ID: 904563925

View in Genome Browser
Species Human (GRCh38)
Location 1:31415918-31415940
Sequence CTTTGGATGGGGAGGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904563925 Original CRISPR CTTTGGATGGGGAGGTAAGA TGG Intronic
901090865 1:6640211-6640233 CTTTGGAACGGGAGGCCAGAAGG - Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
901848091 1:11997408-11997430 GTTTTGATGGACAGGTAAGAGGG + Exonic
903816905 1:26070670-26070692 CTTTGAATGGGGCTGTGAGAGGG + Intergenic
903835347 1:26200062-26200084 CGTGGGATGGGGAGGGCAGAAGG + Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904680292 1:32224285-32224307 TTCTGGATAAGGAGGTAAGAGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
906567748 1:46812875-46812897 CTTTGGCCTGGGAGGAAAGAGGG - Intronic
907950755 1:59181349-59181371 TGTTGCTTGGGGAGGTAAGAGGG - Intergenic
908092259 1:60698665-60698687 CTTTTATTGGGGAGGTTAGAAGG + Intergenic
908308535 1:62851358-62851380 CTTTGGAGTGGGAAGTAAAATGG - Intronic
908448026 1:64220524-64220546 CTCTGGAAGGAGGGGTAAGAGGG - Intronic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912729541 1:112090108-112090130 CTTGTGATGGGGAGGAAAGGGGG - Intergenic
913211483 1:116586275-116586297 TTTTGGATGGGGAGGGAGAAAGG - Intronic
913660683 1:121003882-121003904 CTTTGGATGTGAAGGAAACATGG + Intergenic
914012047 1:143787038-143787060 CTTTGGATGTGAAGGAAACATGG + Intergenic
914165785 1:145174096-145174118 CTTTGGATGTGAAGGAAACATGG - Intergenic
914650677 1:149695698-149695720 CTTTGGATGTGAAGGAAACATGG + Intergenic
914992348 1:152509935-152509957 CTTTGGATGGAGAGGTGAAGAGG - Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
917288179 1:173443051-173443073 CTTGAGATGGGCAGGAAAGAAGG + Intergenic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920793263 1:209113092-209113114 TTTTGTAGGGGGAAGTAAGAAGG - Intergenic
921759826 1:218900017-218900039 CTTTGGAGGTAAAGGTAAGAGGG + Intergenic
922812828 1:228427206-228427228 CTTGGGAGGCTGAGGTAAGAGGG - Intergenic
1063285159 10:4678995-4679017 CTTAGTAGGGGGAGGTAGGAGGG - Intergenic
1063908572 10:10806054-10806076 CTTTAGATGGTGAAGTGAGAAGG + Intergenic
1064473226 10:15658649-15658671 CTTTGGATGGGGTGATCAGGAGG - Intronic
1065025458 10:21535324-21535346 CTTTAGATGGGGAGGGATGCGGG + Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067052901 10:43034435-43034457 ATTTGGATTGGGATGTAAAATGG + Intergenic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1072743215 10:97922663-97922685 AACTGGATGGGGAGGAAAGACGG - Intronic
1073015445 10:100395465-100395487 CTTTGGAAGGGGAGGAGAAAGGG - Intergenic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076707512 10:132309701-132309723 GTTTGGAAGGGGAGGTACCAAGG + Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1079155842 11:17947317-17947339 TTTTGGATGTGCAGGTAAGGGGG + Intronic
1079741278 11:24064554-24064576 ATTTGATTGGAGAGGTAAGACGG - Intergenic
1080633948 11:34106821-34106843 GTTTGGATTGGAAGGTTAGAAGG + Intronic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1087304605 11:96473418-96473440 CTGAGGATGGGGATGTCAGATGG - Intronic
1088463782 11:110111783-110111805 CTTGGGATGCTGAGGTGAGAGGG - Intronic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1089733726 11:120535364-120535386 GTGTGAAGGGGGAGGTAAGAGGG + Intronic
1089883279 11:121795187-121795209 CTTTGAGTGGGGATATAAGAAGG + Intergenic
1090107499 11:123868479-123868501 CTTTGGATTGGGAAGAAAGGTGG + Intergenic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1091886625 12:4021363-4021385 CTTTGGATTGGGAGGAAGGGCGG - Intergenic
1092045660 12:5430593-5430615 GGTTGGATGGGGAGGTGGGAAGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1096094015 12:48922758-48922780 CTGGGAATGGGGAGGTAATAGGG + Intronic
1096750572 12:53756302-53756324 CTTACTTTGGGGAGGTAAGAGGG - Intergenic
1098709988 12:73744850-73744872 AGTAGGAAGGGGAGGTAAGAAGG - Intergenic
1099762688 12:86941629-86941651 CTTTGGATTGGGAGGAAGGGCGG - Intergenic
1100110945 12:91242259-91242281 CTTTAGATGGGGTGGCAAGATGG + Intergenic
1101156217 12:101930051-101930073 TTCTGGATGGTGCGGTAAGAGGG + Intronic
1101172271 12:102110391-102110413 CTTGGGAGGCGGAGGTGAGAGGG + Intronic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1104054447 12:125218722-125218744 CTTGGGATGGGTAGGAGAGAGGG + Intronic
1104630858 12:130400962-130400984 CTTTTGGTGGGAAGGTGAGATGG + Intronic
1104850636 12:131871906-131871928 CAGGGGATGGGGAGGAAAGAAGG + Intergenic
1105496752 13:20937013-20937035 TGTTGGCTGGGGAGGTGAGAAGG + Intergenic
1106375632 13:29184294-29184316 CTTTGGAAGGTGAGGAAATAAGG - Intronic
1107466090 13:40652014-40652036 CTCTGGATGGGTAGGTATGTAGG - Intronic
1112374922 13:98830342-98830364 CCAGGGATGGTGAGGTAAGAAGG - Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113255967 13:108505256-108505278 CTTTTAGTGGGGAGGTAAAATGG - Intergenic
1113353059 13:109548511-109548533 CGTTGGTTGGGGAGGTCTGATGG - Intergenic
1113916103 13:113874988-113875010 CCTGGGAAGGGGAGGTAAGTGGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115444370 14:33472291-33472313 ATTAGGTTGGAGAGGTAAGAGGG + Intronic
1115765181 14:36615859-36615881 CTTTGGGTGGGGATATAAAATGG + Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1117865424 14:60143446-60143468 CTTAGGATGGGGAGGAAACGGGG - Exonic
1119884773 14:78131048-78131070 CTTTGGAATGGGAGGTCAGGAGG - Intergenic
1123171202 14:106374218-106374240 CTTTGTATGGATAGGTAAAAAGG + Intergenic
1124835127 15:33189196-33189218 GGTTGGATGGGTAGGAAAGAGGG + Intronic
1126201398 15:45991099-45991121 CCTTGGAGTGGGAGGTAAGGGGG - Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127595311 15:60476262-60476284 CTGGGGATGGGGGGGTAAGAAGG - Intronic
1128394605 15:67211332-67211354 CTTTGGATGAGGAGATAAGGGGG - Intronic
1130894944 15:88162735-88162757 CTTTGGATGGGGAGGCAGATGGG + Intronic
1131239847 15:90729764-90729786 CTTTGGATGGGTATGGGAGATGG + Intronic
1131443428 15:92476020-92476042 CTTTGGATGTGGGGGTATGAGGG - Intronic
1131684803 15:94757299-94757321 CTTTGGATTGGGAAGAAGGACGG - Intergenic
1131792822 15:95983519-95983541 CTTTGGATGTGGAGGCAAATGGG + Intergenic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1134509996 16:14838483-14838505 CTTTGTATGATAAGGTAAGAGGG + Exonic
1134697646 16:16236977-16236999 CTTTGTATGATAAGGTAAGAGGG + Exonic
1134974198 16:18557693-18557715 CTTTGTATGATAAGGTAAGAGGG - Exonic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138693931 16:58793594-58793616 CAGTTGATGGGGAAGTAAGATGG - Intergenic
1139837879 16:69854299-69854321 ATGTGGATGGCGAGGAAAGAGGG + Intronic
1140250333 16:73289378-73289400 CTTTTGGTGGGGATGTAAGAGGG + Intergenic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141134125 16:81454856-81454878 ATCTGGATGGAGAGGTAGGATGG + Intronic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1142377385 16:89712869-89712891 TTTTGGAAGGGCAGGCAAGAAGG - Intronic
1143406984 17:6684205-6684227 GTTTGGTTGGGGAGGGAAGTAGG - Intergenic
1144180338 17:12745715-12745737 CTTTGTTTAGGGAGATAAGAGGG - Intronic
1145779840 17:27555212-27555234 CTTAGGATTGGGGGGTATGAGGG + Intronic
1147547595 17:41414665-41414687 ACTTGGATGGGCAGGAAAGATGG + Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1149084741 17:52701918-52701940 GTATGGCTGGGGAGGTAGGAAGG - Intergenic
1149210277 17:54292944-54292966 CCATAGATGGGGAGGTAAAAGGG - Intergenic
1151504525 17:74518336-74518358 CTATTGGTGGGGAGGTAAAATGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152003756 17:77664098-77664120 CTTTGGATGAGGAGTCAAGATGG + Intergenic
1152209590 17:78996017-78996039 CCTTGGATAGGGAGGAAAGCGGG - Intronic
1153804231 18:8698092-8698114 CTGTGGATGGGAATGTAAAATGG - Intergenic
1153917757 18:9760764-9760786 CGTGGAATGGGGAGGTGAGATGG + Intronic
1154123054 18:11667017-11667039 CTTTGGGTGGGGACGCATGAGGG - Intergenic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1155644787 18:28064371-28064393 CTTGGGAGGGTGAGGCAAGAGGG - Intronic
1156027274 18:32669660-32669682 CTTAGGATGGGGAGGCCAGGTGG + Intergenic
1157014986 18:43701073-43701095 CATTTGATGGGAAGTTAAGATGG - Intergenic
1157270301 18:46269999-46270021 CTCTGGAAGGGGAGGTATGGAGG + Intergenic
1157681516 18:49611158-49611180 CTGTTGATGGGGATGTAAAATGG + Intergenic
1157716901 18:49894182-49894204 CAGTGGATGGGGATCTAAGAGGG - Intronic
1158170040 18:54587307-54587329 CTTGGGATGCGGAGGTGGGAGGG + Intergenic
1158638157 18:59179363-59179385 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1162326272 19:10001746-10001768 GGTTGGATGGGGATGGAAGAGGG - Exonic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
926344723 2:11934844-11934866 CTCTGAATTGGGAGGAAAGATGG + Intergenic
926452209 2:13018930-13018952 CTCTAGATCGGGAGGTCAGAAGG + Intergenic
926534558 2:14094519-14094541 CTTTGAATGGGAATGTGAGAAGG - Intergenic
927561102 2:24074590-24074612 CCTGGGATGGGCAGGGAAGAGGG - Intronic
928096975 2:28410695-28410717 CTCTGGCTGGGGATGAAAGAAGG + Intronic
929610105 2:43264696-43264718 CTCTGGATTGGGAGAAAAGAAGG + Intronic
930430374 2:51267841-51267863 CTCTGGAAGGGGAGGTAACTGGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931979252 2:67677010-67677032 CATTGGGTGGTGAGGAAAGAGGG - Intergenic
932367544 2:71162568-71162590 CTTTGGATTGGGAAGAAAGGTGG + Intergenic
932750979 2:74371536-74371558 CCTTGGATGGGGAAGGAAGCGGG + Exonic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933990986 2:87633621-87633643 CATTGCAGGAGGAGGTAAGAAGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
934992623 2:98932348-98932370 ATTTGGAAGGGGAGGTAATCAGG - Intronic
935918345 2:107983650-107983672 CTTTGAATGGCAAGGTCAGAGGG + Intergenic
936302853 2:111317202-111317224 CATTGCAGGAGGAGGTAAGAAGG + Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937444234 2:121943335-121943357 ATTTGTAGGGTGAGGTAAGAGGG + Intergenic
937991289 2:127663838-127663860 CTCTGGATGGGGAGGTTGGGAGG - Intronic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
939995034 2:148911980-148912002 GTTGGGATGGGGAGGAAAGAGGG - Intronic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
940850725 2:158685879-158685901 CTTTGGATCGTTAGGTAAAAGGG - Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
941986968 2:171519837-171519859 CACTGGATGGGGAGGTCAGTGGG + Intergenic
942181865 2:173387894-173387916 CTTTGGACAGAGAGGTAAGGAGG + Intergenic
943387090 2:187215331-187215353 CATTGGATGGAGTGGAAAGAAGG + Intergenic
945168208 2:206968405-206968427 CTTTGGATGGTGAGATAGGCGGG + Intronic
946588639 2:221218895-221218917 CTTTTGATGGGGGGATAAGTGGG - Intergenic
946878561 2:224155205-224155227 CTTTGTCTGGGCAGGGAAGATGG - Intergenic
948544521 2:238717343-238717365 CTCTGGATGGGAAGGACAGACGG + Intergenic
1169087580 20:2836894-2836916 CTTTGGATTGGCAGGAAAGAGGG - Intronic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1173450570 20:43159984-43160006 TTTTGCAGGGGGAAGTAAGAAGG - Intronic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176892779 21:14338638-14338660 ACAGGGATGGGGAGGTAAGAAGG + Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178111788 21:29376452-29376474 CTTTGAGTGGGGAAGAAAGATGG + Intronic
1178589726 21:33899094-33899116 CTCTGGCTGGGGTGGCAAGAGGG + Exonic
1178770631 21:35500614-35500636 TTTTAGATGGGGAGGTGAAAGGG - Intronic
1179350684 21:40607922-40607944 CTTTGGATGGAGAAGGAAGTTGG + Intronic
1180971242 22:19816918-19816940 CCTTGGATGGGGTGGGAAGGGGG - Intronic
1181533171 22:23528678-23528700 TTTTGGGGGGGCAGGTAAGAGGG - Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
949195871 3:1306781-1306803 CTTTGACTGAGGAGGTAAAAAGG + Intronic
950040059 3:9914608-9914630 TTGGGGAGGGGGAGGTAAGAGGG + Intronic
950154328 3:10710261-10710283 CTCTGTATGGGGAGGTAATAGGG + Intergenic
950286371 3:11748484-11748506 CTTGGGAGGGTGAGGTAGGAGGG - Intergenic
951055059 3:18137997-18138019 CTTTGGAGGGTGAGGTCACATGG + Intronic
951428330 3:22575977-22575999 CTTAATATGGTGAGGTAAGAAGG - Intergenic
951736029 3:25865511-25865533 CTTTGGATGGGGAAGAAATGGGG + Intronic
952528133 3:34234535-34234557 ATTTGGAGGGTGAGGCAAGAGGG - Intergenic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954298406 3:49686605-49686627 GCTTGGCCGGGGAGGTAAGAGGG - Intronic
955401817 3:58597362-58597384 CTTTGGATTGGCAGGGAGGAGGG + Intronic
955748762 3:62166794-62166816 CTTGGGAGGGTGAGGTGAGAGGG - Intronic
956739288 3:72262544-72262566 CTCTGGAGGGGGAGGTATAAAGG + Intergenic
957295337 3:78326634-78326656 CTTTGGATTGGGAAGAAAGGTGG - Intergenic
959185544 3:103042457-103042479 GTTAGGATGGACAGGTAAGAGGG - Intergenic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
962406787 3:135107314-135107336 CTCTGGATAGGGATGTGAGAAGG + Intronic
962633292 3:137301762-137301784 CTCTGGATGTGGAAGTTAGAGGG + Intergenic
965258107 3:166443150-166443172 CTCTGGAAGGGGAGGTAAATAGG - Intergenic
965736642 3:171827578-171827600 CCTTGGCTGGGTGGGTAAGAAGG + Intergenic
966303239 3:178501812-178501834 CTTTGGATTGGGAAATAAAATGG + Intronic
966860219 3:184227599-184227621 CCTTGGGTGGGGCAGTAAGAAGG - Intronic
967359980 3:188619344-188619366 CTTTGGATGGGGTGGGTAGCAGG - Intronic
967757755 3:193189250-193189272 CATTGGATGGGGAGGTAAGGAGG + Intergenic
968969944 4:3788490-3788512 CGTGGGATGTGGTGGTAAGAGGG + Intergenic
969239408 4:5888922-5888944 CTATGGAAGGAGAGGCAAGAGGG - Intronic
969320327 4:6408522-6408544 GTTTCAATGGGGAGGTAGGATGG + Intronic
969365547 4:6692257-6692279 CTCTGGCTGGGGTGGTATGATGG + Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970238275 4:13981113-13981135 CTGCGGATGGGGAGATAACAAGG + Intergenic
970359244 4:15291786-15291808 CTTTAGAAGGGGAGGTGAAATGG - Intergenic
971344328 4:25798094-25798116 GTTTGGTTGGGGAGGTAGCAAGG + Intronic
972180523 4:36459144-36459166 GTTTGGAGGGGGAGCTAAAAAGG - Intergenic
974882958 4:67781843-67781865 CTTTGGATGCACTGGTAAGAAGG + Intergenic
978315413 4:107430441-107430463 CTTTGAATGAGCAGTTAAGAGGG + Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
982815292 4:159877058-159877080 CTTTGGATGGGGTTTTATGAGGG + Intergenic
983503312 4:168525287-168525309 CTTTGAACAGGGAGCTAAGAGGG + Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984752430 4:183290752-183290774 CTTTGGATGGGAATGTAAAATGG + Intronic
985788303 5:1911394-1911416 CTATGGATGGGGAGGCAGGGTGG - Intergenic
986012381 5:3727346-3727368 CTTTGGATTGGGCGGTGAGTGGG + Intergenic
986619238 5:9653616-9653638 CTATGGATGGGAATGTAAAATGG - Intronic
986963892 5:13246969-13246991 TTTTTGAGGGGGAGGAAAGATGG + Intergenic
987139375 5:14929715-14929737 CTTTGGATTGGTGGGAAAGAGGG + Intergenic
987686305 5:21208097-21208119 ATGAGCATGGGGAGGTAAGAGGG - Intergenic
989213042 5:38876555-38876577 CTTTGGTTTGGTAGGTAGGATGG + Intronic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
990555791 5:56934528-56934550 ATTTGGGTGGTGAGGTGAGAAGG + Intronic
992675511 5:79102086-79102108 CTTTGGAGGGGAGTGTAAGATGG - Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
994077581 5:95670612-95670634 CTTTGTGTGGGGAAGTAAAAGGG - Intronic
998548387 5:143051963-143051985 CTTAGGATGGGGAGGGAAAGAGG + Intronic
999791154 5:154940589-154940611 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1001899845 5:175417640-175417662 CTTAGGTCGGGGAGCTAAGATGG - Intergenic
1001996536 5:176164921-176164943 CTTTGGAGGTGGAGGCATGAGGG - Intergenic
1002403744 5:179012189-179012211 CTTTTAATGGGGAGGTAACATGG + Intergenic
1002436445 5:179234673-179234695 CCTTGGATGTGGAGATGAGATGG - Intronic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003035565 6:2638056-2638078 CTTGGGATGGGGAGGTGATTTGG - Intergenic
1003345870 6:5266088-5266110 GTTTGAATGTGGTGGTAAGATGG + Intronic
1003874743 6:10425748-10425770 TTTGGGATGGGGAAGTAGGATGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1005018483 6:21395689-21395711 CTTTGAATGGAGATGAAAGATGG + Intergenic
1005145494 6:22685252-22685274 CTCTGTATGAGGAGATAAGATGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1007609021 6:43136894-43136916 CTTTGGAGGCTGAGGTGAGAGGG + Intronic
1008976064 6:57428622-57428644 CTTTTGATGGGGAGTTATGAAGG + Intronic
1009164592 6:60325764-60325786 CTTTTGATGGGGAGTTATGAAGG + Intergenic
1010533290 6:76992505-76992527 AGGTGGATGGGGAGGCAAGAAGG - Intergenic
1011179049 6:84598651-84598673 ATTTGGAAGGGGAGAGAAGATGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013544870 6:111146334-111146356 CTGTGGATGGGAATGTAAAATGG + Intronic
1014325396 6:119986819-119986841 AGGTGGATGGGGAGGTCAGAAGG - Intergenic
1014579646 6:123121284-123121306 CTTTGGAGTGTGAGGTAAGTAGG + Intergenic
1015269753 6:131326221-131326243 CTTTGGATTGGGAAGAAAGGCGG - Intergenic
1015805273 6:137102210-137102232 CATTAGATGGGGAGGGAAGGAGG - Intergenic
1018016280 6:159715155-159715177 GTTTGGATGGGAAGCAAAGATGG + Intronic
1018026885 6:159813822-159813844 CTTTGGAAACGGAGGCAAGAGGG - Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1022578834 7:31527154-31527176 CTTTGCATGGGGTGGGGAGAAGG - Intronic
1023385981 7:39658279-39658301 CTTTGTAGGGGGAGGTGAGAGGG - Intronic
1024085321 7:45887841-45887863 CTCTGGAGGGGCAGTTAAGAAGG - Intergenic
1024150643 7:46568429-46568451 GTTTGTATGGGGAGGTAGGTGGG + Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1028532079 7:91849298-91849320 CTTTGGATGGAGAGTTGAGGTGG - Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028935930 7:96464063-96464085 TTTTGGATGCGGAGGTGAAAGGG - Intergenic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029084971 7:98004188-98004210 CTTTAGAGGGTGAGGTGAGAAGG - Intergenic
1030153651 7:106430197-106430219 CTTTGTATTGGGAGATAACATGG + Intergenic
1030903224 7:115149981-115150003 CTATGGAAGCTGAGGTAAGAGGG - Intergenic
1031115521 7:117663725-117663747 TTTAGTATGAGGAGGTAAGATGG - Intronic
1032242402 7:130173883-130173905 CTTCGGATGTGGAGGTAATCTGG + Exonic
1033970616 7:147034684-147034706 AGGTGGATGGGGAGGTCAGAAGG + Intronic
1034033397 7:147792799-147792821 CTGTTGATGGGGATGTAAAATGG - Intronic
1034569180 7:151941455-151941477 CATGGGGTGGGGAGGTAGGAGGG - Intergenic
1036108439 8:5870586-5870608 CTTTGAATGGAGAGGAGAGATGG + Intergenic
1037506772 8:19538558-19538580 ATTTGCATGGGGAAGTGAGAAGG + Intronic
1037856570 8:22375432-22375454 ATTTTGATGTCGAGGTAAGATGG - Intronic
1037945854 8:22988922-22988944 CCTTACATGGTGAGGTAAGAGGG - Intronic
1038526044 8:28274266-28274288 CTTTCTATGGGGAGGCAAGTAGG - Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038709026 8:29923464-29923486 GTTGGGATGGGGAGTGAAGAGGG - Intergenic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041700192 8:60780134-60780156 GTTTGGATGGTGAGCTATGAGGG + Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042590913 8:70397968-70397990 TTTTGGTTGGGGAGGTGGGAGGG - Intronic
1043369656 8:79575812-79575834 TTTTGGTTGGGGACGTAAGGTGG - Intergenic
1044085357 8:87936500-87936522 GTTTGGCTGGGGCGGTTAGAGGG - Intergenic
1045844579 8:106618353-106618375 GTTTGGCTGGGGAGGTTAGGAGG + Intronic
1049622485 8:143604914-143604936 CTTAGGATTGGGAGGAAAGAGGG + Exonic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1055300669 9:74878425-74878447 CTGGGGATGGGGACATAAGATGG - Intronic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1055773948 9:79747807-79747829 CTAGGGATGGGGAGGAAGGAGGG - Intergenic
1056839158 9:89984237-89984259 TTTTGGATGGAGTGGTATGAAGG - Intergenic
1057484903 9:95475343-95475365 CTCTGCATGGGAAGGTGAGAGGG + Intronic
1057556540 9:96092777-96092799 CACTGGATGGTGAGTTAAGAAGG - Intergenic
1059098956 9:111450818-111450840 CTTGGGAGGGTGAGGTAGGAGGG + Intronic
1059365069 9:113780662-113780684 CATTGGATGGGAAGAAAAGAAGG - Intergenic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1060068816 9:120528935-120528957 CTTTGGGTGGGGTGGAGAGAGGG - Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060924467 9:127446431-127446453 CTTAGGATGCTGAGGTAGGAGGG - Intergenic
1061667206 9:132167532-132167554 CTTTGCATGGGGAGGTTTGACGG + Intronic
1062104950 9:134750314-134750336 CTTTGGAGGGAGGGATAAGAAGG - Intronic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1188811220 X:34656609-34656631 CCAGGGATGGGGAGGGAAGAGGG + Intronic
1189002162 X:36958312-36958334 CCAGGGATGGGGAGGGAAGAGGG - Intergenic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1195314031 X:103660335-103660357 CAATGGATGGAGAGGTGAGATGG - Intergenic
1195724420 X:107899459-107899481 CTTTGGGCTGGGAGGTAATAGGG + Intronic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1198472492 X:136960561-136960583 GTTTGGTTGGGGAGGTGGGATGG + Intergenic
1198558867 X:137826474-137826496 ATTTGGCTGGAGAGGGAAGAAGG - Intergenic
1198752010 X:139945594-139945616 ATTGGGATGGGGAGGTGAGTGGG - Intergenic
1199708598 X:150451940-150451962 CTCTGGATGGGGACTTGAGAGGG - Intronic
1200297654 X:154939026-154939048 CTTTGCATTGGGAGCCAAGATGG + Intronic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1201624112 Y:15995058-15995080 TTTTGGTAGGGGAGGTAACAGGG - Intergenic