ID: 904563622

View in Genome Browser
Species Human (GRCh38)
Location 1:31414191-31414213
Sequence CTGTAGCTGCAGCCGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904563612_904563622 19 Left 904563612 1:31414149-31414171 CCGGTCGCGGGTTCGGGACCTGT 0: 1
1: 0
2: 0
3: 3
4: 29
Right 904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 269
904563617_904563622 1 Left 904563617 1:31414167-31414189 CCTGTGGGGAGGCCAACCTCTGT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 269
904563611_904563622 20 Left 904563611 1:31414148-31414170 CCCGGTCGCGGGTTCGGGACCTG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904563622 Original CRISPR CTGTAGCTGCAGCCGCAGAG GGG Intronic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900519643 1:3099376-3099398 GTGTAGCTGAAGCCACATAGCGG - Intronic
901511633 1:9720734-9720756 CCGCAGCTGCAGCTGCTGAGGGG - Exonic
901602787 1:10435055-10435077 CTGCAGCTCCCTCCGCAGAGGGG - Intronic
902765523 1:18612218-18612240 CTATAGCTGCAGCCGCGGTGGGG + Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904635606 1:31878436-31878458 CTGTGGCTGCAGCAGCACAAAGG + Intergenic
905470874 1:38190784-38190806 CTGAAGCTGGGGCTGCAGAGAGG + Intergenic
905733123 1:40310047-40310069 CTACAGCTACAGCCACAGAGTGG - Intronic
906311045 1:44754671-44754693 CTGTTGCTGCTGCCGCATAGGGG + Intronic
906659165 1:47570486-47570508 ATGAAGCTGCAGCCACAGGGAGG - Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
912013846 1:105006066-105006088 GTGTAGCTGCAGCTGCCCAGCGG - Intergenic
913072045 1:115308184-115308206 CTGGAGCTGGGGCTGCAGAGAGG + Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916633196 1:166638657-166638679 CTGCAGCTGCTGTGGCAGAGGGG - Intergenic
918366473 1:183813146-183813168 CTGAAGCTGTGGCGGCAGAGTGG + Intronic
919805739 1:201380102-201380124 CTGCAGCTGCAGCCTCAGCAGGG - Intronic
919838667 1:201593839-201593861 CTCTAGTTGCAGCTGCAGGGAGG + Intergenic
921392780 1:214633720-214633742 CTGCAGCTCCAGCCACAAAGTGG + Intronic
922674164 1:227540915-227540937 CTGTACCTGGAGCTGCAGGGTGG + Intergenic
1062760433 10:12984-13006 CTGTACCTGGAGCTGCAGGGTGG - Intergenic
1067684388 10:48458000-48458022 CTGCAGCTGTACCCACAGAGGGG - Intronic
1068218253 10:54010666-54010688 GGGTAGCTGCAGTCACAGAGAGG - Intronic
1068856711 10:61805290-61805312 GTGTAGCTGTAGCAGCAGTGGGG - Intergenic
1069785328 10:70984163-70984185 CTGTAGGAGCGGCCGCACAGTGG + Intergenic
1070406360 10:76100903-76100925 CTGGAACTGCAGACACAGAGGGG - Intronic
1074481611 10:113826931-113826953 CTGGAGGTGCAACAGCAGAGGGG - Intergenic
1075269309 10:121035288-121035310 CTCTACCTGCAGCCCCAGTGTGG - Intergenic
1075849570 10:125575925-125575947 CTGTAGCTCCAGCCCCAGCCTGG + Intergenic
1077113329 11:871633-871655 CTGGGGCTGCAGCCTCAGGGAGG + Intronic
1080641145 11:34159104-34159126 CTGAAGCTGCAGCCCCACAACGG + Intronic
1080798755 11:35589853-35589875 CTGTAGCAGAAGCCACAGGGAGG + Intergenic
1081315268 11:41623248-41623270 CTGCACCTGCAGCCCCAGTGCGG + Intergenic
1081979919 11:47259852-47259874 CAGCAGCTGCATCCTCAGAGAGG + Exonic
1083363906 11:62129902-62129924 CGGCAGCTGCAGCCGCAGCACGG - Exonic
1083478782 11:62930316-62930338 TTGCAGCTGCAGCTGGAGAGAGG - Intergenic
1083747699 11:64744812-64744834 CGGGAGCCGCAGCCGCAGCGAGG - Intronic
1084386254 11:68844195-68844217 CTGCAACTGCAGCCGCACTGGGG + Intronic
1084638233 11:70407623-70407645 CTGGGGCTCCATCCGCAGAGGGG - Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1088501850 11:110491084-110491106 CTGTGGCTGCATCTGCAGGGAGG + Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1095800924 12:46269282-46269304 CTCCAGCTGCAGCCGCAGCTGGG - Intronic
1102386860 12:112517249-112517271 CTGGAGCTGCAGCCCCAGAAGGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1102877521 12:116459369-116459391 CTGCAGCTGGAGGCGCAGGGCGG - Intergenic
1103850734 12:123931451-123931473 CTGGAGCTGCAGCCTCAGACAGG + Exonic
1103939345 12:124493334-124493356 CTGTACCTGCAGCTGCCCAGAGG - Intronic
1104386861 12:128358096-128358118 GTGCAGCTCCAGCCCCAGAGGGG - Intronic
1106393848 13:29361233-29361255 GTGTAGCTGTAGTAGCAGAGAGG - Intronic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1109110941 13:58318484-58318506 CTCCAGCTGCAGCCCCAGTGGGG - Intergenic
1111397095 13:87677814-87677836 CTGCAGCTGCAGCTGCGGCGGGG - Exonic
1113944059 13:114033814-114033836 CTGGGGCTGCAGCCACAGGGCGG - Intronic
1116452434 14:45080847-45080869 CTCCACCTGCAGCCCCAGAGCGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1119536706 14:75408869-75408891 CTGTGGCAACAGCCACAGAGTGG + Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1122575367 14:102738532-102738554 CTGTGCCTTCAGCCCCAGAGAGG - Intergenic
1123208591 14:106737502-106737524 CTGTAGCTGCTGCCACCAAGAGG + Intergenic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1125053668 15:35331993-35332015 CTGTAGCTGCAGCCATAGATAGG + Intronic
1125727174 15:41874037-41874059 CTGGAGCTCCTGCCACAGAGTGG + Exonic
1126233410 15:46354176-46354198 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1129227030 15:74176045-74176067 CTGAGGCTGCAGTCGCAGAAGGG + Exonic
1129256094 15:74334958-74334980 CTCTAACTGCAGACACAGAGAGG - Exonic
1131123434 15:89837791-89837813 CTTTTCCTGCAGCAGCAGAGTGG + Intronic
1132335091 15:101043146-101043168 CTGGAGCTGAGGACGCAGAGTGG - Intronic
1132402573 15:101522412-101522434 CTGTAGCTACCGCCACGGAGTGG + Intronic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1132548719 16:545424-545446 CTGTGGCTGGAGACGCTGAGGGG - Intronic
1133076455 16:3284122-3284144 CAGGAGCTGCATCCGGAGAGCGG + Exonic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1138179028 16:54930193-54930215 CTGCTGCTGCCGGCGCAGAGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1144503484 17:15809335-15809357 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1144852696 17:18251991-18252013 CTGCAGCTGCAGCTGGTGAGTGG - Exonic
1145166530 17:20617047-20617069 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1146601620 17:34222030-34222052 CAGTATCTGCAGCTGTAGAGTGG - Intergenic
1148689172 17:49516929-49516951 CACTAGCTCCAGCTGCAGAGTGG + Intergenic
1148805041 17:50259706-50259728 CTGGAGCTGGGGCCACAGAGTGG - Intergenic
1149665669 17:58363390-58363412 CTGTAGCTGCAGCAGCCGCTGGG - Exonic
1150621483 17:66811262-66811284 CTGAAGCTGCATCCACAGTGTGG - Intergenic
1150652774 17:67020583-67020605 CTGTTTCTGCAGCCACCGAGTGG - Intronic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1152684037 17:81685008-81685030 CTGGAGCTGCCCCCCCAGAGGGG + Intronic
1152953341 18:13338-13360 CTGTACCTGGAGCTGCAGGGTGG - Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1157384261 18:47248157-47248179 CCGAAGCAGCAGCCACAGAGAGG + Intronic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1160486699 18:79299874-79299896 CTGTAGCTCCTGCTGCAGATGGG + Intronic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1163125692 19:15243156-15243178 CTGCAGCTGCTGCTGCACAGAGG + Exonic
1163798028 19:19348443-19348465 CTCTAGCTGCAGAGGCACAGGGG - Intronic
1164678438 19:30118524-30118546 CTGTCACTGCCTCCGCAGAGGGG + Intergenic
1165138683 19:33686490-33686512 CAGTAGCTGGCGCTGCAGAGTGG - Intronic
1165437172 19:35802302-35802324 CTGTAGATGCAGCCACAGTCTGG - Intronic
1167609861 19:50501820-50501842 CTGTGCCTGCAGCCCCAGAGGGG + Intergenic
1168401615 19:56088609-56088631 CTGAAGCCGCGGCCGCAGCGCGG + Exonic
1168475904 19:56674976-56674998 CTGTTGCTGCAGCCACAGGTTGG + Intergenic
1168685510 19:58347159-58347181 CTGCAGCTGGAGGCGCAGATGGG - Intronic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
931462260 2:62459260-62459282 CAGCAGCTGCAGCTGCAAAGAGG + Intergenic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
931708761 2:64969416-64969438 CTCCACCTGCAGCCCCAGAGTGG + Intergenic
933080256 2:77976842-77976864 CTGAAGCTGCAATGGCAGAGGGG - Intergenic
934512091 2:94953548-94953570 CTGTAGCTGCTGCCACCAAGAGG + Intergenic
937332900 2:121043235-121043257 ATGTGCCTGCAGCCCCAGAGGGG + Intergenic
940591892 2:155739476-155739498 CTGAAGCTGCACCCTCAAAGAGG - Intergenic
943436278 2:187868735-187868757 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436293 2:187868829-187868851 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
944471221 2:200055449-200055471 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
948080016 2:235198293-235198315 CTGGAGCTGCACCTGCAGGGTGG + Intergenic
948111870 2:235462830-235462852 CTACAGCTGCAGCCGCAGCCAGG + Intergenic
948449042 2:238057802-238057824 CTCCACCTGCAGCCGCAGTGGGG - Intronic
948599533 2:239100532-239100554 CTGGAGCTGGAGCCACACAGGGG - Intronic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1170969732 20:21105441-21105463 CGGGGGCTGCAGCCTCAGAGGGG - Intergenic
1171433962 20:25104800-25104822 CTGCATCTGCAGCCACATAGTGG + Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1173615895 20:44402788-44402810 CTGGAGCTGCAGCCTCATACTGG - Intronic
1174070303 20:47894960-47894982 GTGGAGCTGCAGACGCAGGGAGG + Intergenic
1174186614 20:48710785-48710807 CTGTTCCTGCAGACGCAGTGTGG - Intronic
1174929203 20:54794503-54794525 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175878769 20:62244303-62244325 CTCTAGCTGCAGCCGCAGGCTGG + Intronic
1176021477 20:62964389-62964411 CTGAAGCTGCAGCCCCAGGATGG - Intronic
1176093936 20:63331006-63331028 CTGCAGCTTCAGCCGCAGTGGGG + Intronic
1179451142 21:41469175-41469197 CTGTGGCTGAAGCCCCAGGGTGG - Intronic
1179451145 21:41469180-41469202 CTGGGGCTTCAGCCACAGAGTGG + Intronic
1179531921 21:42025555-42025577 CTGACGTGGCAGCCGCAGAGGGG + Intergenic
1179612645 21:42562619-42562641 CTATAGCTGCAGCCACTGCGGGG - Intronic
1179887167 21:44319104-44319126 CTGGAGCTGGAGCTGCTGAGAGG + Intronic
1180108907 21:45638359-45638381 CTGTAGCTGCAGTCACAAATGGG - Intergenic
1180128609 21:45809629-45809651 CTGTAGTGGCAGCGGCAGGGGGG - Intronic
1181145117 22:20840301-20840323 CTGCTGCTGCAGCAGCACAGTGG + Intronic
1181339750 22:22168413-22168435 CTGTGGCTCCAGCACCAGAGTGG + Intergenic
1181725132 22:24806229-24806251 CTGCTGCTGCAGCCGCGGCGGGG - Intronic
1183575289 22:38684335-38684357 CTGCAGCTTCAGCCACAGAATGG + Exonic
1183589664 22:38772667-38772689 CTGGGGAAGCAGCCGCAGAGGGG - Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
1184677459 22:46051513-46051535 CTGTAGCAACAGGCTCAGAGAGG + Exonic
1184970379 22:48015847-48015869 CTGAAGCTGCTGACCCAGAGAGG - Intergenic
1185337256 22:50276228-50276250 CTGTGGGTGGAGCCGCAGGGAGG + Intronic
1185337269 22:50276268-50276290 CCGTGGGTGCAGCCGCAGGGAGG + Intronic
1185337307 22:50276388-50276410 CCGTGGGTGCAGCCGCAGGGAGG + Intronic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
950529698 3:13546139-13546161 CAGCAGCTGCAGCCACAGTGGGG - Intergenic
950667432 3:14505892-14505914 GTGTAGATGCAGGCCCAGAGAGG - Intronic
951710070 3:25577913-25577935 CTGTAGCCCCTGCCGAAGAGGGG + Intronic
952195207 3:31068250-31068272 CTGTGGCTGAAGGCACAGAGTGG + Intergenic
952575997 3:34774859-34774881 CTGTAGCTTCACACGTAGAGTGG - Intergenic
957921894 3:86758011-86758033 CTCTACCTGCAGCCCCAGTGCGG + Intergenic
958838316 3:99172188-99172210 CTGTAGGTGCAATGGCAGAGAGG - Intergenic
961368634 3:126416389-126416411 CTGCAGCTGCCGCCGCAGGCTGG - Exonic
961481282 3:127182762-127182784 CTGTAGCTGCAGCTGGGGTGAGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
963325897 3:143862841-143862863 CTGAAGCTTCAACCGCAGAAGGG - Intergenic
963811133 3:149777533-149777555 CTCTAGCTGCAGCCACAGCAAGG + Intronic
965200275 3:165649265-165649287 CTCCACCTGCAGCCGCAGTGCGG - Intergenic
966361820 3:179137803-179137825 CTTCAGCTGCAGTGGCAGAGTGG - Intergenic
966875977 3:184321895-184321917 CCGTAGCTGGAGTAGCAGAGGGG - Exonic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
968049621 3:195645297-195645319 GTGGAGCTGCAGACGCGGAGAGG + Intergenic
968106183 3:196003002-196003024 TTCTAGCTGCAGACGCGGAGAGG - Intergenic
968106274 3:196003758-196003780 TTGCAGCTGCAGACGCGGAGAGG - Intergenic
968106394 3:196004700-196004722 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
968601400 4:1511659-1511681 CTGTGGCTCCCGCCCCAGAGCGG + Intergenic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
969422963 4:7107880-7107902 CAGTAGCTTCAGCCACCGAGTGG - Intergenic
972817166 4:42657101-42657123 CTCTTGCTGCAGCCGCGGAGGGG + Exonic
977971440 4:103218283-103218305 CTGCAACTGCAGTGGCAGAGGGG - Intergenic
978271274 4:106893461-106893483 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
978999507 4:115200142-115200164 CTCTACCTGCAGCCCCAGTGCGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
981118160 4:141016514-141016536 CTGTGACTGCTCCCGCAGAGCGG - Intronic
981337229 4:143581298-143581320 CTGCAGCTGCAATGGCAGAGAGG - Intronic
981483399 4:145260162-145260184 CTGGAGCTGGAGCAGCAGGGAGG + Intergenic
983491740 4:168397892-168397914 CTGCAGCTGCAGCTGCAGCTTGG - Intronic
983620660 4:169757874-169757896 CTGGCGCTGCAGCTGCAGAATGG - Exonic
985236686 4:187883119-187883141 CTGATGCTGCAGCCATAGAGAGG - Intergenic
985506256 5:282449-282471 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506353 5:283393-283415 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506357 5:283440-283462 TTGTAGCTGCAGACCCAGAGAGG + Intronic
985741632 5:1620514-1620536 TTGCAGCTGCAGACCCAGAGAGG - Intergenic
985741973 5:1623240-1623262 TTGCAGCTGCAGCTCCAGAGAGG - Intergenic
985742032 5:1623711-1623733 GTGCAGCTGCAGACCCAGAGAGG - Intergenic
985742205 5:1625004-1625026 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
986206187 5:5627455-5627477 GTGTGGCTGCAGCCACGGAGGGG + Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
987546595 5:19318208-19318230 TTGTAGCTACAGCTGCAGATAGG - Intergenic
988065560 5:26226299-26226321 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
989165382 5:38428690-38428712 CTGGAGCTGCCACTGCAGAGAGG - Intronic
990116713 5:52399708-52399730 CTTTAGCTGCAGCCCAAGAGTGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992550842 5:77858389-77858411 CTGAAGCTTCAGCCTCAGTGGGG + Intronic
994488318 5:100408245-100408267 CTCTAACTGCAGCCACAGATTGG - Intergenic
995678933 5:114695689-114695711 CTGTAGGTCCCGCCTCAGAGAGG - Intergenic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
998432892 5:142081780-142081802 TTGTATCTGCAACCACAGAGAGG - Intergenic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1002845116 6:938793-938815 TTGTATCTTCAGCCACAGAGAGG + Intergenic
1003012607 6:2439775-2439797 ATGTGGGTGCAGCTGCAGAGGGG + Intergenic
1003482478 6:6546322-6546344 CCGCAGCCGCAGCCGCGGAGGGG + Intergenic
1004317927 6:14606903-14606925 CTCTAGCTTCAGTCACAGAGCGG - Intergenic
1004739775 6:18447516-18447538 CTGTCGCTGCTGCAGAAGAGTGG + Intronic
1006834141 6:36986406-36986428 CTGTGGCGGCAGCCGCAGGCCGG + Intergenic
1010465884 6:76166343-76166365 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1010865723 6:80974883-80974905 CTGTAGCTCCAGTCTCAAAGGGG + Intergenic
1011492471 6:87906615-87906637 CTGTGCCTGCAGCCCCATAGGGG - Intergenic
1011757749 6:90521720-90521742 CAGTAGAGGGAGCCGCAGAGGGG - Intronic
1013039970 6:106423825-106423847 CTGTAGTTCCAGCCACTGAGGGG - Intergenic
1014124389 6:117759905-117759927 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1015006860 6:128293326-128293348 TTGTTGCTGCATCCTCAGAGAGG + Intronic
1018146884 6:160900073-160900095 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1018962670 6:168459525-168459547 CTGTAGCTAGAGCCCCAGGGTGG + Intronic
1019096022 6:169579784-169579806 CGGTAGCTGCACAGGCAGAGTGG - Intronic
1019186388 6:170223049-170223071 ATGTGGCTGCAGCCGCAGATGGG - Intergenic
1019286052 7:223668-223690 CTGCAGCTGCAGTCACAGGGAGG + Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1024696933 7:51867265-51867287 CTGTAGCTGCAGTGGCTTAGAGG + Intergenic
1025158338 7:56630545-56630567 CTGTACCTGAAGCTGCAGGGTGG - Intergenic
1025233323 7:57217442-57217464 CTGGAGCTGCAGACCCAGGGAGG + Intergenic
1028176952 7:87671300-87671322 CTGCAGCGGCAGTCTCAGAGAGG + Intronic
1029946246 7:104536067-104536089 CTGTAGCTGTAGCTGCACAGAGG + Intronic
1030198598 7:106878451-106878473 CTGTAACTGAAGTCTCAGAGAGG - Intronic
1030231190 7:107209841-107209863 CTGTAGCTAAAGCTACAGAGTGG + Intronic
1031923450 7:127617858-127617880 TTGTAGCTGCAAAGGCAGAGTGG + Intergenic
1033538485 7:142333916-142333938 CTGTAGCTTCACCCACAGAGAGG + Intergenic
1033858586 7:145596388-145596410 CTGTAGCTGCTGCCACATAGGGG - Intergenic
1034272145 7:149808521-149808543 CTGTAGCTGCAGCTGCAACGTGG + Intergenic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1038015301 8:23509649-23509671 CAGTGGCTGCACCCCCAGAGCGG - Intergenic
1039061771 8:33577489-33577511 CTCTGGCTGCAGCCTCAGAAGGG + Intergenic
1039069037 8:33633775-33633797 CTCCACCTGCAGCCGCAGTGCGG - Intergenic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1040549831 8:48429415-48429437 ATGCAGCTGCGGCCTCAGAGGGG + Intergenic
1042050410 8:64698316-64698338 CTTTAGCTCCAGCAGCAGGGGGG + Intronic
1042482762 8:69322755-69322777 GTGCAGCTGCAGACCCAGAGAGG + Intergenic
1042482775 8:69322855-69322877 CTGCAGCTGGAGACCCAGAGAGG + Intergenic
1042659171 8:71134802-71134824 AGGTAGCTGAAGCCACAGAGGGG + Intergenic
1044162463 8:88936151-88936173 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045713283 8:105011493-105011515 CTGTAGCTGGAGCTGCAGCCTGG - Intronic
1049188034 8:141269395-141269417 GTGAATCTGCAGCGGCAGAGGGG + Intronic
1049197961 8:141325792-141325814 CTGTGGCTGCAGCCCTCGAGGGG - Intergenic
1049592060 8:143467080-143467102 TTTTAACTGCAGCCGCAGAGGGG + Intronic
1051053730 9:12958930-12958952 CTTTAGCTGCAGAGGCAGTGTGG + Intergenic
1051235357 9:14993328-14993350 CTGGCGCTGCAGCTGCAGAATGG + Intergenic
1051936287 9:22446868-22446890 CTGGAGCTGGAGACGCTGAGAGG - Exonic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1052866638 9:33468140-33468162 CTGTACCTGGAGCCACAGAAGGG + Exonic
1054750512 9:68900315-68900337 CAGGTGCTGCAGCTGCAGAGAGG - Intronic
1057256271 9:93550122-93550144 ATGGACCTGCAGCTGCAGAGTGG + Intronic
1058684117 9:107465798-107465820 CTCTAGCTCCGGGCGCAGAGGGG + Intergenic
1059405643 9:114097202-114097224 CTGAAGCTGCAGCTGCAGTCTGG + Intronic
1060974334 9:127755434-127755456 CTGGAGCTGCGGGCGCGGAGCGG + Intronic
1186019320 X:5236199-5236221 CTGAAGTTCCAGCGGCAGAGAGG + Intergenic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1190106811 X:47566969-47566991 CGGCAGCTGCAGTTGCAGAGAGG - Exonic
1190216519 X:48482580-48482602 CTCTAGCTGCAGGGACAGAGGGG - Exonic
1192177066 X:68892808-68892830 CTGTAACTGCAGCGGGAGTGGGG + Intergenic
1192691803 X:73372853-73372875 CTGTAGCTGCAATGGCAGATGGG + Intergenic
1192756264 X:74049558-74049580 CTGTAGCTGCAATGGTAGAGGGG - Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1196245191 X:113391740-113391762 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1197055487 X:122113767-122113789 CTGCAGCTGCAGCTGCTGTGGGG + Intergenic
1198966859 X:142236865-142236887 CTGGAGCTGAAGCAGCTGAGAGG - Intergenic
1199689362 X:150296605-150296627 CTGTGGCTGCCACCACAGAGAGG - Intergenic
1200078273 X:153562672-153562694 CTGCAGCTGAAGCCGCACACTGG + Intronic
1201604683 Y:15771865-15771887 CTTTAGCTGCAGCCTGAGACTGG + Intergenic
1201895240 Y:18985834-18985856 CCTGAGCTGCAGCCTCAGAGTGG - Intergenic
1202090233 Y:21181027-21181049 TTGTTGCTGCAGCTGCAGTGTGG - Intergenic