ID: 904560682

View in Genome Browser
Species Human (GRCh38)
Location 1:31395206-31395228
Sequence AAGAAGAAGAAGAAGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904560682_904560688 22 Left 904560682 1:31395206-31395228 CCCGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 904560688 1:31395251-31395273 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
904560682_904560685 -9 Left 904560682 1:31395206-31395228 CCCGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 904560685 1:31395220-31395242 CTTCTTCTTCTTTTTTTTTTTGG No data
904560682_904560687 18 Left 904560682 1:31395206-31395228 CCCGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 904560687 1:31395247-31395269 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
904560682_904560686 -3 Left 904560682 1:31395206-31395228 CCCGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 904560686 1:31395226-31395248 CTTCTTTTTTTTTTTGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904560682 Original CRISPR AAGAAGAAGAAGAAGAAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr