ID: 904561755

View in Genome Browser
Species Human (GRCh38)
Location 1:31402918-31402940
Sequence ACTGAGGCCAAGACCGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904561755_904561757 3 Left 904561755 1:31402918-31402940 CCTTCTTCGGTCTTGGCCTCAGT No data
Right 904561757 1:31402944-31402966 TCCATCTGTTAACTGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904561755 Original CRISPR ACTGAGGCCAAGACCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr