ID: 904556620

View in Genome Browser
Species Human (GRCh38)
Location 1:31369076-31369098
Sequence CAGGGTCACCCAGCTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 9, 3: 61, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904556614_904556620 24 Left 904556614 1:31369029-31369051 CCATCTATGGAAGGGGAAAGAAA 0: 1
1: 1
2: 2
3: 50
4: 349
Right 904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG 0: 1
1: 0
2: 9
3: 61
4: 429
904556615_904556620 1 Left 904556615 1:31369052-31369074 CCTAGAGCTACTGCATACCTTGC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG 0: 1
1: 0
2: 9
3: 61
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904556620 Original CRISPR CAGGGTCACCCAGCTGGAGC TGG Intronic
900126933 1:1072876-1072898 CAGGGCCAGCCAGGTGGGGCAGG - Intronic
900165254 1:1241919-1241941 CCGGGGCACCCAGGTGGAGCAGG - Intergenic
900170815 1:1267781-1267803 CAGGCTCGCCCAGCAGGGGCCGG + Intronic
900195632 1:1374317-1374339 CAAGGGGGCCCAGCTGGAGCTGG - Exonic
901089005 1:6629246-6629268 CAGGGGCACCCACGTGGAGTGGG + Intronic
901685698 1:10942223-10942245 GTGGGCCACCCAGCTGGAGAAGG - Intergenic
902058791 1:13624214-13624236 AAGGGCCACCCAACAGGAGCTGG - Intergenic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902560815 1:17276531-17276553 CAGGGTCACCCAGGTGGTGCGGG + Exonic
902932791 1:19743180-19743202 CAGGGTCACCCAGCTAGTCAGGG - Intronic
903342157 1:22661257-22661279 CATGGTCCTCAAGCTGGAGCAGG + Exonic
903811304 1:26036384-26036406 GGGGTTCACCCACCTGGAGCTGG + Exonic
903875720 1:26472094-26472116 CTGGGGCCCCCAGCGGGAGCAGG + Intergenic
903908191 1:26701531-26701553 CAGGGTCACACAGCTTAATCTGG - Intronic
904029209 1:27523520-27523542 CAGGGTCACACAGCAGAACCAGG + Intergenic
904237232 1:29123489-29123511 CCGGGTGACCTTGCTGGAGCCGG - Intronic
904376315 1:30084605-30084627 CAGGGTCACCAAGCAGAAACAGG - Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
905220467 1:36442885-36442907 CAAGGTCACACAGCTGGTGATGG + Intronic
905402963 1:37716511-37716533 CAGAGTCACTGAGCTGGGGCAGG + Exonic
905555506 1:38879469-38879491 TGAGGTCACACAGCTGGAGCTGG + Intronic
905879597 1:41454922-41454944 CAAGGTCACACAGCTAGAGGTGG - Intergenic
905939832 1:41854246-41854268 CAGGGCCACCCAGCAGGCGCTGG + Intronic
905973232 1:42156309-42156331 GAAGGCCTCCCAGCTGGAGCTGG - Intergenic
907506516 1:54923015-54923037 CAGGCTAACCCAGCTGGAGCCGG + Intergenic
907525834 1:55053494-55053516 CAGGGTCGCACAGCTCAAGCTGG + Intronic
907798571 1:57742010-57742032 GAGGTTCAACCACCTGGAGCAGG + Intronic
908329114 1:63052890-63052912 CAAGGTCACACAGCTGGAAGTGG + Intergenic
908830781 1:68176245-68176267 CCGAGTCACCCAGCTGGTGGTGG + Intronic
911077595 1:93893205-93893227 CAAGGTCACCCAGCTGGCTTTGG - Intronic
912498484 1:110106575-110106597 CAGGGCCAAGGAGCTGGAGCAGG - Intergenic
912569909 1:110613765-110613787 CAGGGTCACCCAGCCAGTCCAGG + Intronic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
913012463 1:114697771-114697793 CAGGGTGACCCTCCAGGAGCGGG - Intergenic
915734630 1:158076933-158076955 TAAGGTCACCCAGCTGGCGGAGG - Intronic
917600430 1:176568449-176568471 CAAGGTCACACAGCTGGTGCAGG + Intronic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
918056279 1:181024334-181024356 CAAGGTCACCAGTCTGGAGCTGG + Intergenic
918276703 1:182959769-182959791 CAGTGTCACTCGGCTGCAGCTGG - Intergenic
920048650 1:203150193-203150215 CAGGCTCACCCAGTGGGTGCAGG - Intronic
920346132 1:205306807-205306829 GAGGGTCAGCCAGATGGAGGGGG + Intronic
920351223 1:205339291-205339313 CAGGGTCACAAAGCTGGAGAAGG + Exonic
920513687 1:206568609-206568631 CAGGGAGCTCCAGCTGGAGCTGG + Intronic
921512108 1:216044760-216044782 CAAGGTCACACAGCTTGAGTCGG - Intronic
1063692723 10:8302711-8302733 CAGGGCCACACACCTGGAGAGGG - Intergenic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1067469921 10:46528629-46528651 CAGGGTCACCCTGCAGCTGCAGG - Intergenic
1069355851 10:67584440-67584462 GAGGGTCACCCAGCTGTATGAGG + Intronic
1069597954 10:69684804-69684826 CAGGATCATACAGCTGGAACAGG + Intergenic
1069769606 10:70888785-70888807 CAGGGCCACCCAGCTGTAAGCGG - Intergenic
1069866425 10:71506503-71506525 CAGGGTCCCCCAGCCAGAGATGG + Intronic
1070798295 10:79230004-79230026 CAGGGTCACACAGCTAGGGAGGG + Intronic
1071789962 10:88942969-88942991 CAGGGTCACACAGCTAGAACTGG - Intronic
1072211253 10:93248931-93248953 CAGGGTCCCGCAGCTGCAGCTGG - Intergenic
1072623400 10:97095762-97095784 CAAGGTCACACACCTGGTGCAGG - Intronic
1072970961 10:100017082-100017104 CATGTTCACCCCGCAGGAGCGGG - Intergenic
1073513455 10:104057067-104057089 CAGGGGCACCAGGCTGGCGCTGG + Exonic
1074100114 10:110348232-110348254 CAGGGTCACCCATCAGGGGCTGG - Intergenic
1074101141 10:110355732-110355754 CAAGGTCACCCAACTGGACTCGG - Intergenic
1074336358 10:112580420-112580442 CAAGGTGACTCAGCAGGAGCGGG + Intronic
1074549254 10:114427662-114427684 CAGGCCCACCCTGCTGGAGGTGG - Intergenic
1075087217 10:119421767-119421789 CAGGGTCTCCCAGCTGAGCCAGG - Intronic
1075412685 10:122240607-122240629 CAGGGTCACACAGCTGGGAGGGG + Intronic
1075512942 10:123086897-123086919 CAGGGTCACGGAGGTGGAGGTGG + Intergenic
1075777630 10:124998565-124998587 CAGGGTCTCCCTCATGGAGCTGG + Intronic
1076812278 10:132893438-132893460 CAGGTTCACCCAGGAGGAGGAGG - Intronic
1076979659 11:197752-197774 CAGGGTCACTAACCTGGACCAGG - Exonic
1077478061 11:2800271-2800293 CAGGGTTACCCTGCTGGGGGAGG - Intronic
1078431631 11:11292679-11292701 CAGAGTCTCACAGCTGGGGCAGG - Intronic
1079203661 11:18395599-18395621 CAGAGTCACCAAGCTGGAGCCGG - Intronic
1079481306 11:20883237-20883259 CTGGGTCACCCTGCTTTAGCTGG + Intronic
1081623859 11:44635046-44635068 CAGGGCCACCCTGCTGGTGAGGG - Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1082003994 11:47409751-47409773 CAGAGACACCCAGCTGGGCCGGG + Intronic
1082085348 11:48045336-48045358 CAGGGTCACCCAATGGGATCAGG - Intronic
1082782073 11:57295633-57295655 CAGGGTCACCAAGTTGTGGCAGG - Intergenic
1083212248 11:61195496-61195518 CTGGCTCTCCCATCTGGAGCAGG + Intergenic
1083477393 11:62923129-62923151 CAGGGTCACCCAGCCGGTCAGGG + Intergenic
1084089045 11:66868503-66868525 CGGGGTCACACAGCTGGCGCTGG - Intronic
1084147818 11:67274407-67274429 AGGGGTCACCCACCAGGAGCCGG - Intronic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084323749 11:68387526-68387548 CAGGGTCACACAGCAGGATGTGG + Intronic
1084444701 11:69196850-69196872 CAGGGTGGCCCGGCCGGAGCAGG + Intergenic
1084447086 11:69209878-69209900 CAGGGTCACGCAGCTGGGAAAGG - Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1084689190 11:70715271-70715293 CAGGGTCACCCAGCCGGGAAGGG + Intronic
1084704937 11:70810635-70810657 GAAGGTCACACAGCTGGGGCAGG - Intronic
1085274774 11:75291481-75291503 CATGGTCACCCAGCTGGATAAGG + Intronic
1085834703 11:79940280-79940302 CAGGTTAAGCCAGGTGGAGCAGG - Intergenic
1087149930 11:94850235-94850257 CAGGGTCATCAAGCTGGAAGAGG + Exonic
1087672920 11:101128215-101128237 CAGGGTCGCCCTGGTGGAGCAGG - Exonic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089166642 11:116482585-116482607 CAGGGTCCCCCAGTTGGTGAAGG - Intergenic
1089731745 11:120523645-120523667 CAGGGTCACACAGCTGAACCTGG + Intronic
1089974234 11:122718456-122718478 CAAGGTCACACGGCTGGAGATGG - Intronic
1090298965 11:125617356-125617378 CAAGGTCACCCAGCTAGAATTGG + Intronic
1090778623 11:129986746-129986768 CTGGGTCATGGAGCTGGAGCTGG - Intronic
1091015855 11:132050241-132050263 CAGGGTCAAGCAGCTGGAGAGGG + Intronic
1091102297 11:132886488-132886510 GAGAGGCCCCCAGCTGGAGCTGG - Intronic
1091464577 12:672708-672730 CAGGATCACACAGCTGGTGATGG + Intergenic
1091624987 12:2115015-2115037 CAAGGTCACCCAGCTAAACCAGG + Intronic
1091657562 12:2356667-2356689 CAGGGTCAGACAGCTAGCGCTGG - Intronic
1091804043 12:3343292-3343314 CAGGGGCAGCCAGCAGGTGCGGG + Intergenic
1091804711 12:3347639-3347661 CAGGGTCACACTGCTGTAGGTGG - Intergenic
1092082217 12:5725664-5725686 CAGGACCACCCAGTGGGAGCTGG - Intronic
1094852368 12:34388024-34388046 CAGGGACACCCAGCTTAACCTGG + Intergenic
1095038827 12:37421244-37421266 CAGGGGCACGCAGGTGGACCTGG + Intergenic
1096217815 12:49808275-49808297 CAGAGTGCCCCAGCTGGAGTGGG + Intronic
1101002578 12:100371506-100371528 AAGGATCATCCAGCTGCAGCTGG - Intronic
1101725639 12:107385994-107386016 CAAGGTCACACAACAGGAGCTGG - Intronic
1102004707 12:109581710-109581732 CAGGGCCACACAGCTAGTGCTGG + Intronic
1102413428 12:112739884-112739906 CAGTGTCACCCAGTAGAAGCTGG - Intronic
1102435618 12:112920903-112920925 CAGGGTCACCCAGCTGGTCAGGG + Intronic
1102577649 12:113866552-113866574 CAGGTTCACCCAGTTGGTGAGGG - Intronic
1102754535 12:115326814-115326836 CATGGTCACCCAGCTGGTTGGGG + Intergenic
1102826083 12:115948874-115948896 CTCTGTCACCCAGCTGCAGCAGG - Intergenic
1103331101 12:120154633-120154655 CACGGTCACGCAGCTAGTGCAGG + Intronic
1103487727 12:121294629-121294651 CAGGGTCACACAGCCAGTGCAGG - Intronic
1103611988 12:122129620-122129642 CAGGCTCACCCACCTGGACCAGG - Exonic
1103715795 12:122944710-122944732 CAGAGGCCTCCAGCTGGAGCAGG + Intronic
1104895249 12:132160808-132160830 CAGGTTCCCCCAGCTGGTGTCGG + Intergenic
1104902621 12:132197577-132197599 CAGGGTCACACAGCCAGAGAGGG - Intronic
1104912714 12:132247445-132247467 CAGGGTCCCTGAGCTGGAGTTGG - Intronic
1105892614 13:24692415-24692437 CAGGGTCACCTAGCAGGAGAGGG - Exonic
1106128271 13:26919217-26919239 TAAGGTCATCCAGCTGGAGCTGG - Intergenic
1107250111 13:38349952-38349974 CAGGGTCGGGCAGCTGGACCAGG - Intronic
1108004225 13:45931414-45931436 CAGGGCCACCTAGCAGGGGCCGG - Intergenic
1108264968 13:48697278-48697300 GAGGGTCACCCAGCTGTATGAGG - Intronic
1110329720 13:74257484-74257506 CAGTGTGAGCCAGATGGAGCAGG + Intergenic
1111434094 13:88183918-88183940 CAGGGGCACGCAGCTGGAAGAGG + Intergenic
1112294480 13:98174863-98174885 CAAGGTCACGCAGCTGTAACTGG + Intronic
1113425772 13:110207176-110207198 GAGGCTCACCCCGCTGGATCAGG - Intronic
1113658395 13:112085962-112085984 CAAGGCCACCCAGCAGGAGGTGG - Intergenic
1113945113 13:114039632-114039654 CAGGGTGACCCCACAGGAGCTGG + Intronic
1114430667 14:22657674-22657696 CCTGGTCACCCAGCTGGAGGGGG - Intergenic
1114796489 14:25720934-25720956 CAGGGGCACCCAGCTGTATGAGG + Intergenic
1115662683 14:35512490-35512512 CAATGTCACTCAGCTGCAGCTGG - Intergenic
1117756483 14:58979515-58979537 CAGGGTCACCCGACAGTAGCTGG - Intergenic
1118911493 14:70065536-70065558 CAAGGTCACCCAGCTAGTGAGGG - Intronic
1118974288 14:70663954-70663976 GAAGGTCACCCAGCTGGAAGGGG - Intronic
1119485953 14:74986714-74986736 CAAGGTCACCCAGCTTGTGAGGG + Intergenic
1119547009 14:75479321-75479343 GAGGTACACCCAGCTGGAGTGGG - Intergenic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1119668449 14:76500624-76500646 CTGGGTCCTCCAGCTTGAGCAGG - Intronic
1119779238 14:77267079-77267101 CAAGGTCACCCAGCTGATGAAGG - Intronic
1120454925 14:84718661-84718683 CTAGGTCACCAAGCTGGACCTGG - Intergenic
1121517416 14:94561744-94561766 CAGGGACACACAGCTGGTACAGG + Intronic
1121736425 14:96221048-96221070 CAGAGTCACACAGCTGGTGATGG - Intronic
1122164860 14:99814972-99814994 CAGGGTCACACAGCTAGGGAGGG + Intronic
1122284461 14:100642433-100642455 CAGGGTCACCTCCCTGGAGTGGG - Intergenic
1122347454 14:101069389-101069411 CAAGGTCACCCAGCTGGAGGTGG + Intergenic
1122408387 14:101513599-101513621 CTGGGTCAGCCTGCAGGAGCAGG + Intergenic
1123990206 15:25677813-25677835 CTGGGACTCCCAGCTGGAGCTGG - Exonic
1124120160 15:26882265-26882287 CCGGGCCACCCTGCTGGGGCTGG + Intronic
1126675889 15:51159057-51159079 TAGGCTCACCCATCTGGAGATGG - Intergenic
1126806428 15:52353936-52353958 GCGGGTCACAGAGCTGGAGCAGG - Exonic
1127598111 15:60507386-60507408 CAGGTTCACCTAAATGGAGCTGG + Intronic
1127754406 15:62077113-62077135 CATGGTCACACAGCTGGTGAGGG + Intergenic
1128227583 15:66012911-66012933 AAGGGCCAGCCAGCTGGACCGGG + Intronic
1128755662 15:70182017-70182039 CAAGGCCACACAGCTGGAACTGG + Intergenic
1129059311 15:72848216-72848238 CAGGGTCACCCAGCAAGAGCTGG + Intergenic
1129711122 15:77820603-77820625 CAAGGTCACACAGCAGGAGCGGG - Intronic
1129831568 15:78674264-78674286 CAGGGTAACACAGCTGGAAGGGG + Intronic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1129976147 15:79823471-79823493 CAAGGTCACGCAGCTGGTGTTGG - Intergenic
1130171298 15:81517640-81517662 CATGCTTATCCAGCTGGAGCTGG + Intergenic
1131093997 15:89644853-89644875 CAGGGTCACACAGCTGGAAGAGG + Intronic
1131181650 15:90244114-90244136 CAAGGTCAGGCAGCTGGAGTCGG + Exonic
1132226973 15:100150400-100150422 CAGGCTCACCCAGCTGGAAAGGG - Intronic
1132348565 15:101123025-101123047 CAAGGCCACCAAGCTGGGGCTGG + Intergenic
1132602746 16:781321-781343 CAGGGCCTCCCAGCAGGAACTGG + Intronic
1132627340 16:897767-897789 GAGGGTGGCCCAGCTGCAGCAGG + Intronic
1132982597 16:2746145-2746167 TGCGGTCACCAAGCTGGAGCAGG + Intergenic
1133035924 16:3034246-3034268 CAGGGTCACACAGCTGGACGAGG + Intronic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1133128452 16:3662081-3662103 CATGGTCACCGTGCTGGAGATGG - Exonic
1133330933 16:4973444-4973466 CAGTGTCACCCAGCTGATGAAGG - Intronic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1134081379 16:11327316-11327338 CCAGGGCACCCAGCCGGAGCTGG - Intronic
1134625202 16:15718380-15718402 CCGGATCGCCCAGCTGGAGGAGG - Exonic
1134627500 16:15732823-15732845 CAAGGTCACACAGCTAGAGAGGG - Intronic
1135063474 16:19290212-19290234 CAAGGTCTCCCAGCTGGGGTGGG - Intronic
1135161995 16:20104676-20104698 CAGGTTCACCCAGCTAGAAAGGG + Intergenic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136008925 16:27349712-27349734 CAGGGTCACACAGCTGGAAATGG + Intronic
1136414610 16:30095841-30095863 GAGGGTCCCCCACCTGGAGGAGG + Exonic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136716559 16:32287502-32287524 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1136834947 16:33493780-33493802 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1136996670 16:35195502-35195524 CAGGCGCCCCCAGCTGGAGGTGG + Intergenic
1137571016 16:49566347-49566369 CTGGGTCACCCAACTGGGGCAGG + Intronic
1137720510 16:50625020-50625042 CAGGGTCACACAGCTGTGGAGGG + Intronic
1138428633 16:56953145-56953167 AGGGGTCAGCCAGCTGGGGCAGG + Intergenic
1139940450 16:70601723-70601745 CTGGGAAACCCAGCAGGAGCTGG - Intronic
1140449889 16:75062559-75062581 CAGGATCACCCGGGAGGAGCAGG + Intronic
1140975411 16:80055490-80055512 CAGGGTCCCTCAGCTGCAGTGGG - Intergenic
1141421834 16:83922544-83922566 CTGGGCCACCCAGCTGGAAGTGG - Exonic
1141846469 16:86612505-86612527 CAAGGTCACCCAGCTGCTCCAGG - Intergenic
1141995619 16:87634878-87634900 CAGTGTCACCCAGCTAGAGCGGG - Intronic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1203009856 16_KI270728v1_random:230252-230274 CAGGTTCACCCAGAAGCAGCAGG + Intergenic
1203145109 16_KI270728v1_random:1794068-1794090 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1142742297 17:1938103-1938125 CAGTGTGACAGAGCTGGAGCAGG - Intronic
1142967211 17:3589096-3589118 CAGGAGCCACCAGCTGGAGCTGG + Intronic
1143270126 17:5669225-5669247 CAGGTTCACCCAGCCTGACCTGG - Intergenic
1143473646 17:7191288-7191310 CAGAGCCACCAAGCTGGAGCAGG - Exonic
1143625560 17:8108704-8108726 CAGGGACCCCCAGGTGCAGCTGG + Intronic
1143716698 17:8776868-8776890 CTGGGCCACCAAGCTGGAGAGGG + Intergenic
1144711542 17:17404554-17404576 CAGTGCCACCCAGCTGAACCTGG - Intergenic
1145000621 17:19302109-19302131 CAAGGCCACCCAGCTGGGGCAGG - Intronic
1145348555 17:22057475-22057497 CAAGGTCACACAGCTGGAAATGG + Intergenic
1146846456 17:36184175-36184197 CAGGGTGAGCAAGCTGAAGCAGG + Intronic
1147893438 17:43733791-43733813 CAGTGTCAACTACCTGGAGCTGG - Intergenic
1147906728 17:43828089-43828111 CAAGGTCACCCAGCTGGTAAAGG + Intronic
1148212911 17:45818996-45819018 CTGGGTCACCCAGAGGGAGCAGG - Intronic
1148806490 17:50266592-50266614 CAGCATCCCCCACCTGGAGCAGG + Intergenic
1152157513 17:78644500-78644522 TGGGGTCTCCCAGCTGGAGATGG - Intergenic
1152199335 17:78935979-78936001 CAGGGTGATCCAGGTGGAGGAGG + Intergenic
1152617978 17:81346446-81346468 CCAGGTCGCCCAGCTAGAGCCGG + Intergenic
1152740123 17:82015071-82015093 CCCGGTCACCAAGCTGGGGCTGG - Exonic
1152754503 17:82081625-82081647 CAGGGACAGCCAGCGGGACCTGG - Exonic
1152898660 17:82927863-82927885 CAGAGACACCCAGCTTGAGAGGG - Intronic
1153503307 18:5770396-5770418 CAGGGTCAGACACCTGGAGACGG - Intergenic
1154193765 18:12251580-12251602 CAAGGTCACCCAGCTAGAGGAGG + Intergenic
1155075219 18:22348640-22348662 CGGGGCCGCCCAGCCGGAGCCGG - Intergenic
1157568129 18:48693914-48693936 CAGGGTCAACCCTCTAGAGCAGG - Intronic
1157784764 18:50471696-50471718 CAGGGTCACCCAGTTGGTTAAGG - Intergenic
1157914841 18:51654829-51654851 CTGCGGCACCCAGCTGGGGCTGG + Intergenic
1160761912 19:789730-789752 CAGGACCTCCCAGCAGGAGCAGG + Intergenic
1160771746 19:835171-835193 GAGGGTCCCCCTGCTGGGGCGGG + Intergenic
1160774408 19:848422-848444 CAGGGCCACCCTGATGGGGCCGG - Intergenic
1160874567 19:1291104-1291126 CAGGGTGTCCCACCTGGGGCCGG + Intronic
1161070130 19:2255836-2255858 CAGGGTCACGCAGCAGGATGTGG - Intronic
1161131007 19:2588688-2588710 CTGGGTAACCCAGCTGGGGTTGG - Intronic
1162470164 19:10868308-10868330 TAGGGTCACCCAGCTTGGGAGGG + Intronic
1162495662 19:11022042-11022064 CAGGCCCAGCCAGCTGTAGCTGG - Intronic
1162870684 19:13584253-13584275 CAGGGTCGCCCAGCTCTAACAGG + Intronic
1163548613 19:17952904-17952926 CAAGGTCACCCAGCTGGGCTGGG + Intronic
1163642213 19:18468314-18468336 CAGGGTCACCCACATGGCTCTGG - Intronic
1163797690 19:19346799-19346821 CAGCATCACCTACCTGGAGCGGG + Intronic
1164596615 19:29534330-29534352 CAGGGGCACCCAGGTGGTGCAGG + Intronic
1164941186 19:32253203-32253225 CAGGGTCACCCACAGGGACCTGG + Intergenic
1166052464 19:40268447-40268469 CAAGGCCACCCAGCTGGCGGTGG - Intronic
1166199317 19:41226282-41226304 CAGGGTCAGCGCGCGGGAGCTGG - Intronic
1166216927 19:41341941-41341963 CATGGCCACCCCGCTGGAGAGGG - Exonic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1166535478 19:43571378-43571400 GAGAGTGCCCCAGCTGGAGCTGG - Intronic
1166999438 19:46737214-46737236 CAGGGTCACACAGCTGGGATGGG - Intronic
1168241383 19:55090855-55090877 CACGGCCCCCCAGCAGGAGCAGG + Intergenic
925290903 2:2748168-2748190 CAGGCCCAACCAGCTGCAGCAGG - Intergenic
925719905 2:6817249-6817271 CATGGTCCACCAGCTGGGGCAGG + Intergenic
925768302 2:7259046-7259068 CCAGGTCACCAAGCTGGACCTGG - Intergenic
925818034 2:7772319-7772341 CAGGGTCATCGAACTGGAACTGG + Intergenic
926045827 2:9708939-9708961 CAGGGTCTCTCAGCTTCAGCAGG - Intergenic
926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG + Intergenic
926299405 2:11591317-11591339 CAGGGCCGCACAGCTGGTGCTGG + Intronic
927855054 2:26522750-26522772 CAGGGTCACACAGCAGGTTCAGG - Intronic
928323999 2:30305698-30305720 CAGAGTCACCCTCCTGGAGAAGG - Intronic
928450032 2:31370504-31370526 CCAGGTCAGCAAGCTGGAGCAGG + Intronic
928495094 2:31823298-31823320 CAATGTCACTCAGCTGCAGCTGG - Intergenic
929993919 2:46813115-46813137 CAGAGTCACCCAGCTAGTGAGGG + Intergenic
930103526 2:47620918-47620940 CAAGGTCACACAGCTGGTGATGG + Intergenic
930146743 2:48015056-48015078 CAGGGTCTCCCAGATGAAGAGGG + Intergenic
931116928 2:59175020-59175042 CTGGTGCAGCCAGCTGGAGCAGG - Intergenic
931702774 2:64922649-64922671 CAAGGTCACCCAGCTGGCAAGGG - Intergenic
931718876 2:65052683-65052705 CTCTGTCACCCAGCTGGGGCTGG - Intergenic
932406092 2:71513395-71513417 CATGGTCAGCTTGCTGGAGCGGG + Intronic
932743143 2:74307417-74307439 CAGTGTCACTCGGCTGTAGCTGG - Intronic
934499902 2:94850053-94850075 CATGGTGACCCATTTGGAGCAGG - Intergenic
935090042 2:99886305-99886327 CAAGGTTCCCCAGCAGGAGCTGG - Intronic
935375146 2:102388153-102388175 CAGGATAGCCCAGCTGGAGGGGG - Intronic
937983645 2:127628935-127628957 CAGGGTCACACAGCTCAAGGGGG + Intronic
938370157 2:130763551-130763573 CAGTGTCACACAGCTTCAGCAGG - Exonic
938729008 2:134131361-134131383 CAGGGTCACACAGCCAGAACTGG + Intronic
939829027 2:147050436-147050458 CAGGGTTACACAGCTGGACGTGG - Intergenic
941125691 2:161580643-161580665 CAATGTCACTCAGCTGCAGCTGG + Intronic
942472008 2:176269855-176269877 CAAGGTCACCCCGCAGGAGCAGG + Intronic
942543403 2:177038026-177038048 CAGTGTGGACCAGCTGGAGCAGG - Intergenic
944382204 2:199124167-199124189 CTCTGTCACCCAGCTGGAGTAGG - Intergenic
945674754 2:212842692-212842714 AAGGGTCACCCAGCTGGTTGTGG - Intergenic
945863050 2:215145713-215145735 CTGGGTCATCCAGATGAAGCAGG - Intergenic
946181820 2:217953574-217953596 CAGGGTCCCCCAGCCAGGGCAGG - Intronic
946397447 2:219450049-219450071 CAGGGTCTCCCAGGAGCAGCAGG - Intronic
946687941 2:222290753-222290775 AAGCGTCACCCTGCTGGAGGGGG + Intronic
947542940 2:230991076-230991098 CAGGGTCTCCCTGATGGATCGGG + Intergenic
947543538 2:230994759-230994781 CAGGGTCACACAGCTGGCTGGGG - Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731003 2:232431623-232431645 CAGGGTCACTCAGCAGGTGTTGG - Intergenic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
948351932 2:237347850-237347872 CAGGGTAACCCAGGTGAACCTGG - Exonic
948524772 2:238564694-238564716 CAGGGAAAGCCAGCCGGAGCAGG + Intergenic
948631725 2:239306957-239306979 CAGGGTAACCCAGAAGCAGCAGG + Intronic
1169659016 20:7957908-7957930 GAGGGTCACCCAGCTGTATGAGG + Intergenic
1171135312 20:22690005-22690027 AAGGGTCACCTGGCTAGAGCTGG + Intergenic
1171186820 20:23128849-23128871 CAGGGTCACCCAGTGGGAAAGGG - Intergenic
1172878460 20:38180989-38181011 CAGGGTCACACAACTGGAAAAGG - Intergenic
1172899517 20:38324201-38324223 CTGGGTCACCCAGCTGGAGAGGG - Intronic
1173895193 20:46545749-46545771 CAGGGTCACTCAGCAGGTCCTGG - Exonic
1173940457 20:46906711-46906733 CAAGGTCACCCAGCAAGTGCAGG + Intronic
1174198631 20:48791440-48791462 CAAGGTCACCCTGCTGGTGAGGG + Intronic
1174362029 20:50034951-50034973 CTGAGTCACTCATCTGGAGCTGG - Intergenic
1174368448 20:50070504-50070526 CAAGGTCACCCAGCAGGTGGGGG - Intergenic
1174400536 20:50273585-50273607 CAGGGACACCCAGCCGGAGATGG + Intergenic
1174619857 20:51865671-51865693 CAGGGTCCCCCAGCTGTTTCAGG + Intergenic
1174767506 20:53267929-53267951 CAAGGTCACGCAGCTGGTGAGGG + Intronic
1175368158 20:58469591-58469613 CAGGGTCACCCAGACAGAACTGG - Intronic
1175936303 20:62515675-62515697 CACGGTCACCCACATGGAGTCGG + Intergenic
1175937152 20:62519115-62519137 CTGAGTCACCCAGCAGGAGCGGG + Intergenic
1176033745 20:63026369-63026391 CAGTGTCACTGTGCTGGAGCCGG + Intergenic
1176198013 20:63846517-63846539 GGGGCTCACCCTGCTGGAGCCGG + Intergenic
1177191438 21:17856223-17856245 AAGGGTAATCAAGCTGGAGCTGG - Intergenic
1178261990 21:31108058-31108080 AAGGGGAAGCCAGCTGGAGCAGG - Intergenic
1178354698 21:31900894-31900916 CACGGTAACCCAGAAGGAGCTGG + Intronic
1178499012 21:33110460-33110482 CAGGGTCACACAGCAAGGGCTGG - Intergenic
1179617870 21:42593540-42593562 CAGTGTGGCCCAGCTGGGGCGGG - Intergenic
1180834444 22:18922828-18922850 CATGGACACCAAGCTGGAGGTGG - Exonic
1181634825 22:24169668-24169690 CAGGGGCACCCTGGTGGACCTGG - Intronic
1181673082 22:24434997-24435019 CAGGGACAGCCACCTGGTGCAGG - Intronic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1182568345 22:31216509-31216531 CAGGGCCACCAATCTGGAGGTGG + Intronic
1182711234 22:32324711-32324733 CAGGGTCACACAGCTTGTGAGGG - Intergenic
1183266513 22:36829726-36829748 AAGTGTCACACAGCTAGAGCTGG - Intergenic
1183468871 22:37995083-37995105 CAAGATCACACAGCAGGAGCTGG - Intronic
1183475938 22:38035782-38035804 CATGGTCACCCAGCTGGGAAGGG - Intronic
1183597034 22:38818948-38818970 CAAGGCCACCCAGCTGGACACGG - Exonic
1183676406 22:39301278-39301300 CAGGGTCACCCAGATGGTCAGGG - Intergenic
1183922604 22:41181440-41181462 CGGGGTCACTGAGCTGAAGCAGG - Intergenic
1184479180 22:44737102-44737124 CAGGTTCTCCGGGCTGGAGCGGG - Exonic
1184510662 22:44931358-44931380 CAGGGTCACCGAGACCGAGCCGG - Intronic
1184691055 22:46117425-46117447 CATGTTCACCCAGCTGGCACAGG - Intergenic
1184873621 22:47258355-47258377 CAGATTCCCCCAGCTGGGGCTGG + Intergenic
1185058047 22:48591539-48591561 CAGAGTCATCCTGCTGGCGCAGG + Intronic
1185158645 22:49209267-49209289 CAGGGTCTCACAGCTGGAAGTGG - Intergenic
1185269793 22:49924065-49924087 AATGGTCACCGAGCTGGAGGTGG + Intronic
1203284533 22_KI270734v1_random:148127-148149 CATGGACACCAAGCTGGAGGTGG - Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
950116762 3:10455801-10455823 CAGGGTCACACCACTGGAGCTGG - Intronic
950160601 3:10757921-10757943 CAGGGTCACACAGCTGGGTCTGG + Intergenic
950173653 3:10856542-10856564 CAGGGTCACACAGTTGGTGGAGG + Intronic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
950184654 3:10937662-10937684 CAGAGCCAGCCAGCTGGTGCGGG + Intronic
950414132 3:12858681-12858703 CAGGATCAGCCAGCTGGGGTGGG + Intronic
950481928 3:13249634-13249656 TAGGGTCACACAGCAAGAGCTGG - Intergenic
950529436 3:13544650-13544672 CAGGGGCTGGCAGCTGGAGCAGG + Intergenic
950539276 3:13600306-13600328 GAGGGCCACCCAGTTGCAGCAGG - Intronic
954132713 3:48568515-48568537 CAGGGTCAACCTGGTGCAGCAGG - Exonic
954627891 3:52032698-52032720 CACGGTCACACAGCTGTAGGTGG + Intergenic
954751126 3:52814242-52814264 CAGTGTCACGCAGAAGGAGCCGG + Exonic
955405586 3:58623720-58623742 CAGGGTCACCCAGCTAGTAAGGG - Intronic
955409847 3:58648474-58648496 CAGGGTCACACAGCTGTAAGTGG - Intronic
956217300 3:66861691-66861713 CAGGGCCACCTAGCTGGAGGTGG + Intergenic
956886438 3:73564771-73564793 CAGTGTCACACAGCTGGAAGTGG - Intronic
961356993 3:126345649-126345671 CAGGGCCACCCAGCGAGAGGCGG + Intronic
961823746 3:129588177-129588199 CAGAGTCGCACAGCAGGAGCTGG - Intronic
962267738 3:133955545-133955567 AAGGGGCACCCAGCTGGAAAAGG + Intronic
962317597 3:134368494-134368516 CAAGGTTAAACAGCTGGAGCAGG - Intronic
962386868 3:134938866-134938888 CATGGTCACACAGCTGGGTCTGG + Intronic
963828615 3:149983192-149983214 CACGGTCACTCGGCCGGAGCAGG + Intronic
964529791 3:157655175-157655197 CAGGCACACCCAGCTGGTGTGGG - Intronic
965544708 3:169903660-169903682 CAATGTCACTCAGCTGCAGCTGG - Intergenic
968660610 4:1797338-1797360 CAGGGTACCCCAGCAGGGGCTGG - Intronic
969254726 4:5994164-5994186 CAGGGTCACACAGCTGCTGCAGG - Intergenic
969258214 4:6017319-6017341 CCAGGCCACCCAGCGGGAGCTGG + Intergenic
969264229 4:6054695-6054717 CAGCGTCTCCCAGCTGGGTCTGG - Intronic
969618235 4:8265908-8265930 CAGGGTCACGCAGCTGGGCAAGG - Intergenic
969629811 4:8329568-8329590 CAAGGTCTCACAGCTGGAGGAGG - Intergenic
970758566 4:19455586-19455608 CGGGGTCCTGCAGCTGGAGCTGG - Intergenic
973199578 4:47485162-47485184 CTCGGTCAAACAGCTGGAGCTGG + Intergenic
979000357 4:115209751-115209773 CAGAGTAACCCAGATGGAGTTGG + Intergenic
981102290 4:140842589-140842611 CAAGGCCACCCAGCAGGAGATGG - Intergenic
981422964 4:144572271-144572293 CAATGTCACTCAGCTGTAGCTGG + Intergenic
981531850 4:145761474-145761496 GAAGGCCAACCAGCTGGAGCTGG - Exonic
982118805 4:152119397-152119419 CAGGGTCACACAGCAGAAACTGG + Intergenic
985581162 5:695897-695919 CACGGTAACACAGGTGGAGCTGG - Intergenic
985595786 5:787229-787251 CACGGTAACACAGGTGGAGCTGG - Intergenic
985764177 5:1768209-1768231 GAGGCCCACCCAGGTGGAGCAGG + Intergenic
985871774 5:2563013-2563035 CACGGTCACCAAGCTGGTGCTGG - Intergenic
985903438 5:2814540-2814562 CAGGGTCATGCAGCAGGGGCTGG + Intergenic
986334913 5:6747233-6747255 CAGGGACACGCGCCTGGAGCTGG - Intronic
987757393 5:22114053-22114075 CTGGGTCACCCAGTGAGAGCTGG - Intronic
988484758 5:31659410-31659432 GAGGGTCAACCAGATGGAGATGG - Intronic
990011061 5:50998671-50998693 CAGGTTCACTCAGCTGGATTAGG - Intergenic
992003550 5:72457326-72457348 CAGGGACTCACAGCTTGAGCCGG + Intronic
992481579 5:77157028-77157050 CATGATCACCCTGCTGAAGCTGG - Intergenic
992800214 5:80288999-80289021 CAATGTCACTCAGCTGCAGCTGG + Intergenic
994851078 5:105056677-105056699 CTGTGCCACCCAGCTGCAGCTGG - Intergenic
995244516 5:109921118-109921140 CAGGGACACCCAGATGGACGTGG + Intergenic
997436030 5:133876384-133876406 CAGGGTCACCCAACTGGTAAGGG - Intergenic
997615629 5:135244412-135244434 CAGGGTCACCCAGATGGTAGGGG - Intronic
998351049 5:141501594-141501616 CAGAGTCACACAGCTGGAACTGG - Intronic
998602304 5:143597504-143597526 CAAGGTCACACAGCTGGTGTGGG + Intergenic
999172282 5:149605806-149605828 CAAGGTCACACAGCTTGACCAGG + Intronic
999197129 5:149790022-149790044 CAAGGTCACCCAGCTAGAAGTGG - Intronic
999292617 5:150436508-150436530 CAGGGGCACACAGCTGGAAAGGG - Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1000816336 5:165927150-165927172 GAGGAGCAGCCAGCTGGAGCTGG - Intergenic
1001571546 5:172733530-172733552 CAGCTTCACCCAACTGGCGCCGG + Intergenic
1002169109 5:177365701-177365723 CTGGCTCACCCAGCAGGGGCTGG + Intronic
1002250023 5:177922690-177922712 CAGGGTCACATAGCTGAGGCAGG + Intergenic
1003129917 6:3386707-3386729 CAGGGTCACCCAGCGTGGGAGGG + Intronic
1004385597 6:15170126-15170148 CAAGGTCACCCAGCTGGTAACGG + Intergenic
1004925763 6:20413642-20413664 CAAGGGTACCCAGCTGGTGCTGG - Intronic
1005450410 6:25966566-25966588 CAGGCTCAGGCAGATGGAGCAGG - Exonic
1006733220 6:36252223-36252245 CAGGATCTGCCAGCTGGAACTGG - Intronic
1007752485 6:44078856-44078878 CAAGGTCACCAAGCTGGATGAGG - Intergenic
1008252280 6:49254594-49254616 CAGGGTCACACAGGCAGAGCTGG - Intergenic
1009642888 6:66361172-66361194 TAGGGTCTCCCTGATGGAGCTGG + Intergenic
1010090823 6:71979392-71979414 CAGGGTCACCCAGCAGGACAGGG + Intronic
1011192131 6:84740183-84740205 CAGGGTAGGCCAGGTGGAGCAGG - Intronic
1011242601 6:85288295-85288317 CAATGTCACTCAGCTGCAGCTGG + Intergenic
1012749593 6:103140641-103140663 GAGTGCCACCCAGCAGGAGCAGG + Intergenic
1012991558 6:105931475-105931497 CAAGGTTACCCACCTGGAGTTGG + Intergenic
1013291405 6:108721760-108721782 CAGGGTCACACAGCTTGTGGAGG - Intergenic
1013654398 6:112230407-112230429 CAAGGTCACCCAGGTAGAGCTGG - Intronic
1014934088 6:127365985-127366007 CAGGTTCCCCCAGCTTGAGTGGG + Intergenic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017162025 6:151374204-151374226 CAGGAGCACACAGCAGGAGCTGG - Intronic
1017711209 6:157169970-157169992 CAGGGTATCCCAGCTCCAGCAGG + Intronic
1018721827 6:166578730-166578752 CAGGATCACTGTGCTGGAGCAGG + Intronic
1019365569 7:630830-630852 CACCATCACCCAGGTGGAGCAGG + Intronic
1021790393 7:24198845-24198867 CGTGTACACCCAGCTGGAGCTGG - Intergenic
1021937286 7:25643791-25643813 CAAGGTCACCCAGTTGGAAAGGG - Intergenic
1022468130 7:30665090-30665112 CATGGTCAACGAGCTGCAGCAGG + Exonic
1022646093 7:32229729-32229751 CAAGGTCACACAGCTGGAGGTGG + Intronic
1023998670 7:45177299-45177321 CTGGGACACCCACCTGGAGAGGG - Exonic
1024479863 7:49852236-49852258 CAGGGTCACTCACCTGGAAAAGG - Intronic
1024558180 7:50621528-50621550 CAGGGGCACTCAGCTGCATCCGG - Intronic
1026946750 7:74321059-74321081 CAGGGTCACACAGCAGGAGCAGG - Intronic
1027238142 7:76310270-76310292 CAGGGTCACCCAGCAGGTCTGGG + Intergenic
1029062335 7:97811076-97811098 GAGGGTCACCCAGCTGTATGAGG - Intergenic
1030589856 7:111467168-111467190 CAAGGTCACCCAGTAGGTGCTGG - Intronic
1032128094 7:129209179-129209201 AAAGTTCACCCAGCTGGGGCTGG - Intronic
1032238049 7:130141424-130141446 CAGGGGCGCCCTGCTGGGGCGGG - Intergenic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1032536357 7:132667961-132667983 CAAGGTTACCCAGCTAGAGTTGG + Intronic
1032852710 7:135808871-135808893 CAGGGCCACCCAGCTAGGCCTGG + Intergenic
1033475216 7:141685816-141685838 AAGGGTCACTTGGCTGGAGCTGG + Intronic
1034118958 7:148609864-148609886 CAGTGTCCCCCACCTGGAGGGGG + Intronic
1034425340 7:151010945-151010967 CAGGGTCTCCGGGCTTGAGCTGG - Exonic
1034553622 7:151836427-151836449 CTGGTTCTCCCAGCTTGAGCAGG - Intronic
1034570381 7:151951086-151951108 CTGGGTCATGCAGCTGGAGTGGG - Intergenic
1035544618 8:470149-470171 CAGAATCACCCAGATGGAACAGG + Intronic
1037463526 8:19136819-19136841 CAAGGCCACACAGCTGGAGAAGG - Intergenic
1037806402 8:22060016-22060038 CAGGGACACACAGCTGGGGGAGG + Intronic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1039366287 8:36931664-36931686 CAGGGTCAAACTGCTGTAGCTGG - Intronic
1041037902 8:53813967-53813989 CAGGCTCACCCAGAGGCAGCTGG + Intronic
1044749499 8:95402458-95402480 CAGGGTCTCCCCGCTCCAGCAGG + Intergenic
1045086088 8:98687467-98687489 CCGGGTCACACAGCTGGAGGTGG - Intronic
1045326520 8:101121456-101121478 CAAGGTCACCCAGCTAGAAAAGG - Intergenic
1047525351 8:125628346-125628368 CAAGGTCACGCTCCTGGAGCTGG + Intergenic
1048140430 8:131789017-131789039 CAGGGTCACGCAGCTAGCGAAGG + Intergenic
1048454960 8:134569563-134569585 CAGGGTCACTCAGGGTGAGCAGG - Intronic
1049337512 8:142094290-142094312 CAAGGTCACACAGCTGCAGGTGG - Intergenic
1049388056 8:142354200-142354222 CAGGGCCGCGCAGCTGGTGCAGG - Intronic
1049441788 8:142612963-142612985 AGGGGGCACCCAGCTGGACCAGG + Exonic
1053287355 9:36858687-36858709 GAGGGTCTCCAAGCTGGAGGGGG - Intronic
1053351140 9:37414141-37414163 CAAGGTCACCACGCTTGAGCTGG - Intergenic
1053657264 9:40230477-40230499 CATGGTGACCCATTTGGAGCAGG + Intronic
1053907626 9:42859768-42859790 CATGGTGACCCATTTGGAGCAGG + Intergenic
1054369385 9:64376754-64376776 CATGGTGACCCATTTGGAGCAGG + Intronic
1054527330 9:66145749-66145771 CATGGTGACCCATTTGGAGCAGG - Intronic
1054677016 9:67866510-67866532 CATGGTGACCCATTTGGAGCAGG + Intronic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1055601623 9:77925038-77925060 GAGGGCCACCCAGCAGGAGCTGG - Intronic
1055693410 9:78857978-78858000 CTGGGACACCCCGCTGGAGAGGG + Intergenic
1055963392 9:81842253-81842275 CAAGGTCACACAGCTAGAGCTGG + Intergenic
1056529932 9:87478380-87478402 CCAGGTCCCCTAGCTGGAGCAGG - Intergenic
1057268666 9:93635015-93635037 CAAGGTCACACAGCTGGAAGAGG + Intronic
1057739541 9:97699493-97699515 CAGTGTCACTCGGCTGCAGCTGG + Intergenic
1057779690 9:98039549-98039571 AAGAGTCACACAGCTGGAGGGGG + Intergenic
1059235855 9:112760253-112760275 CAGGGTCATTGAGCAGGAGCTGG + Intronic
1059499255 9:114737222-114737244 CCAGGTCACACAGCAGGAGCTGG - Intergenic
1059748895 9:117229408-117229430 TTGGGTAGCCCAGCTGGAGCTGG - Intronic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060244130 9:121929780-121929802 TGGGGTCACACAGCTGGAGAGGG - Intronic
1060348609 9:122838119-122838141 CAGTGTCACTCAGCTGCAGCTGG + Intergenic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061325452 9:129861240-129861262 CAGGGTCACCCAGCTGGGAGAGG - Intronic
1061520286 9:131113753-131113775 GAGGGGCAGCGAGCTGGAGCAGG + Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1061898424 9:133660590-133660612 CAGGGTCACACAGCAGGGGCAGG - Intergenic
1061935610 9:133855996-133856018 AAGGTTCACCCAGCCGTAGCCGG - Intronic
1062216535 9:135392518-135392540 CAGGCTCACCCCACTGGTGCTGG - Intergenic
1062264060 9:135678784-135678806 CAGGGTGGCCCACCAGGAGCTGG - Intergenic
1062404456 9:136388480-136388502 CATGCTCACGCAGCTGGTGCAGG - Exonic
1062463379 9:136671099-136671121 CAGGGTGAACCTGCTGGAGGAGG + Intronic
1062571235 9:137186331-137186353 CAGGCTCAGTCTGCTGGAGCGGG - Exonic
1187449377 X:19383106-19383128 GAGTGTCACCAGGCTGGAGCAGG - Intronic
1190092538 X:47452096-47452118 CAGGCTCATCCAGCAGGGGCAGG + Intronic
1190733064 X:53237160-53237182 CAGGGTCATACAGCTGGAAATGG + Intronic
1190797272 X:53757479-53757501 CAGGGACACACAGCAGCAGCTGG - Intergenic
1190913070 X:54789617-54789639 CAGGGACACACAGCAGCAGCTGG - Intronic
1190917874 X:54823692-54823714 CAGGGACACACAGCAGCAGCGGG + Intergenic
1193397748 X:81005155-81005177 CAGGTTCAGAAAGCTGGAGCTGG + Intergenic
1195705438 X:107734958-107734980 CAAGGTCACACAGCTAGAGCTGG + Intronic
1196828122 X:119757118-119757140 CAAGGTCACCCAGCAGGAAGTGG - Intergenic
1197952951 X:131917626-131917648 CAGTTTCACCCAGGAGGAGCAGG + Intergenic
1200101665 X:153691612-153691634 CAGGGCCACTCCCCTGGAGCCGG - Intronic