ID: 904564857

View in Genome Browser
Species Human (GRCh38)
Location 1:31422737-31422759
Sequence TGTGGGGCCTGTTTCTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904564856_904564857 -8 Left 904564856 1:31422722-31422744 CCAGAGGTATCTGGATGTGGGGC 0: 1
1: 0
2: 5
3: 12
4: 112
Right 904564857 1:31422737-31422759 TGTGGGGCCTGTTTCTTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904564857 Original CRISPR TGTGGGGCCTGTTTCTTTAA AGG Intronic
901599434 1:10411369-10411391 TGTGTCGCCTGTTTCTCTGAAGG + Intronic
904394603 1:30210588-30210610 TGTAGTCCCAGTTTCTTTAAAGG - Intergenic
904564857 1:31422737-31422759 TGTGGGGCCTGTTTCTTTAAAGG + Intronic
904679058 1:32216096-32216118 TGTGGGGGCTATTTCCTTATGGG + Exonic
905571047 1:39005996-39006018 TGTTGGGCTTTTTTTTTTAAAGG - Exonic
905706979 1:40067831-40067853 GGTGTGTCCTGTTCCTTTAAGGG + Intronic
910104755 1:83619523-83619545 TGTGGGGATTTTTTTTTTAATGG - Intergenic
910830548 1:91456862-91456884 TGTTGGGAAAGTTTCTTTAAAGG + Intergenic
915554679 1:156654771-156654793 TGTGGGGCCTGGTGCTTAATGGG + Intronic
918799477 1:188953825-188953847 GGTGTGGCCTGTTTCCTTACTGG + Intergenic
921362339 1:214341540-214341562 TGTGTGGCCCGTCCCTTTAATGG + Intergenic
921557543 1:216616628-216616650 TCTGGCTCCTGTTTCTGTAAAGG + Intronic
924609902 1:245564947-245564969 TGTGTGGCCTGCTTCTTAACAGG + Intronic
1063834999 10:10002411-10002433 TGTGCGGCCTGGTTCCTAAAGGG - Intergenic
1064303853 10:14147752-14147774 TGTGTGGCCTGTTTCCTAACAGG + Intronic
1065422266 10:25558454-25558476 GGAGGGGCAGGTTTCTTTAAAGG + Intronic
1065505759 10:26428693-26428715 TGTGTGGCCTGGTTCTTAAGAGG - Intergenic
1067726292 10:48773802-48773824 GGTGGGGCCTGTATCTGTCAAGG + Intronic
1069620446 10:69834265-69834287 TGTGAGGCCTGGTTCTTAACAGG + Intronic
1070666539 10:78349087-78349109 TGTGGAGCCTATTTCTCCAACGG - Intergenic
1071129340 10:82373339-82373361 CCTGGGGTCTGTTTGTTTAATGG - Intronic
1072174260 10:92901242-92901264 TGTGGGTCCTGTTTCCTAACAGG + Intronic
1073224189 10:101902786-101902808 TTTGGGGCCTGATTCTTTGACGG + Intronic
1074782688 10:116813217-116813239 TGGATGGCCTCTTTCTTTAACGG - Intergenic
1074968626 10:118516675-118516697 TGTGTGGCCTGGCTCTTTACGGG + Intergenic
1074994737 10:118746935-118746957 TGTGTGGCCTGGTTCCTTACAGG - Intronic
1075395926 10:122126992-122127014 TGTGGGGCCTCTTTTTATAAGGG - Intronic
1075477498 10:122748813-122748835 TGTAGGACCAGTTTCTTTTATGG + Intergenic
1079569941 11:21930391-21930413 TGTGTGGCCTGGTTCTTGACAGG - Intergenic
1081814426 11:45930547-45930569 TGTGGGTCCTTTTTCTTTCATGG - Intronic
1081828178 11:46079515-46079537 TGTGGGGCCAGCTTCTTTCCAGG - Intronic
1082206442 11:49440915-49440937 TGTGTGGCCTGGTTCTTAACAGG + Intergenic
1083864539 11:65446379-65446401 TATGGGGCCTGACTCGTTAAAGG - Intergenic
1084592052 11:70096374-70096396 TGGGGGGCCTGGTTCCTAAAAGG - Intronic
1086648827 11:89260858-89260880 TGTGTGGCCTGGTTCTTAACAGG - Intronic
1086728170 11:90216017-90216039 TGTAGGTTCTTTTTCTTTAAAGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1093301776 12:17467640-17467662 TCTGTGGCCTCTTTTTTTAAGGG - Intergenic
1099811419 12:87587281-87587303 TGTGAGGCCTGTAGCTCTAAAGG - Intergenic
1101439464 12:104692633-104692655 TGTGGGGCCTGGTTCCTAAAAGG - Intronic
1101695662 12:107123585-107123607 TGTGTGGCTTGTTTCTTAAAAGG - Intergenic
1102740956 12:115207217-115207239 CCCGGGGTCTGTTTCTTTAATGG - Intergenic
1103989391 12:124788294-124788316 TTTGGGTCCTGTTTCTAAAAGGG - Intronic
1105298630 13:19113646-19113668 TTTGAGGCCTTTTTCTTTCATGG - Intergenic
1107389034 13:39944123-39944145 TGTGGGACCTGTCTCTTTCGAGG + Intergenic
1107788908 13:43981266-43981288 TGTGAGGCCTGTTTCCTAATAGG + Intergenic
1108583458 13:51847225-51847247 TGTGGGGCCCGGTTCCTAAAAGG - Intergenic
1109679501 13:65731415-65731437 TGTTCTGCCTGTTTCTTTTAGGG - Intergenic
1110059820 13:71027285-71027307 TCTGGGGCCTGTGTCTTCCAAGG + Intergenic
1110588075 13:77218800-77218822 TGTGTGGACTATTTCTATAATGG - Intronic
1110739437 13:78977273-78977295 AGTGGTGCCTTTTTTTTTAAGGG + Intergenic
1112976331 13:105323067-105323089 TCTGGGGCCTCTTTTTATAAGGG + Intergenic
1114052180 14:18929832-18929854 TTTGGGGCGTTTTTCTTTCATGG + Intergenic
1114110379 14:19472092-19472114 TTTGGGGCGTTTTTCTTTCATGG - Intergenic
1114830039 14:26129364-26129386 AGTGGGTCCGGTTCCTTTAATGG - Intergenic
1117307903 14:54494432-54494454 TCTGGGCCCTGTTCCTTAAAAGG - Intergenic
1118893805 14:69929808-69929830 TGTGGGGCTTGTTTCTTGGTCGG + Intronic
1122312847 14:100808103-100808125 TGTGGGGCCTCTCTTCTTAAAGG - Intergenic
1124047511 15:26163903-26163925 TGTGGGAGCTGGTTGTTTAAAGG - Intergenic
1129580734 15:76806953-76806975 TGGGGGGCAGGTGTCTTTAAGGG + Intronic
1130161820 15:81409193-81409215 TGTAGAGCCTGTTTATGTAAGGG - Intergenic
1130865918 15:87933247-87933269 TGTGGGGCCAGTTTCTTTCCAGG - Intronic
1131407266 15:92175596-92175618 TGTGTGGCCTGGTTCTTAAAAGG - Intergenic
1133809256 16:9148611-9148633 TGTGTGGCCTGGTTCCTAAAGGG + Intergenic
1134330434 16:13245888-13245910 TCTGGCGCCTGTTTATTTAAGGG + Intergenic
1134679451 16:16114015-16114037 TGTGGGGCCTGGTTCCTAACCGG + Intronic
1135572102 16:23557438-23557460 TAGGGGGCCTGTGACTTTAAGGG - Exonic
1136048624 16:27634928-27634950 TTTGGGGCCAGTGTTTTTAAGGG + Intronic
1136061344 16:27728739-27728761 TGTGGGGCTGCTCTCTTTAAAGG - Intronic
1137491799 16:48939075-48939097 TGTGGGCCCTGGTTCTTTCAAGG - Intergenic
1137729037 16:50676606-50676628 TGTGGGGGCTGGGTCTTGAAGGG - Intronic
1137759856 16:50931761-50931783 TATGGGGCTTTTTTGTTTAAGGG + Intergenic
1140383646 16:74513547-74513569 TGAGGGGCCTGTCTCTTAGAAGG + Intronic
1140916617 16:79499591-79499613 TTTGGGGCCTCTTTTTATAAAGG - Intergenic
1140926463 16:79589158-79589180 TGAGGGGCCTTTTTCTTAGAGGG - Intronic
1144674809 17:17155050-17155072 TGTGGGGGCTGGTCCTTTGATGG + Intronic
1145688640 17:26707054-26707076 TTTGAGGCCTGTTGCTTAAAAGG + Intergenic
1146553897 17:33806543-33806565 TAAGGAGCCTGCTTCTTTAAAGG + Intronic
1150099383 17:62408966-62408988 TGTGGGGATTGTTATTTTAATGG - Intronic
1151335831 17:73439110-73439132 TGTGAGGGCTGGTTGTTTAAAGG + Intronic
1151786278 17:76276597-76276619 TGTGGGGCCTGGCACTTTTATGG - Intronic
1153073015 18:1127983-1128005 TGTGAGGCCTGTTTATTTTGGGG - Intergenic
1153205577 18:2696301-2696323 TGTGGGGCCGGGTTCCTAAAAGG - Intronic
1153240328 18:3025462-3025484 TGTGCAGCCTGTTTCTTGTATGG - Intergenic
1153728653 18:7983409-7983431 TTTGGGGCCTGTTGGTATAAAGG + Intronic
1153749086 18:8210776-8210798 TGGGGGAACTGTTGCTTTAAAGG + Intronic
1153833945 18:8947759-8947781 TGAGGTCCCTGTTTCTTTACTGG - Intergenic
1154078564 18:11230572-11230594 TTTGGGGACTGCTGCTTTAAAGG + Intergenic
1154121464 18:11655702-11655724 TGTTGGGCTTGTTTCTTCAGCGG - Intergenic
1154165240 18:12009787-12009809 TGTGCCACCTTTTTCTTTAATGG + Intronic
1154351262 18:13585344-13585366 TCTGGGTTCTGTTTTTTTAAAGG + Intronic
1159266506 18:66087441-66087463 TGTGGTGCCTGTTTTCTGAAGGG - Intergenic
1159558358 18:69968261-69968283 TGTGCGGCCTGGTTCCTAAAAGG + Intergenic
925432607 2:3808333-3808355 TTGGGGACCTGTTTGTTTAATGG + Intronic
925672593 2:6327209-6327231 TCTGGGGCCACTTTCTTAAAGGG + Intergenic
926176475 2:10596650-10596672 TGTGCGGCCTGATTCCTAAAAGG + Intronic
931770756 2:65495749-65495771 TGTGGAGCCTCTTCCTATAAGGG - Intergenic
931942270 2:67265623-67265645 TATGGTGCCTGTCTCCTTAAAGG + Intergenic
932564948 2:72900368-72900390 TGTGGGGCCTCTTTCCTTCTGGG + Intergenic
933087320 2:78071849-78071871 TGTTGGGCTTATTTCTTAAAAGG + Intergenic
935899406 2:107774825-107774847 TGTGGAGTCTGTTACTTTAGTGG + Intergenic
936996377 2:118418263-118418285 AGAGTGGCCTCTTTCTTTAAAGG - Intergenic
937556778 2:123167637-123167659 TGTGCCATCTGTTTCTTTAAGGG + Intergenic
937840325 2:126518620-126518642 TGTGGGGCATCTTTGATTAATGG - Intergenic
939899712 2:147837435-147837457 TGTGCGGCCTGGTTCTTAACAGG + Intergenic
941770547 2:169340675-169340697 TGTGGAGCCTGTGTCTCTAATGG + Intronic
943597747 2:189878321-189878343 TGTGGGACCTGGTTTTTGAAAGG - Intergenic
944279367 2:197877354-197877376 TGAGGGGCCTGTGTTTATAAGGG + Intronic
945368013 2:208979992-208980014 TGTGGGATCTGGTTGTTTAAAGG + Intergenic
945915132 2:215695862-215695884 TTTGTGGCCTGTTTCTGTTAGGG + Intergenic
946073122 2:217051414-217051436 TGTTTGGCCTTTGTCTTTAATGG + Intergenic
946151234 2:217772843-217772865 TCTGGGGCCTCTTTTTGTAAGGG + Intergenic
948001572 2:234572331-234572353 CGTGGGGCATGTGTCTTTGATGG - Intergenic
1169516602 20:6322821-6322843 TGGGTGTCCTGTTTATTTAAAGG + Intergenic
1170406424 20:16042762-16042784 TCTGGGGCCAGTTTATTTATGGG + Intronic
1173069375 20:39747011-39747033 TGTGTGGCCTGGTTCTTAACAGG - Intergenic
1174662755 20:52228581-52228603 TGTGTGGCCTGGGTTTTTAACGG - Intergenic
1174703052 20:52628551-52628573 TGTGGGGGTTGTTTCATTATTGG - Intergenic
1180470652 22:15652205-15652227 TTTGGGGCGTTTTTCTTTCATGG + Intergenic
1180788240 22:18558708-18558730 TGTGGAGCCTGTTGCTTTCCAGG - Intergenic
1181233498 22:21436610-21436632 TGTGGAGCCTGTTGCTTTCCAGG + Intronic
1181245152 22:21498233-21498255 TGTGGAGCCTGTTGCTTTCCAGG - Intergenic
1182557102 22:31135170-31135192 AGGGGGGCCTCTTTTTTTAACGG - Exonic
1184728573 22:46360056-46360078 GGTGAGCCCTGTTTCCTTAAGGG + Intergenic
950374817 3:12562586-12562608 TGTGTGGCCTGGTTCCTAAAAGG - Intronic
951403278 3:22261962-22261984 TGTGCCACCTGCTTCTTTAAAGG + Intronic
952635388 3:35523040-35523062 TGTGTGGCCTGGTTCTTAACAGG + Intergenic
953636401 3:44668794-44668816 TTTTGTGCGTGTTTCTTTAAGGG - Intergenic
955054592 3:55444383-55444405 TTTGGGAACTGCTTCTTTAAAGG - Intergenic
955917937 3:63925346-63925368 TGTGTGGCCTGTTTCCTAACAGG - Intronic
955989556 3:64611763-64611785 TGTGCAGCCTGGTTCTTTACAGG + Intronic
956855526 3:73271194-73271216 CTTGTGGCCTGTTTCTTTTATGG - Intergenic
960665630 3:120106147-120106169 TGTGGGGACAGTTTCTTCAAGGG - Intergenic
963533017 3:146495542-146495564 TCTGGGGTCTATTTCTATAAGGG - Intronic
965946028 3:174242277-174242299 TGTGCGGCCTGATTCTTAACAGG - Intronic
966358479 3:179107854-179107876 TGTGTGGCCTGGTTCTTAACAGG + Intergenic
971211207 4:24618409-24618431 TGTGTGGCCTGGTTCTTAACAGG + Intergenic
972302281 4:37796110-37796132 TTTGGGGCCTGATAATTTAAAGG + Intergenic
973539587 4:51922845-51922867 TCTGGGGTCTCTTTCTGTAAGGG - Intergenic
973907815 4:55547916-55547938 TGAGGTGACTGTTACTTTAAAGG - Intergenic
973991690 4:56414791-56414813 CCTGGGCCCTGTTTCTCTAAAGG + Intronic
974104732 4:57456847-57456869 TTTGAGGCCTGTTTCTTCAATGG - Intergenic
975883050 4:78933713-78933735 TTTTGGGTCTGTTTCTTTATTGG + Intronic
980164815 4:129213184-129213206 TGTGGGGCCTGGTTCCTAACAGG - Intergenic
982625370 4:157760051-157760073 TGAGGGGCCTGTTTGTTAGAAGG - Intergenic
984072974 4:175139389-175139411 TGTGCGGCCTGTTTCCTAAAGGG + Intergenic
985165715 4:187092170-187092192 TGTGGTCCATGTTTCTTTAGTGG + Intergenic
986194829 5:5528180-5528202 TCTGGGGCCTGTTCCATTTATGG - Intergenic
986197972 5:5555289-5555311 TGTGTGGCCTGGTTCCTTACAGG - Intergenic
988882277 5:35516594-35516616 TGTGGGGCCTGGTTCCTAACAGG - Intergenic
989437896 5:41435844-41435866 GGTGGGCCCTGTTTCTTTACGGG - Intronic
990247124 5:53874213-53874235 TGTGAGGCCTGGTTCCTTACAGG + Intergenic
991929514 5:71738762-71738784 TTTGGGGCTCTTTTCTTTAAAGG + Intergenic
992499860 5:77331235-77331257 TGTGGGGTCTGTATCCTTGAAGG + Intronic
994603864 5:101942633-101942655 GGTGTGGCCTGATTCTCTAAGGG - Intergenic
996224845 5:120979478-120979500 TATGGGGCCTTATTCTTTACAGG + Intergenic
996767743 5:127051580-127051602 TGTGGGAACTGTTTGCTTAATGG - Intronic
997689387 5:135815419-135815441 TGTGTGGCCTGGTTCCTAAAAGG + Intergenic
997919316 5:137963673-137963695 TGTGTGGCCTGGTTCTTAACAGG - Intronic
998749663 5:145305666-145305688 CCTGGGTCCTGTTTTTTTAAAGG + Intergenic
1004000266 6:11591364-11591386 TGTGCGGCCTGGTTCTTAACAGG + Intergenic
1004164990 6:13249159-13249181 TGTGGGGCCTGTTTCCTAACAGG - Intronic
1004618712 6:17314559-17314581 TCTGGAGCCTGTTTTTATAAGGG - Intergenic
1010856397 6:80845998-80846020 CGTGGATCCTGTATCTTTAAGGG - Intergenic
1013703671 6:112806269-112806291 TGTGGGTTCTGATTCATTAAAGG - Intergenic
1019506119 7:1392357-1392379 TGTGAGACCTGGTTGTTTAAAGG + Intergenic
1020430817 7:8114492-8114514 TTTTGGGCCTGTTGCTTTGAAGG - Intronic
1021838168 7:24701154-24701176 TGAGCGTCATGTTTCTTTAAGGG - Intronic
1022284843 7:28946649-28946671 TCTGGGGCCTCTTTTTATAAGGG - Intergenic
1022291061 7:29003950-29003972 TGTGTGGCCTGCTTCCTAAAAGG + Intronic
1024349201 7:48346505-48346527 TGGGGGGCTTTTTTTTTTAATGG - Intronic
1025629383 7:63255478-63255500 TGTGGGGACAGAGTCTTTAATGG - Intergenic
1026413996 7:70158093-70158115 TGTGGGGCCTGGTTATTTGGAGG + Intronic
1026828283 7:73597023-73597045 TGTGGGGCCTGTACCTAAAAGGG - Intronic
1027722504 7:81762014-81762036 TGTGAGGCCTGTTTCTTAACAGG + Intronic
1028067560 7:86406322-86406344 TGTGTGGCCTGGTTCTTAAAAGG - Intergenic
1028765315 7:94550674-94550696 TCTGGGGTCTTTTTTTTTAAAGG + Intronic
1029377785 7:100191014-100191036 GGTGGGGCCTGTTGTCTTAAAGG + Intronic
1029898945 7:104019690-104019712 TGTGGTGTTTATTTCTTTAAGGG + Intergenic
1030607687 7:111655397-111655419 TGTGAGATCTGGTTCTTTAAAGG - Intergenic
1031309949 7:120183989-120184011 AGGGGGGCCTGTTCATTTAACGG + Intergenic
1035180590 7:157086531-157086553 TGTGTGGCCTGTATCTATATAGG - Intergenic
1036385298 8:8274165-8274187 TGTGGGTCCTGAATCTTGAAAGG - Intergenic
1038199101 8:25395336-25395358 TGTGTGGCCTGTTTCCTAATAGG + Intronic
1038202745 8:25430299-25430321 TGTGTGGCCTGATTCTTAACAGG - Intronic
1038265577 8:26037517-26037539 AGTGGGGCCAGTGTCTTTATCGG - Intronic
1041583090 8:59485334-59485356 TATGGGGATAGTTTCTTTAAAGG - Intergenic
1044031950 8:87249371-87249393 TGTGTGGCCTGATTCTTAACAGG + Intronic
1046362122 8:113173639-113173661 TTTGGTGCCTGTTTCTTCTACGG - Intronic
1046662930 8:116968454-116968476 TGTGGGGACTGTTTTATTCATGG + Intronic
1054737536 9:68770544-68770566 TGTGTGGCCTGGTTCCTTACAGG - Intronic
1055132253 9:72789369-72789391 TGTGGGTTATGTTTCTTTGATGG + Intronic
1056952787 9:91057956-91057978 TGTGAGGTCTGGTTGTTTAAAGG + Intergenic
1057138245 9:92710263-92710285 TGTGGGGCAGGCTTCTTTACAGG - Intergenic
1058074526 9:100637508-100637530 TGAGGGGCCTGTCTGTTAAAAGG - Intergenic
1059898122 9:118891339-118891361 TGTGAGGCCTGTTTCCTAACAGG - Intergenic
1060599911 9:124870493-124870515 AGTGGGGCCTGCTGCTTTAGGGG + Intronic
1061107204 9:128540347-128540369 TGTGGGGCATGTTGGTCTAAGGG - Intronic
1188401143 X:29746440-29746462 TGTGGAGCAAGTTTCTGTAAAGG + Intronic
1188469214 X:30518340-30518362 TGTGTGGCCTGGTTCTTAAGAGG + Intergenic
1188659230 X:32737477-32737499 TGTGGAGTCTTTTTTTTTAATGG - Intronic
1189978373 X:46485605-46485627 TGAGGGGCCTGTCTGTTAAAAGG - Intronic
1191596970 X:62956246-62956268 TATAGGGCCAGTTTCTTCAAGGG - Intergenic
1194503528 X:94705904-94705926 TGTTGGCCCTGTTTCTTAAAGGG + Intergenic
1194818388 X:98473977-98473999 TGTGAGGCCTGGTTCTTAACAGG - Intergenic
1197696799 X:129558612-129558634 TTTGGGGTCTGTGTCTTTCAGGG + Exonic
1198323947 X:135548389-135548411 TGTGGGGCCTCAGTCTTTTATGG - Intronic
1199883936 X:152000065-152000087 TGTGCGGCCTAGTTCCTTAAAGG + Intergenic
1200767619 Y:7093682-7093704 TGTGGGGGCTGCTTCTTCACTGG + Intergenic