ID: 904553291

View in Genome Browser
Species Human (GRCh38)
Location 1:31339596-31339618
Sequence GCATTGGAGTGCTCCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904553286_904553291 26 Left 904553286 1:31339547-31339569 CCTTGCTGCATAGAGTTCTAAGA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904553291 Original CRISPR GCATTGGAGTGCTCCATCAA TGG Intronic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
907338172 1:53714317-53714339 GCAGAGGGGTGCTCCATAAATGG + Intronic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
918091679 1:181300641-181300663 GCACTGGAGTGCTCAATCTGTGG + Intergenic
923978313 1:239290345-239290367 GCATTTGAGTGCTGCCTCAGAGG - Intergenic
1064712717 10:18142529-18142551 GTATTCGAGTCCTCCATCAAAGG + Intronic
1065416917 10:25498442-25498464 ACATTTGAGTCCTACATCAAGGG + Intronic
1070684487 10:78470883-78470905 GTATTGGAGTGTGCTATCAAAGG - Intergenic
1070840661 10:79485500-79485522 CCAATGGAATGCTCCATTAATGG - Intergenic
1078067929 11:8090111-8090133 GCATTGGCCTGCACCATCAGGGG - Exonic
1080156473 11:29117587-29117609 GCACTGGATTGCTACATCATGGG + Intergenic
1085711802 11:78835772-78835794 GCCTAGGAGTGCACCAACAAGGG - Intronic
1095583474 12:43826051-43826073 CCATTGAAATGCACCATCAAAGG + Intergenic
1098081440 12:66790189-66790211 GCTTTGGACTGCGCAATCAATGG + Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1106989533 13:35400797-35400819 ACATAGGAGTGCTCCACAAATGG - Intronic
1117423346 14:55570477-55570499 GCATTGGCTTGCTCCTTCACTGG - Intronic
1117684338 14:58238056-58238078 ACTTGGGAGTGCTCCATCGATGG - Intronic
1129969470 15:79764971-79764993 GCAATGGAGAGTACCATCAAAGG + Intergenic
1130722814 15:86406087-86406109 GCATTGCTGCACTCCATCAAAGG - Intronic
1133743829 16:8672743-8672765 GGATTGGATTGCTAGATCAAAGG + Intergenic
1134644506 16:15855637-15855659 GCACTGAAGTGTTCCATCAACGG + Intronic
1135457926 16:22614907-22614929 GCTGTTGAGTGCTCCAGCAAAGG + Intergenic
1137028483 16:35501045-35501067 GCCCTGAAGAGCTCCATCAATGG + Intergenic
1141197333 16:81869949-81869971 GCATTGGAGTCCTCCAACTGGGG - Intronic
1144711512 17:17404403-17404425 CCCTTGGTGTGCACCATCAAGGG - Intergenic
1146288895 17:31594214-31594236 GCCCAGGAGTGCTCCATGAAAGG + Intergenic
1147722155 17:42546028-42546050 CCAATGGAGTTCTCCATAAAAGG - Intergenic
1147723340 17:42552198-42552220 CCAATGGAGTTCTCCATAAAAGG - Exonic
1166040248 19:40198103-40198125 GCTTTGGGGAGCTCCATGAATGG - Intronic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
925956122 2:8966828-8966850 GTATTGGAGTGCTCTGTCATGGG - Intronic
937132921 2:119526677-119526699 GGATTGAAGTGCTCCCTGAAAGG + Intergenic
937852765 2:126650200-126650222 GTATTGGGGTCCTTCATCAAGGG + Intergenic
938848793 2:135238923-135238945 GCATGGGTGTCTTCCATCAAGGG + Intronic
941271084 2:163429906-163429928 GCATAGGAGTGCCACATCTAAGG - Intergenic
942701622 2:178717720-178717742 GCATTTGAATGCCGCATCAATGG - Exonic
943531409 2:189086033-189086055 GTGTGTGAGTGCTCCATCAATGG + Intronic
1177361252 21:20075307-20075329 GTATTGTTCTGCTCCATCAATGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1181404721 22:22674655-22674677 TCTTTGGAGTGTTCCCTCAAGGG - Intergenic
1181413294 22:22740169-22740191 TCTTTGGAGTGTTCCCTCAAGGG - Intronic
1181850574 22:25747160-25747182 GGGATTGAGTGCTCCATCAAAGG - Intronic
952228524 3:31404365-31404387 GCTTTGGAGTGTTCCCTCTATGG - Intergenic
955107455 3:55912022-55912044 ACATTGGAGTGATCTACCAAAGG + Intronic
957756901 3:84501179-84501201 TCATTGGCGTGCTTCATCTACGG + Intergenic
961752232 3:129103453-129103475 GCCTTGGAGTACTCCAGGAATGG - Intronic
964162623 3:153663761-153663783 GCATTGCATTTCTCCATCCAGGG + Intergenic
980107214 4:128599474-128599496 CCTTAGGAGTGCACCATCAAAGG - Intergenic
982980779 4:162132274-162132296 GCACTACAGTGCTCCATCAGAGG + Intronic
991615722 5:68495294-68495316 GCATTTGGATGCTGCATCAAGGG + Intergenic
996053853 5:118963541-118963563 GCATTGAAGTTCTCCAGGAAAGG + Intronic
999468189 5:151826844-151826866 GCTGTGCAGTGCTCAATCAAAGG + Intronic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1002240037 5:177832521-177832543 CCAGTGGAGTGCTTCATGAAGGG - Intergenic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010108614 6:72197593-72197615 GCATTGAAGTGCTTCGACAAAGG + Intronic
1011907758 6:92393003-92393025 GCATTGAAGTGTTGCATCATAGG - Intergenic
1014944175 6:127477155-127477177 ACATTGGAATGGTCCATCCAAGG + Intronic
1015940525 6:138446905-138446927 GCATTTCATTGCTACATCAAAGG - Intronic
1018217514 6:161544204-161544226 GAATTGGTGTGCTCTATCAAAGG - Intronic
1018797964 6:167201959-167201981 AGATTGGAGTGGTCCATCTACGG + Intergenic
1018814751 6:167322213-167322235 AGATTGGAGTGGTCCATCTACGG - Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021112387 7:16710302-16710324 GAAATGGAGTGCTGGATCAATGG - Intergenic
1021858220 7:24879110-24879132 TCTCTGGAGTGCTCCATCAGAGG + Intronic
1023853411 7:44163692-44163714 CCATGGGAGTGCTCGATGAAGGG + Intronic
1034535459 7:151723266-151723288 GCAGTGGAGTCCTTCTTCAAGGG + Intronic
1035452929 7:158990102-158990124 GCCTTGGAGGGCTTCATAAAGGG + Intergenic
1041671086 8:60492575-60492597 GGATTTGAGTGCACCATCCAGGG - Intergenic
1043317879 8:78943849-78943871 GCAATGGAGTTCTTCCTCAAAGG + Intergenic
1044274595 8:90285274-90285296 GAATTGGAGTGCACCAGCACTGG + Intergenic
1045396393 8:101764703-101764725 ACAGTGAAGTGCTCCATAAATGG - Intronic
1046224644 8:111261859-111261881 GCATTAGAATGCTTAATCAAGGG - Intergenic
1047820870 8:128518994-128519016 GAATTTGGGTACTCCATCAATGG - Intergenic
1050174601 9:2856580-2856602 GCATTTGATTGCTCCATGACTGG + Intergenic
1050333286 9:4566727-4566749 GCATTGTAGAGCTCCAGCAATGG - Intronic
1051049970 9:12920637-12920659 GATTTGGAATGTTCCATCAATGG - Intergenic
1055196261 9:73598182-73598204 GCAATTGAGTGCTCAATCCAAGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1191849046 X:65572034-65572056 GCATTAGTGTGCTCCATGATAGG + Intergenic
1195543771 X:106092199-106092221 GCCTTGGAGTACTTCATGAATGG + Intergenic
1198864085 X:141102626-141102648 CCATTCGGGAGCTCCATCAAGGG - Intergenic
1198898604 X:141484789-141484811 CCATTCGGGAGCTCCATCAAGGG + Intergenic