAGTATAGGG + Intronic
995723997 5:115166163-115166185 CAGGGATAGCCTGAAGCCTAGGG + Intronic
995927010 5:117386419-117386441 CAGGGATGGCCTGAAGCCTCGGG + Intergenic
996217551 5:120887702-120887724 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
996443939 5:123522593-123522615 CAGGAATAACCTAAAGAATAGGG - Intronic
998460229 5:142304514-142304536 CAGCGATGGGCTAGAGCAGAAGG - Intergenic
1000410988 5:160934891-160934913 CAGGGGTGGCCAAAGGCATATGG + Intergenic
1000854239 5:166379376-166379398 CAGGGATGGCCTGAAACATGGGG - Intergenic
1001399151 5:171436552-171436574 CTGGGATGGCCTAAAGCAGGTGG + Intronic
1002317776 5:178355142-178355164 TAGAGATGACTTAAAGCATATGG + Intronic
1002678034 5:180935224-180935246 CAGGGATGACCTGAAGCCTGGGG - Intronic
1003438977 6:6122108-6122130 CATGGATGGCCTATAGCCTGGGG + Intergenic
1004720832 6:18266137-18266159 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1005594727 6:27368244-27368266 CAGGGATGGCCTAACACATGGGG + Intergenic
1005658518 6:27967935-27967957 CAAGGATGGCCTGAAGCCTGGGG - Intergenic
1006238225 6:32654513-32654535 TAGAGATGGCTTAAAGTATATGG - Intergenic
1006753741 6:36396584-36396606 CAGGGAAGGCCTAAAGGCTGGGG + Intronic
1006766333 6:36510062-36510084 CAGGGATGGCCTGAAGCCTGAGG - Intronic
1009241703 6:61193445-61193467 CTGGGATGGCCTGAAGCCTGGGG - Intergenic
1009530212 6:64803505-64803527 CAGGGAAGGCGTGAAGCATGGGG - Intronic
1009588621 6:65637973-65637995 CAGGGATGGCCTGAAGCCTGGGG + Intronic
1010022340 6:71174961-71174983 CAGGGATGCCCTAAAGAAAGAGG - Intergenic
1010027711 6:71239165-71239187 CAGGGAGGCCGTATAGCATAAGG + Intergenic
1010723642 6:79310299-79310321 TAGGGGTGGCCAAAGGCATATGG + Intergenic
1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG + Intronic
1010846875 6:80720224-80720246 CAGGGATTGTCTAAAGCCTGTGG + Intergenic
1010887608 6:81263515-81263537 CAGGGACAGCCTAAAGCGCAGGG - Intergenic
1012889921 6:104885942-104885964 CAGGGATGGCCTGAGGCCTGGGG + Intergenic
1014391677 6:120872465-120872487 CTGGGATGACCTGAAGCCTAGGG + Intergenic
1014391887 6:120873645-120873667 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
1014505340 6:122248050-122248072 CAGGCATGGCCTAAAGCCTGGGG - Intergenic
1016163328 6:140908266-140908288 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1016745126 6:147571151-147571173 CAAGGAGGACCTGAAGCATAAGG - Intronic
1017396281 6:154003095-154003117 CAGGGATGGTCTAAAGCCTGGGG - Intergenic
1020474855 7:8582790-8582812 CAGGGACAGCCTGAAGCATGGGG - Intronic
1020659617 7:10966493-10966515 CAGGGATGGCCTGAAGCCTGTGG - Intergenic
1021835890 7:24674337-24674359 CATGGATGGGCTGAAGAATAGGG - Intronic
1022952156 7:35349355-35349377 CAGGGAAGGACTGAGGCATAAGG + Intergenic
1023028716 7:36074683-36074705 CAGGGATGGTCTTAACCATGAGG - Intergenic
1023789106 7:43737734-43737756 CAGGGAGGGCCTAAAGACTGGGG + Intergenic
1023790455 7:43749725-43749747 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1026370185 7:69691251-69691273 CAGGGATGGCCTGAAGCCTAGGG - Intronic
1027241013 7:76329039-76329061 CTGGCAAGGCCTAAACCATAAGG + Exonic
1027734945 7:81920527-81920549 CAGAGACGGCCTAAAGCCTGGGG - Intergenic
1027924830 7:84447366-84447388 CAGGGATGGCCTGAAGTCTTGGG + Intronic
1028054568 7:86226159-86226181 CAGGGACTGCCTAAGGCATGAGG - Intergenic
1028136762 7:87230605-87230627 CAAGGATGGCCTGAAGCATGAGG + Intergenic
1029499191 7:100917376-100917398 AATGGATGGCCTAATGCTTAGGG - Intergenic
1029714550 7:102318826-102318848 CAGGGATGGCCTTAAGCACCTGG - Intronic
1030957609 7:115874191-115874213 TATGGATGGCATTAAGCATAAGG + Intergenic
1031648268 7:124253838-124253860 CATGCATGGCATAAAGAATATGG + Intergenic
1031786572 7:126040876-126040898 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1032894832 7:136238678-136238700 CAGAGATGACTTAAAGTATATGG + Intergenic
1032919275 7:136527495-136527517 CAGGGACAGCCTGAAGCATGGGG - Intergenic
1035722994 8:1806378-1806400 CAGGGGTGGGCGACAGCATATGG + Intergenic
1036907619 8:12720366-12720388 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1039182327 8:34880531-34880553 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1039860658 8:41454455-41454477 CAAAGATGGCCAAAAGAATAAGG + Intergenic
1042254339 8:66787981-66788003 CAGGGATGGCCTGAAAGAGAGGG - Intronic
1042820208 8:72922385-72922407 CAGGAATGGACTAAGGCAAATGG - Intronic
1043082546 8:75784599-75784621 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
1043180657 8:77083269-77083291 CAGGGATGTCCTAAAGCCTGGGG - Intergenic
1043956009 8:86360499-86360521 CAGGAAAGGCCTACTGCATAGGG - Intronic
1044129665 8:88505930-88505952 AAGGGATGGCCTGAAGCCTGGGG - Intergenic
1045026879 8:98096061-98096083 CATGGAAGGACTAAAGGATATGG - Intergenic
1047104677 8:121719892-121719914 CAGGGAAGGCCTGAAGCCTGGGG - Intergenic
1047442105 8:124887516-124887538 CAGGGATGGCTAAAAAAATAAGG - Intergenic
1048547966 8:135404773-135404795 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1050467913 9:5950830-5950852 TAGAGATGACCTAAAGTATATGG - Intronic
1050521936 9:6509988-6510010 CAGGGCTGTCCTGAAGAATAGGG - Intergenic
1050589702 9:7148962-7148984 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1050808892 9:9718976-9718998 CAGGGATGACCTGAAGCCTGGGG + Intronic
1050947940 9:11549778-11549800 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1051431547 9:16985130-16985152 CAGGGTTGTTATAAAGCATAGGG + Intergenic
1052466818 9:28839758-28839780 CTGGGATGGCCTAAAGCCTTGGG - Intergenic
1052597124 9:30574994-30575016 CAGGGATGACCCAAAGGCTAGGG + Intergenic
1053065018 9:35062069-35062091 CATGGATGGCCTAAAGCAGAGGG - Exonic
1054914695 9:70485224-70485246 TAGAGAGGGTCTAAAGCATACGG - Intergenic
1054916148 9:70496976-70496998 CAGGGATGGCCCAAAGTGCAGGG + Intergenic
1055601729 9:77926083-77926105 TAGGGAAGGCCAAATGCATATGG + Intronic
1057042716 9:91859021-91859043 CTGGGAAGGCCTAATGCAAAGGG + Intronic
1058545801 9:106059557-106059579 CAGGGATAGCCTGAAGCCTTGGG - Intergenic
1059104781 9:111501771-111501793 CAGGGACAGCCTAAAGCCTGGGG + Intergenic
1059852826 9:118363388-118363410 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
1060180112 9:121527896-121527918 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1062184707 9:135211733-135211755 CAGGGAGGGCCTAAAGGCTGGGG + Intergenic
1062329118 9:136029087-136029109 CAGGAATGGCCTGAAGCCCAGGG + Intronic
1062736902 9:138142294-138142316 CAGGGATGCCCTAGGGCACAGGG - Intergenic
1185850850 X:3485155-3485177 CAGGGAAGGCATAAATAATAGGG - Intergenic
1187376721 X:18762214-18762236 CAGGGATGGCTGACTGCATATGG + Intronic
1188026791 X:25218365-25218387 CAGAGATGGTTTAAAGTATACGG + Intergenic
1189185197 X:39048858-39048880 GAGGGATCCTCTAAAGCATAGGG + Intergenic
1191016350 X:55813777-55813799 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
1192773275 X:74215755-74215777 CAGAGATGGCCTTAAGGACAAGG - Intergenic
1192972880 X:76252445-76252467 CAGGAATGGCCTAACATATAAGG + Intergenic
1193211460 X:78811258-78811280 CAGTGATGGCCTGAAGTCTAGGG - Intergenic
1193919378 X:87406922-87406944 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1195880297 X:109586356-109586378 CAGGGAGGGCATGAAGCATGGGG - Intergenic
1197035642 X:121870423-121870445 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1197527183 X:127577554-127577576 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1197609550 X:128623261-128623283 CAGGGAGGGCCTAAATCCTGAGG - Intergenic
1197666353 X:129228240-129228262 TAGAGATGACTTAAAGCATATGG + Intergenic
1198045021 X:132892886-132892908 TAGAGATGACTTAAAGCATATGG - Intronic
1198189484 X:134288064-134288086 CAGGGATGGCCTAAAGCCTGGGG + Intergenic
1198586230 X:138125120-138125142 CTGGGATGGCCTAAAGAACAGGG - Intergenic
1200749154 Y:6929140-6929162 CAGGGATGGCCTGAAGCCTGGGG - Intronic
1202018184 Y:20434492-20434514 CAGGGAGGGCCCAAAGCCTGGGG - Intergenic