ID: 904566017

View in Genome Browser
Species Human (GRCh38)
Location 1:31428899-31428921
Sequence CAGCCCACTCACACCAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 2, 3: 91, 4: 472}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904566017_904566032 20 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566032 1:31428942-31428964 GTCTGGCAGGGGTCTTACCAGGG 0: 1
1: 0
2: 0
3: 8
4: 131
904566017_904566026 -2 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566026 1:31428920-31428942 TGGGTGGGGTGGGGTGTCTCTGG 0: 1
1: 0
2: 14
3: 95
4: 886
904566017_904566030 9 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566030 1:31428931-31428953 GGGTGTCTCTGGTCTGGCAGGGG 0: 1
1: 0
2: 1
3: 26
4: 279
904566017_904566029 8 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566029 1:31428930-31428952 GGGGTGTCTCTGGTCTGGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 200
904566017_904566027 3 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566027 1:31428925-31428947 GGGGTGGGGTGTCTCTGGTCTGG 0: 1
1: 0
2: 1
3: 53
4: 386
904566017_904566028 7 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566028 1:31428929-31428951 TGGGGTGTCTCTGGTCTGGCAGG 0: 1
1: 0
2: 2
3: 68
4: 360
904566017_904566031 19 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566031 1:31428941-31428963 GGTCTGGCAGGGGTCTTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 129
904566017_904566033 21 Left 904566017 1:31428899-31428921 CCTTGGCTGGTGTGAGTGGGCTG 0: 1
1: 0
2: 2
3: 91
4: 472
Right 904566033 1:31428943-31428965 TCTGGCAGGGGTCTTACCAGGGG 0: 1
1: 0
2: 2
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904566017 Original CRISPR CAGCCCACTCACACCAGCCA AGG (reversed) Intronic
900154998 1:1200372-1200394 CAGCACACTCTCACCAGCAGCGG + Intergenic
900391370 1:2435392-2435414 CAGCGCTCTCACACCACCCTGGG + Intronic
900815417 1:4839901-4839923 CATCCCAGTCACTGCAGCCATGG - Intergenic
900946539 1:5834240-5834262 CAGGCCACACACCCCAGCCTGGG + Intergenic
901089785 1:6633518-6633540 CTGCCCACTCACACCAGGCCGGG - Exonic
901926191 1:12567691-12567713 CAGGCCCCTCCCAGCAGCCATGG - Intergenic
902215782 1:14933672-14933694 CAGCCCTTGCACACCAGCCTGGG - Intronic
902509426 1:16958056-16958078 CAGCCCACACACACCAGACTGGG - Intronic
902694131 1:18128919-18128941 CAGCCCACTCACCCAAGCGCTGG - Intronic
903258189 1:22116709-22116731 CAGCAAACTCACAGCAGCCGGGG - Intergenic
904118226 1:28177751-28177773 CTGCCAACCCACACCAGCCTGGG - Intronic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904914485 1:33960105-33960127 CAGCCCACTCTTACCATCCCTGG + Intronic
905067538 1:35195965-35195987 CGCCGCACTCAGACCAGCCATGG - Intergenic
905318246 1:37097212-37097234 CAGCCCTCTCACATCACCCCAGG - Intergenic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
905630116 1:39513893-39513915 GAGCCCACAGAGACCAGCCAGGG + Intronic
905667643 1:39772297-39772319 GAGCCCACAGAGACCAGCCAGGG - Intronic
905894449 1:41535935-41535957 CAGCTCAGTATCACCAGCCATGG - Intronic
906077482 1:43062841-43062863 CAGGCCTCTCACACCAGGCCAGG - Intergenic
907439223 1:54468594-54468616 CATCCCAGCCACTCCAGCCATGG + Intergenic
907792928 1:57684994-57685016 CATGCCACTCACTCCAGCCTGGG - Intronic
907798615 1:57742427-57742449 TATCTCACTGACACCAGCCAGGG - Intronic
908509577 1:64840786-64840808 CACACCACTCACTCCAGCCTGGG + Intronic
908581265 1:65519905-65519927 CATGCCACTCACTCCAGCCTGGG - Intronic
908752224 1:67435340-67435362 CAGCCCGCGCACTCCAGCCTGGG - Intergenic
908911213 1:69073638-69073660 CATCCCAGTCGCTCCAGCCATGG - Intergenic
911686296 1:100780865-100780887 CATCCCAGCCACTCCAGCCATGG - Intergenic
911943325 1:104073969-104073991 CTGCCCACTCACACCAGGCCAGG - Intergenic
913318767 1:117574430-117574452 CACCCAACTCTCACCAGCCTGGG + Intergenic
915654876 1:157351076-157351098 CATCCCAGCCACTCCAGCCATGG - Intergenic
917536584 1:175878574-175878596 CTCCCCACTTGCACCAGCCAAGG - Intergenic
918490367 1:185075036-185075058 CACGCCACTCACTCCAGCCTGGG - Intronic
922420009 1:225453088-225453110 CACGCCACTCACTCCAGCCTGGG + Intergenic
922634448 1:227151978-227152000 CACGCCACTGACACCAGCCTAGG + Intronic
923407699 1:233679322-233679344 CAGACCTCTCAGATCAGCCATGG + Intergenic
924152451 1:241142573-241142595 CATCCCAGCCACTCCAGCCATGG - Intronic
924350244 1:243107693-243107715 CAGACCACTCACCGAAGCCAGGG - Intergenic
1062904421 10:1170154-1170176 CAACCCACCCTGACCAGCCAAGG - Intergenic
1063396502 10:5692843-5692865 CGGCCCCCTCCCGCCAGCCAAGG - Intronic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1065152388 10:22835599-22835621 CACACCACTCACTCCAGCCTGGG - Intergenic
1065745245 10:28834797-28834819 CATACCACTCACTCCAGCCTGGG - Intergenic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1068805796 10:61192693-61192715 CACCCCAGCCACTCCAGCCATGG - Intergenic
1068936515 10:62640240-62640262 CAGGCCACTGACTCCAGCCTGGG + Intronic
1069040787 10:63693754-63693776 CATCCCAGCCACTCCAGCCATGG + Intergenic
1069616464 10:69809657-69809679 GAGGCCAGTCAAACCAGCCAGGG + Intronic
1071035495 10:81239249-81239271 CACCCCAGCCACTCCAGCCATGG - Intergenic
1071098937 10:82012270-82012292 CATCCCAGCCACTCCAGCCATGG - Intronic
1071569885 10:86691033-86691055 CAGCCCACTCACCCTGGCCGGGG - Intronic
1072431154 10:95371916-95371938 CAACACACTCACACTAACCAAGG + Intronic
1072546775 10:96446118-96446140 CAGCCCAGACACCACAGCCATGG - Exonic
1072593883 10:96853603-96853625 CAGCCAAATCACCCCAGACATGG - Intronic
1072761656 10:98061802-98061824 GCGCACACACACACCAGCCAAGG - Intergenic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1073880279 10:107973205-107973227 CATCCCAGCCACTCCAGCCAAGG + Intergenic
1074917582 10:117972157-117972179 CATGCCACTCACTCCAGCCTGGG + Intergenic
1075237765 10:120746437-120746459 CAGCCCACTGACAGCTTCCAGGG - Intergenic
1075625404 10:123960642-123960664 CAGCCCACTCACACTGGGGAGGG - Intergenic
1075750454 10:124766192-124766214 CACTGCACTCAGACCAGCCAAGG - Intronic
1076273575 10:129177447-129177469 CAGCCCACCCTCCCCAGGCAAGG + Intergenic
1076406534 10:130215682-130215704 CAGGCCTCCCCCACCAGCCAAGG - Intergenic
1076613823 10:131743469-131743491 CAGCCCTCCCAAATCAGCCACGG + Intergenic
1077464362 11:2726538-2726560 CACCTCCCTCACATCAGCCATGG - Intronic
1077597636 11:3547626-3547648 CAGCCCACTGCCACCAGCAAAGG + Intergenic
1078108428 11:8373089-8373111 GAGCCCAGTCATCCCAGCCAAGG - Intergenic
1078856153 11:15207619-15207641 CAGCCCACTCCCTCCTGCCCAGG - Intronic
1079504309 11:21136275-21136297 CACCCCCCTCACAACAGGCATGG - Intronic
1079921842 11:26442565-26442587 CAGCCCTTGCACACCAGCCTTGG - Intronic
1080183000 11:29446358-29446380 CGTCCCAGTCACTCCAGCCATGG + Intergenic
1081586115 11:44384937-44384959 CCACTCACTCACACCACCCAAGG - Intergenic
1081785212 11:45741762-45741784 CAGCCAAGTCATCCCAGCCAAGG + Intergenic
1083065262 11:59917093-59917115 CATCCCAGCCACTCCAGCCATGG - Intergenic
1083787983 11:64964263-64964285 CAGACCTCTGAGACCAGCCAAGG - Intronic
1084063310 11:66689485-66689507 CAGCCCAGCCACACAACCCATGG + Intronic
1084253735 11:67923532-67923554 CAGCCCACTGCCACCAGCAAAGG + Intergenic
1084323845 11:68387957-68387979 CAGCACACTCACAACCCCCAGGG - Intronic
1084400326 11:68939536-68939558 GAGCCCTCTCACCGCAGCCATGG - Exonic
1084476536 11:69392457-69392479 CACCCCACAGACACCAGCCTTGG - Intergenic
1084668679 11:70592491-70592513 CAGCACACCCCCTCCAGCCACGG + Intronic
1084819142 11:71672394-71672416 CAGCCCACTGCCACCAGCAAAGG - Intergenic
1085906818 11:80774246-80774268 CATCCCAGTCACTCCAGCCATGG + Intergenic
1085942623 11:81222914-81222936 CAGCCCCCACCCCCCAGCCAAGG - Intergenic
1086053409 11:82620021-82620043 CAGTGCACTCACTCCAGCCTTGG + Intergenic
1086777394 11:90855939-90855961 CACAGCACTCACTCCAGCCAGGG + Intergenic
1087212402 11:95457449-95457471 CTGACCAATCACAACAGCCAAGG + Intergenic
1087475359 11:98627200-98627222 CACACCACTCACTCCAGCCTTGG - Intergenic
1087495951 11:98890862-98890884 CATCCCAGGCACACCAGCCATGG - Intergenic
1088002511 11:104899421-104899443 GAGCCCAGTCATCCCAGCCAAGG + Intergenic
1089395996 11:118136573-118136595 CAGCCCACTCCCACCTCCAAAGG + Exonic
1089405133 11:118191585-118191607 CATCCCAGCCACTCCAGCCATGG + Intergenic
1089877559 11:121740262-121740284 CATCCCACTCATGCCAGCAAAGG - Intergenic
1092383833 12:8020117-8020139 CATGCCACTCACTCCAGCCCAGG + Intergenic
1092423809 12:8356919-8356941 CAGCCCACTGCCACCAGCAAAGG + Intergenic
1092619078 12:10243568-10243590 CACGCCACTCACTCCAGCCTGGG + Intergenic
1093383449 12:18521974-18521996 CAGCCCCCACCCCCCAGCCAAGG - Intronic
1096063344 12:48720269-48720291 CATCCCAGCCACTCCAGCCATGG - Intergenic
1096486322 12:51984110-51984132 CAGCCCACTAGCAGCAGACAAGG - Exonic
1099243270 12:80163683-80163705 AAGCCAAATCACCCCAGCCAAGG - Intergenic
1099247812 12:80215208-80215230 CAGGCCATTCACTCCAGCCTGGG - Intronic
1100298439 12:93284739-93284761 CATGCCACTCACTCCAGCCTGGG - Intergenic
1101101617 12:101399466-101399488 CACGCCACTCACTCCAGCCTGGG + Intronic
1102257639 12:111425362-111425384 CAGCCCCCTCCCACCTCCCAAGG - Intronic
1102323181 12:111956825-111956847 CACGCCACTCACTCCAGCCTGGG - Intronic
1102390792 12:112547098-112547120 CAGCCCTCTCCAACCACCCACGG - Intergenic
1102742237 12:115217961-115217983 CAGCCCATCCACATCAGGCAAGG + Intergenic
1103295802 12:119885752-119885774 TAGCACACACACCCCAGCCATGG + Intergenic
1103546388 12:121704694-121704716 CAGCCCACTCACGACATCAAAGG + Intergenic
1103681714 12:122699584-122699606 CATCCCAGTCACCCCAGCCCCGG + Intergenic
1103683466 12:122713048-122713070 CATCCCAGTCACCCCAGCCCCGG + Intergenic
1104317151 12:127713795-127713817 CAGCCCACTGAACCCAACCAGGG - Intergenic
1104792591 12:131493295-131493317 CAGCCTCCTCACACCTGCCCGGG - Intergenic
1104808077 12:131602130-131602152 CATCCCAGCCACTCCAGCCATGG - Intergenic
1105581278 13:21699087-21699109 CAGCCCAATCTCCCCAGCTAAGG + Intronic
1105728153 13:23186139-23186161 AAGGCTACTCAGACCAGCCAGGG - Intronic
1106704447 13:32265627-32265649 CACACCACTCACATCAGCCAAGG - Intronic
1107217285 13:37936074-37936096 CAACCCAGCCAGACCAGCCACGG - Intergenic
1107796062 13:44053030-44053052 CTGCCCACTCACATCAAGCAAGG - Intergenic
1110083409 13:71345922-71345944 CATCCCAGCCACTCCAGCCATGG - Intergenic
1110377836 13:74814408-74814430 CATCCCAGCCACTCCAGCCATGG + Intergenic
1110567236 13:76968508-76968530 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1110817098 13:79873963-79873985 CAACACACTCACACCAACCTAGG - Intergenic
1110921719 13:81095956-81095978 CAGGCCACTGACTCCAGCCTGGG + Intergenic
1111072541 13:83187683-83187705 CATCCCAGCCACTCCAGCCATGG + Intergenic
1111327791 13:86722003-86722025 TAGCTGGCTCACACCAGCCATGG + Intergenic
1111441307 13:88285600-88285622 CATCCCAGCCACTCCAGCCATGG + Intergenic
1112142869 13:96665126-96665148 CATGCCACTCACTCCAGCCTGGG + Intronic
1113200911 13:107867055-107867077 CAGCCCGCTCTCCCCTGCCAGGG + Intergenic
1114917818 14:27289172-27289194 CATCCCAGTCGCTCCAGCCATGG - Intergenic
1115076898 14:29403499-29403521 CACCCTACTCATACCAGCAAAGG - Intergenic
1115113646 14:29854825-29854847 CATCCCAGCCACTCCAGCCATGG + Intronic
1115541689 14:34427194-34427216 CATCCCAGCCACACTAGCCATGG + Intronic
1115561816 14:34589406-34589428 CACGCCACTCACTCCAGCCTGGG + Intronic
1116281574 14:42914955-42914977 CATCCCAGCCACTCCAGCCATGG - Intergenic
1116409429 14:44604103-44604125 CAGCCCACTCACACTGGAGAGGG + Intergenic
1116588524 14:46740871-46740893 AAGCCCACTCACACTGGCCTGGG + Intergenic
1117837825 14:59825869-59825891 CAGGCCACTCACTCCAGGAATGG + Intronic
1118220187 14:63848344-63848366 CACTGCACTCAGACCAGCCAAGG + Intergenic
1118717863 14:68573097-68573119 CAGTCAACTCCCAGCAGCCAGGG + Intronic
1118835989 14:69478213-69478235 CATCCCAGCCACTCCAGCCAGGG - Intergenic
1118885855 14:69865411-69865433 AAGCCCACTCACATCAGGGAGGG + Intronic
1120326501 14:83036574-83036596 CATCCCAGCCACTCCAGCCATGG - Intergenic
1122265662 14:100545582-100545604 AAGCCCCCTCCCACCAGCAATGG - Intronic
1122482195 14:102054492-102054514 CAGCCCACCCCCAACCGCCAGGG + Intergenic
1123089859 14:105737708-105737730 CAGACCCCACACACCAGCCATGG - Intergenic
1123983731 15:25625696-25625718 CATTCCACTCACTCCAGCCTGGG + Intergenic
1125734049 15:41911469-41911491 CAGCCCACCCACACCAAGCCAGG - Intronic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1127393850 15:58527984-58528006 CAGCCCACACTCCCCACCCACGG + Intronic
1127598387 15:60510664-60510686 CAGCCAACTGGCAACAGCCAGGG - Intronic
1127849493 15:62900755-62900777 CTGCCCACTCACAGCGGCCGGGG + Intergenic
1128041458 15:64578213-64578235 CAGCCCACTGCGCCCAGCCAAGG + Intronic
1129285426 15:74520673-74520695 CACACCACTCACTCCAGCCTGGG - Intergenic
1129584470 15:76848894-76848916 CAGAACAGTCACCCCAGCCATGG + Intronic
1129584711 15:76850363-76850385 CAGAACAGTCACCCCAGCCATGG + Intronic
1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG + Intronic
1132679538 16:1134121-1134143 GAGCCGACTCACCCCAGCCCTGG + Intergenic
1132729718 16:1355465-1355487 CAGCCCAGCCCCACCAGCCTCGG - Intronic
1132840007 16:1974333-1974355 CAGCCCACTCACACCGTGCTCGG + Intronic
1133025036 16:2985450-2985472 AAGGCAACTCACACCAGCAAAGG - Intergenic
1133374468 16:5273021-5273043 CAGCCCACTGCCACCAGCAAAGG - Intergenic
1136136318 16:28258863-28258885 CATGCCACTCACCCCAGCCGAGG + Intergenic
1136301674 16:29339049-29339071 CCGGGCACTCAGACCAGCCAGGG + Intergenic
1136344481 16:29665890-29665912 CACCACACTCTCCCCAGCCATGG + Exonic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137800702 16:51259671-51259693 CAGCCTTCTCTAACCAGCCAAGG - Intergenic
1138383808 16:56622319-56622341 CATCCCAGCCACTCCAGCCATGG + Intergenic
1139966203 16:70746759-70746781 CAGCCCCTGCACACCTGCCACGG + Intronic
1140090320 16:71833048-71833070 CAGCACAGACACACCAGGCACGG + Intergenic
1140225320 16:73071952-73071974 CATCCCACTCAGAACAGCCTAGG - Intergenic
1140476972 16:75243939-75243961 CCGCCCACACCCTCCAGCCAGGG - Intronic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1142041373 16:87896595-87896617 CAACCCACTTCCACCAGCAAAGG - Intronic
1142660281 17:1424406-1424428 CAGCCCACTCGCACAAGACCTGG + Intronic
1142729982 17:1847411-1847433 CAGCCCACTCTCTCCAGTCACGG + Intronic
1142795358 17:2303335-2303357 CAGCCCTCTCAGACCCGCCCCGG - Intronic
1142876474 17:2854264-2854286 CAGGCTCCTCGCACCAGCCAGGG - Intronic
1143352834 17:6301534-6301556 CTGCCCACACATAGCAGCCAGGG - Intergenic
1144123124 17:12176219-12176241 CACACCACTCACTCCAGCCTGGG - Intergenic
1146917339 17:36686670-36686692 CAGCCTAATCACAGCAGCCCTGG + Intergenic
1147188778 17:38726817-38726839 CACCCCACCCCCACCAACCAGGG + Exonic
1147488050 17:40837514-40837536 CACTACACACACACCAGCCAGGG + Intergenic
1147717283 17:42516842-42516864 CAGCACTGTCACACCAGGCAGGG + Intronic
1147718267 17:42522321-42522343 CAGCTCACTCAGAAAAGCCAGGG - Exonic
1148212364 17:45816344-45816366 GTTCCCACTCACACCAGCTAGGG - Intronic
1148574801 17:48702416-48702438 GGTCCCACTCACACCAGCAAAGG - Intergenic
1149102027 17:52918585-52918607 CATCCCAGCCACTCCAGCCATGG - Intergenic
1149234114 17:54570588-54570610 CATCCCAGTCACTCCAGCCAGGG - Intergenic
1149481514 17:57007285-57007307 CAAGCCACTCACTCCAGCCTGGG + Intergenic
1149524172 17:57341049-57341071 CAGCTCTCTCACACCAGCCCTGG - Intronic
1149602491 17:57902283-57902305 CACACCACTCACTCCAGCCTGGG + Intronic
1149649210 17:58266251-58266273 CAGCCAACTCACAGGATCCATGG + Exonic
1150693785 17:67386715-67386737 AAGCCCACACAAGCCAGCCAGGG - Intronic
1150786884 17:68170252-68170274 CAGCCCAAACACACCATCCATGG + Intergenic
1151135810 17:71944978-71945000 CATCCCAGCCACTCCAGCCATGG + Intergenic
1152121644 17:78422539-78422561 CATGCCACTCACTCCAGCCTGGG - Intronic
1152613659 17:81328361-81328383 CAGCCCACCCTCACCCGCCCGGG + Intronic
1152701698 17:81822850-81822872 CAGCCCAGTCCCAGCAGCCTGGG + Exonic
1153913259 18:9722255-9722277 CAGCCCTCACACAGCTGCCAGGG - Intronic
1154007042 18:10539830-10539852 CACCCCAGACACAGCAGCCATGG + Exonic
1154049740 18:10942893-10942915 CGTCCCAGTCACTCCAGCCATGG + Intronic
1154319121 18:13330796-13330818 CAGCCCACCCCCACCCTCCAGGG + Intronic
1156034718 18:32753616-32753638 TAGCCCACCCCCACCACCCAAGG + Intronic
1156169382 18:34463587-34463609 CATCCCAGCCACTCCAGCCATGG - Intergenic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1160936617 19:1599195-1599217 CACCCCAATCACACAACCCAAGG + Intronic
1160971814 19:1772055-1772077 CACACCACTCACTCCAGCCTGGG - Intronic
1162518723 19:11166451-11166473 CACCCCACTCACACTCCCCAAGG - Intronic
1162674776 19:12290757-12290779 CAGCCTAATCACTCCAGCAATGG - Intronic
1163057771 19:14734150-14734172 CATCCCACTAACAGGAGCCAGGG - Exonic
1163148383 19:15397484-15397506 CAGCCCACTCCCACCAGGCAAGG - Intronic
1163528950 19:17838334-17838356 CAGCCCACCCACATCATCCTTGG - Exonic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164588342 19:29491720-29491742 CAGCCAACACACAGCAGCCAGGG + Intergenic
1165017469 19:32891253-32891275 CAACCCAAGCACACCACCCAGGG + Intronic
1165124744 19:33585973-33585995 CTGCCCACTCTCGCCAGGCAGGG + Intergenic
1166252762 19:41582703-41582725 CATCCCAGCCACTCCAGCCATGG - Intronic
1166533979 19:43560355-43560377 CAGTGCACTCACTCCAGCCTGGG + Intronic
1167383953 19:49153376-49153398 CTTCCCACCCACACCAGCCCAGG + Intronic
1167399676 19:49256458-49256480 CATGCCACTCACTCCAGCCTGGG - Intergenic
1168033974 19:53704207-53704229 CCACCCACTCACGCCAGCCCCGG + Intergenic
1168267276 19:55229839-55229861 ACGCACACTCACACCAGCCTGGG + Exonic
1168400963 19:56086159-56086181 CAGCCCACTCTGAACTGCCAAGG + Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925259800 2:2519607-2519629 CAGCCCAGCACCACCAGCCAAGG + Intergenic
925864739 2:8217547-8217569 AAGCACACTCACACCAGCTGTGG + Intergenic
926465107 2:13177604-13177626 CATCCCAGCCACTCCAGCCATGG - Intergenic
926938910 2:18115001-18115023 CATCCCAGCCACTCCAGCCATGG + Intronic
927808850 2:26171002-26171024 CAGCCCGCTCACCCTGGCCAGGG - Intergenic
928213452 2:29341316-29341338 CTGCCCACTCATACCTGCAATGG + Intronic
929822493 2:45284505-45284527 CACCCCTCACACACAAGCCAGGG + Intergenic
930419642 2:51134906-51134928 CGCCCCAGCCACACCAGCCATGG + Intergenic
930521293 2:52470737-52470759 CATCCCAGCCACTCCAGCCATGG + Intergenic
931041409 2:58305100-58305122 CATCCCAGCCACTCCAGCCATGG + Intergenic
932028515 2:68159308-68159330 CATGCCACTCACTCCAGCCTGGG - Intronic
932477111 2:72013226-72013248 CAGCTCACCCACACCACCCTTGG + Intergenic
933247045 2:79987160-79987182 CTGGCCCCTCACCCCAGCCAGGG + Intronic
934054970 2:88243889-88243911 CATCCCAGCCACTCCAGCCATGG + Intergenic
934745744 2:96758527-96758549 CACGCCACTCACTCCAGCCTGGG - Intergenic
935047613 2:99496558-99496580 CATGCCACTCACTCCAGCCTAGG - Intergenic
935062889 2:99623525-99623547 AACCTCACTCACCCCAGCCAGGG - Intronic
935218923 2:100995452-100995474 CCACCTACTCACAACAGCCAGGG + Exonic
936811422 2:116407564-116407586 CATCCCAGTCACTCCAGCCATGG + Intergenic
936994412 2:118398375-118398397 CATCCCAGCCACTCCAGCCATGG + Intergenic
937122449 2:119450313-119450335 CAGCCCTCTGAAACCAGCCCTGG + Intronic
937931415 2:127208286-127208308 GAACCCACTCCCCCCAGCCAAGG + Intronic
938488123 2:131735879-131735901 CACCCCACTCACCCAAACCAGGG - Intronic
938500118 2:131827951-131827973 CAGGAAACCCACACCAGCCATGG + Intergenic
939559304 2:143714295-143714317 CATCCCAGCCACTCCAGCCATGG - Intronic
940790797 2:158027922-158027944 CATCCCAGTCACTCCAGCCGTGG - Intronic
941356542 2:164500140-164500162 CCGTCCCCTCACTCCAGCCAGGG + Intronic
942367108 2:175239359-175239381 CATCCCAGCCACTCCAGCCATGG - Intergenic
942725436 2:179001860-179001882 CACACCACTCACTCCAGCCTGGG - Intronic
943417766 2:187630329-187630351 CATCCCAGCCACTCCAGCCATGG + Intergenic
943491342 2:188559233-188559255 CATCCCAGTTACTCCAGCCATGG + Intronic
945089777 2:206168079-206168101 CATCCCAGCCACTCCAGCCATGG - Intergenic
946173138 2:217907149-217907171 CAGCCTTCTCACACCTGCCCAGG + Intronic
946374141 2:219298002-219298024 CAGCCCAGCCACACCTGCCAGGG + Exonic
947100690 2:226618167-226618189 CAGCACACTCACACAAGCACAGG + Intergenic
947676328 2:231984341-231984363 CACGCCACTCACTCCAGCCTGGG - Intronic
947812106 2:233011077-233011099 CAGCCCTCTCACCCCAACAACGG - Intronic
948044941 2:234936369-234936391 CATCCCACTCACATCTGACATGG + Intergenic
948458097 2:238116609-238116631 CAGACCCCTCACAGCTGCCATGG - Intronic
948865005 2:240770778-240770800 CAGACCACCCACAGCAGCCAAGG - Intronic
948868655 2:240787518-240787540 CAGATGACCCACACCAGCCAGGG - Intronic
948876882 2:240834130-240834152 CAGCCCACAGACACCTGCCCAGG + Intergenic
1168976442 20:1969632-1969654 CAGCCCCCTCACTCCCGCCAAGG + Intergenic
1170365567 20:15594460-15594482 CAGCCCAGTAACCCCACCCAAGG - Intronic
1170589211 20:17758450-17758472 CATCCCCCACACATCAGCCAGGG - Intergenic
1170974591 20:21150272-21150294 CCGCCCTCTCACACCTGCTAAGG + Intronic
1171485981 20:25486569-25486591 CACCCCACACACACCAGTCGAGG + Intronic
1172700751 20:36852313-36852335 CGGGCCACTCACCCCAGCCCCGG + Intronic
1172778121 20:37419957-37419979 CAGCCCACTCGCCCAGGCCAGGG + Intergenic
1172896650 20:38304837-38304859 CAGACCACTCACCCCAGCCCAGG + Intronic
1174229939 20:49038290-49038312 GAGGCCACTCACCCCAGCCTGGG - Intergenic
1174243864 20:49161281-49161303 CACACCACTCACTCCAGCCTAGG + Intronic
1174386046 20:50189295-50189317 CAGCCCACTGACCCCAGCCCTGG - Intergenic
1174395785 20:50246249-50246271 CTGCCCTCTCCCTCCAGCCAGGG + Intergenic
1175484204 20:59333411-59333433 GAGCCAAGTCACCCCAGCCAGGG - Intergenic
1176218315 20:63958515-63958537 CAGCCCACTCCCACCCACCCTGG + Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176958977 21:15138570-15138592 CAGCACACTCAGGACAGCCAGGG - Intergenic
1177171527 21:17661082-17661104 CAGCCCACTCACAGCAGAGGCGG + Intergenic
1177614448 21:23499252-23499274 CATCCCAGCCACTCCAGCCATGG - Intergenic
1179818961 21:43925406-43925428 CTGCTCACACACTCCAGCCAGGG + Exonic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1181965612 22:26654753-26654775 CACGCCACTCACTCCAGCCTGGG - Intergenic
1182577802 22:31284907-31284929 CTGCCCACCCATCCCAGCCAGGG + Intronic
1182650663 22:31848534-31848556 CATCCCAACCACTCCAGCCATGG - Intronic
1184158384 22:42683795-42683817 CAGGCCTCTCAGAGCAGCCAGGG + Intergenic
1184737806 22:46409482-46409504 CAGCCCCAGCACCCCAGCCACGG - Intronic
1185405090 22:50643105-50643127 CAGCTACCTCACACCTGCCACGG - Intergenic
949834687 3:8255068-8255090 CTGCCAACACACAGCAGCCAGGG - Intergenic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
950752808 3:15144259-15144281 CAGCCCACTGCCACCAGCAAAGG - Intergenic
951116536 3:18869761-18869783 CAGCCCTTTCATACCAGTCAGGG - Intergenic
951793987 3:26517764-26517786 CATCCCAGCCACTCCAGCCATGG + Intergenic
952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG + Intergenic
952846390 3:37691139-37691161 CAGCCCACTTCCAGCTGCCAGGG - Intronic
953115711 3:39990223-39990245 GAGTCCACTCCCCCCAGCCAAGG - Intronic
953482047 3:43260156-43260178 CACCTCACTCACACCAGGTAAGG - Intergenic
954019148 3:47723429-47723451 CAGCTCACTGCAACCAGCCAGGG + Intronic
954321138 3:49832773-49832795 CAGCCCACCCAGACCTGGCAGGG + Intronic
954638943 3:52086676-52086698 CAGCACCTTCACACCACCCAAGG + Intronic
955436042 3:58899709-58899731 CAGTCCCCCCACCCCAGCCAAGG - Intronic
956777577 3:72578092-72578114 CTCCCCAATCACAGCAGCCAGGG + Intergenic
957067805 3:75540004-75540026 CAGCCCACTGCCACCAGCAAAGG + Intergenic
957988198 3:87597380-87597402 TATCCCAGCCACACCAGCCATGG - Intergenic
958688083 3:97425478-97425500 CATCCCAGCCACTCCAGCCATGG - Intronic
958922466 3:100122273-100122295 GAGCCCACCCACACCAGAAAGGG - Intronic
959054431 3:101553643-101553665 CATCCCAGCCACTCCAGCCATGG + Intergenic
959172550 3:102860222-102860244 CATTCCAGTCACTCCAGCCATGG - Intergenic
959381068 3:105641802-105641824 CATCCCAGCCACTCCAGCCATGG - Intergenic
959452634 3:106522793-106522815 GGGCCCCCTCCCACCAGCCAAGG + Intergenic
960060205 3:113312709-113312731 AATCCCAGTCACTCCAGCCATGG + Intronic
960626543 3:119686963-119686985 CATCCCAGCCACTCCAGCCATGG - Intergenic
961210714 3:125123329-125123351 CATGCCACTCACTCCAGCCTGGG + Intronic
961285351 3:125797976-125797998 CAGCCCACTGCCACCAGCAAAGG - Intergenic
961360769 3:126365774-126365796 CACCTCATTCACACCAGCCTAGG - Intergenic
961619584 3:128213111-128213133 CCTCCCACTCACCCTAGCCAAGG - Intronic
962687318 3:137860034-137860056 CAGACCACTCAGACCAGTGAAGG - Intergenic
963368450 3:144367731-144367753 CATCCCAGCCACTCCAGCCATGG - Intergenic
964172153 3:153783584-153783606 CAGCCCACTCCTACCAGCCCAGG - Intergenic
964520706 3:157563591-157563613 CATCCCAGGCACTCCAGCCATGG - Intronic
964910752 3:161777158-161777180 CATCCCAGCCACTCCAGCCATGG + Intergenic
967634409 3:191784387-191784409 CATCCCAGCCACTCCAGCCATGG - Intergenic
968211543 3:196852915-196852937 CATGCCACTCACTCCAGCCTGGG + Intergenic
968335689 3:197911681-197911703 CATGCCACTCACTCCAGCCTGGG - Intronic
968466033 4:751795-751817 CAGCCAACTCAGAGCAGCCGAGG + Intronic
968483184 4:845890-845912 CCGCCCACACCCGCCAGCCACGG + Intergenic
969266416 4:6066906-6066928 CACCCCACACACACCTGCCATGG + Intronic
969741708 4:9033157-9033179 CAGCCCACTGCCACCAGCAAAGG - Intergenic
969801075 4:9566054-9566076 CAGCCCACTGCCACCAGCAAAGG - Intergenic
970217263 4:13773024-13773046 CATGCCACTCACTCCAGCCTAGG - Intergenic
970615277 4:17763051-17763073 CATCCCATTGACAGCAGCCAGGG - Intronic
970987665 4:22176887-22176909 CATCCCAGCCACTCCAGCCATGG - Intergenic
971753293 4:30678237-30678259 CATCCCAGCCACTCCAGCCATGG + Intergenic
971914632 4:32851708-32851730 CAACCTACTGACACCAGCCAGGG - Intergenic
973779738 4:54277115-54277137 CAGCGCGCTCACACCAGGGAGGG + Intronic
974322487 4:60369308-60369330 CATCCCAGCCACTCCAGCCATGG + Intergenic
975121229 4:70730698-70730720 CACCGCACTCACTCCAGCCTGGG + Intronic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
976689682 4:87855716-87855738 AACCCCACCCACACAAGCCAAGG + Intergenic
978939046 4:114415412-114415434 CATCCCAGCCACTCCAGCCATGG + Intergenic
979251692 4:118572859-118572881 CAGACCACTCACCTAAGCCAGGG + Intergenic
979323363 4:119350565-119350587 CACACCACTCACTCCAGCCTGGG - Intergenic
979391928 4:120138288-120138310 CATCCCAGCCACTCCAGCCATGG - Intergenic
979923029 4:126524870-126524892 CATCCCAGCCACTCCAGCCATGG - Intergenic
980006832 4:127552290-127552312 CATCCCAGCCACTCCAGCCATGG + Intergenic
980256948 4:130393856-130393878 CAGCCAAGTCATAACAGCCAAGG + Intergenic
981157990 4:141462564-141462586 CAGGTGACTCACATCAGCCAAGG + Intergenic
981631770 4:146827146-146827168 GAGCCCCCTCCCTCCAGCCAAGG - Intronic
981643015 4:146967143-146967165 CATCCCAGCCACTCCAGCCATGG + Intergenic
981821017 4:148887715-148887737 CAGTCCAGTCACACAGGCCATGG + Intergenic
982072167 4:151705129-151705151 CAGCCCTCTCGCACCACCCCCGG + Intronic
982098648 4:151946946-151946968 CATCCCAGGCACTCCAGCCATGG + Intergenic
982966343 4:161913379-161913401 CGTCCCAGTCACTCCAGCCATGG + Intronic
983337525 4:166415958-166415980 CTTCCCAGTCACTCCAGCCATGG - Intergenic
983821087 4:172193817-172193839 CGGGCCACTCACTCCAGCCTGGG + Intronic
984016352 4:174431568-174431590 CCACCCACTCACTCCAGCCTGGG + Intergenic
985159935 4:187034043-187034065 CATCCCAGGCACTCCAGCCATGG + Intergenic
985236888 4:187884987-187885009 CTGCCCACTCCCCCCAGCCATGG + Intergenic
985390803 4:189490558-189490580 CAGCCCACCCACACCACCGAGGG - Intergenic
985390812 4:189490588-189490610 CAGCCCACCCACACCACCGAGGG - Intergenic
985390825 4:189490648-189490670 CAGCCCACCTACACCAGTGAGGG - Intergenic
985390833 4:189490678-189490700 CAGCCCACCTACACCACCGAGGG - Intergenic
985390841 4:189490708-189490730 CAGCCCACCCACACCGGTGAGGG - Intergenic
985390856 4:189490768-189490790 CAGCCCACCTACACCAGTGAGGG - Intergenic
985390864 4:189490798-189490820 CAGCCCACCTACACCACCGAGGG - Intergenic
985390872 4:189490828-189490850 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390881 4:189490858-189490880 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390889 4:189490888-189490910 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390898 4:189490918-189490940 CAGCCCACCCACACCACCGAGGG - Intergenic
985390905 4:189490948-189490970 CAGCTCACCCACACCACCGAGGG - Intergenic
985390913 4:189490978-189491000 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390928 4:189491038-189491060 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390944 4:189491098-189491120 CAGCCCACCCACACCATCGAGGG - Intergenic
985390958 4:189491158-189491180 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390974 4:189491218-189491240 CAGCCCACCCACACCATCGAGGG - Intergenic
985390982 4:189491248-189491270 CAGCCCACCCACACCAGTGAGGG - Intergenic
985390991 4:189491278-189491300 CAGCCCACCCACACCACCGAGGG - Intergenic
985390999 4:189491308-189491330 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391014 4:189491368-189491390 CAGCCCACCTACACCAGTGAGGG - Intergenic
985391021 4:189491398-189491420 CAGCCCACCTACACCAGTGAGGG - Intergenic
985391029 4:189491428-189491450 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391038 4:189491458-189491480 CAGCCCACCCACACCACCGAGGG - Intergenic
985391046 4:189491488-189491510 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391055 4:189491518-189491540 CAGCCCACCCACACCACCGAGGG - Intergenic
985391063 4:189491548-189491570 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391072 4:189491578-189491600 CAGCCCACCCACACCACCGAGGG - Intergenic
985391080 4:189491608-189491630 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391089 4:189491638-189491660 CAGCCCACCCACACCACCGAGGG - Intergenic
985391096 4:189491668-189491690 CAGCCCACCTACACCAGTGAGGG - Intergenic
985391111 4:189491728-189491750 CAGCCCACCTACACCAGTGAGGG - Intergenic
985391118 4:189491758-189491780 CAGCCCACCTACACCAGTGAGGG - Intergenic
985391126 4:189491788-189491810 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391135 4:189491818-189491840 CAGCCCACCCACACCACCGAGGG - Intergenic
985391143 4:189491848-189491870 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391152 4:189491878-189491900 CAGCCCACCCACACCACCGAGGG - Intergenic
985391160 4:189491908-189491930 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391168 4:189491938-189491960 CAGCCCACCCACACCAGTGAGGG - Intergenic
985391177 4:189491968-189491990 CAGCCCACCCACACCACCGAGGG - Intergenic
985522127 5:379047-379069 CAGCCCCCTGCCCCCAGCCACGG + Intronic
985558801 5:571078-571100 CACCCCACCCCCACCAGCCTTGG - Intergenic
985772758 5:1823509-1823531 CACCCCACCCACGCCAGCAAAGG - Intergenic
986196350 5:5539756-5539778 CAACCCACTCACACCCCACAGGG - Intergenic
987464194 5:18252810-18252832 CATCCCAACCACCCCAGCCATGG + Intergenic
988160123 5:27508739-27508761 CGTGCCACTCACTCCAGCCAGGG - Intergenic
988379442 5:30481215-30481237 CATCCCAGCCACTCCAGCCATGG - Intergenic
988604611 5:32668713-32668735 CAGCTCACTCCCACCCGCCATGG + Intergenic
990432033 5:55745464-55745486 CACACCACTCACTCCAGCCTGGG - Intronic
991002500 5:61796448-61796470 CAGCTGACTCACCTCAGCCATGG + Intergenic
991724869 5:69526142-69526164 CAGCCCACTCACTCCCACCCTGG + Intronic
993888915 5:93448795-93448817 AAGCCCACCCACACCAGGGAGGG + Intergenic
995061136 5:107812906-107812928 ATGCCCACTGAAACCAGCCAGGG + Intergenic
999395297 5:151223328-151223350 CAGCCCACACTCACCAGCTCTGG + Intronic
999430505 5:151521544-151521566 GAGCACATCCACACCAGCCACGG + Exonic
999919750 5:156305313-156305335 CATCCCAGTCACTCCAGCCATGG + Intronic
1000110010 5:158099344-158099366 CACCACACTCACACCAAGCATGG - Intergenic
1001840580 5:174873075-174873097 CAGCCCACACCCACCAGCGAAGG - Intergenic
1002190656 5:177475761-177475783 CCACCCACTCCCACCAGTCAGGG - Intergenic
1002419347 5:179137618-179137640 CAGGGCAGCCACACCAGCCAGGG + Intronic
1002819739 6:713595-713617 CATCCCACTAACATCAGCCTTGG + Intergenic
1003026133 6:2557289-2557311 CAGCCCCCTCCCACCAGGCAAGG - Intergenic
1005993332 6:30916949-30916971 CAGAACACTCACAACATCCATGG - Exonic
1006303379 6:33205674-33205696 CAGCCCAATCACTCCAGCCTTGG - Exonic
1006429381 6:33985672-33985694 CCGCCCATTCACACCAGCCCAGG + Intergenic
1006911833 6:37568243-37568265 CAGCCCACTAACTTCAGACAAGG + Intergenic
1007611151 6:43149940-43149962 CAGCCCACTCACACCCAATATGG - Intronic
1009726047 6:67537201-67537223 CATCCCAGTCACTCTAGCCAGGG + Intergenic
1012075029 6:94672550-94672572 CAGTCTCCTCCCACCAGCCATGG - Intergenic
1013266848 6:108508354-108508376 CAAGCCACTCACCTCAGCCATGG - Intronic
1015136942 6:129882890-129882912 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1017109173 6:150916343-150916365 CACACCACTCACTCCAGCCTGGG - Intronic
1018058445 6:160071454-160071476 CCTCCCACTGGCACCAGCCAAGG - Intronic
1018400223 6:163414324-163414346 CAGCCCACACCCACCCGCCCCGG + Intronic
1018446868 6:163866342-163866364 CAGCCCACACCCCACAGCCACGG - Intergenic
1019477326 7:1250143-1250165 CTGCCCCCTCACCCCTGCCACGG - Intergenic
1019569492 7:1704215-1704237 CAGCCCACTCACAGCTGGCAGGG - Intronic
1019684834 7:2375651-2375673 CCTGCCACTAACACCAGCCAAGG - Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1021529835 7:21632147-21632169 CATCCCAGCCACTCCAGCCATGG - Intronic
1023869972 7:44257904-44257926 CTGCACGCTCACAGCAGCCATGG + Intronic
1024049028 7:45606310-45606332 AACCCCACCCACACCAGCAAAGG - Intronic
1024099409 7:46015323-46015345 GAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1024213678 7:47228615-47228637 CTGCCCTCTCTCACCAACCATGG + Intergenic
1024383548 7:48725601-48725623 CATCCCAGCCACTCCAGCCATGG - Intergenic
1024588532 7:50861281-50861303 CAGCCCACTCACACCTCTCTGGG + Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1029041372 7:97580011-97580033 GAGCCCCCACACCCCAGCCAAGG + Intergenic
1029047453 7:97645251-97645273 CATCCCAGCCACTCCAGCCATGG + Intergenic
1030144709 7:106341431-106341453 CATCCCAGCCACTCCAGCCATGG - Intergenic
1030868744 7:114731373-114731395 CATCCCAGCCACTCCAGCCATGG + Intergenic
1031287299 7:119886111-119886133 CATCCCAGCCACTCCAGCCATGG - Intergenic
1032077151 7:128841373-128841395 CAGCTCACACACACCTGCCCCGG + Intronic
1034571227 7:151958299-151958321 TGGCACACTCAGACCAGCCATGG - Intronic
1036246908 8:7125754-7125776 CAGCCAACTGCCACCAGCAAAGG - Intergenic
1036253899 8:7188656-7188678 CAGCCCACTACCACCAGCAAAGG + Intergenic
1036363594 8:8098823-8098845 CAGCCCACTACCACCAGCAAAGG - Intergenic
1037042720 8:14257302-14257324 CACTCCACTCACTCCAGCCTGGG + Intronic
1037578059 8:20226458-20226480 CACGCCACTCACTCCAGCCTGGG - Intronic
1037681422 8:21100861-21100883 CAGCCCTGTCACAGCAGCCATGG + Intergenic
1038240675 8:25805505-25805527 CACCCCACTCTCATCAGACATGG + Intergenic
1038537184 8:28361659-28361681 CAGCACACACACATCAACCACGG + Intronic
1038935142 8:32241793-32241815 CTGCACACTCACTCCAGCCTAGG - Intronic
1039908347 8:41803345-41803367 CACTGCACTCAGACCAGCCAGGG - Intronic
1039911045 8:41827313-41827335 CATCTCATTCACACCAGCAAGGG - Intronic
1040009696 8:42651053-42651075 CACACCACTCACTCCAGCCTGGG + Intergenic
1040286522 8:46103315-46103337 CAGCCCACTCAGTGCAGCCCTGG + Intergenic
1040299802 8:46182042-46182064 CAGCCCACTCCAAACAGCCCAGG + Intergenic
1040302469 8:46195126-46195148 CAGCCCACTCAGAACAGTCCTGG - Intergenic
1040966040 8:53082104-53082126 CATCCCATCCACTCCAGCCATGG + Intergenic
1042137044 8:65642815-65642837 GAGACCACGCACACCAGCCTGGG - Intergenic
1042317126 8:67436070-67436092 CACCCCACCCCCACCAACCAGGG + Intronic
1043182317 8:77101262-77101284 GAGCACACTCAGACCATCCATGG - Intergenic
1046207124 8:111015277-111015299 CATCCCAGCCACTCCAGCCATGG + Intergenic
1047153801 8:122294721-122294743 CATCCCAGCCACTCCAGCCATGG - Intergenic
1047356745 8:124129382-124129404 CTGCCCACTCTCACCAGACAAGG + Intergenic
1047410866 8:124623674-124623696 CTGCACACTCACTCCAGCCTGGG - Intronic
1047964864 8:130039082-130039104 TACCCCACGCTCACCAGCCAGGG - Intergenic
1048669061 8:136695950-136695972 CATCCCAGCCACTCCAGCCATGG + Intergenic
1048729213 8:137418943-137418965 CAACCCAGCCACTCCAGCCATGG - Intergenic
1048782448 8:138017101-138017123 CATCCCAGCCACTCCAGCCATGG + Intergenic
1049176181 8:141194024-141194046 CTGCCCACCCAGACCTGCCAGGG - Exonic
1049448927 8:142648446-142648468 CATCCCAGCCACTCCAGCCATGG + Intergenic
1049562497 8:143318707-143318729 CAGCCCTCCCTCACCAGACACGG + Intronic
1052767974 9:32660726-32660748 CATCCCAGCCACTCCAGCCATGG - Intergenic
1056013537 9:82357619-82357641 CAGCCACCTCACTCCAGCCTGGG + Intergenic
1056595130 9:88001867-88001889 CATCCCAGTCACCCCAGCCATGG + Intergenic
1056702056 9:88918947-88918969 CATCTCACTCACTCCAGCCATGG - Intergenic
1056741446 9:89259298-89259320 CAAGCCACTCACTCCAGCCTGGG - Intergenic
1056756641 9:89385868-89385890 CCGCCCACCCACCCCTGCCAAGG + Intronic
1057170825 9:92962109-92962131 CCTCCCACTCACCCCAACCAGGG + Intronic
1057212875 9:93210110-93210132 CAGATCAGCCACACCAGCCATGG - Intronic
1057500889 9:95596001-95596023 GAGCCCACTCAGACCAGCGCGGG + Intergenic
1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG + Intergenic
1059988175 9:119839923-119839945 CAGCCTCCCCGCACCAGCCATGG - Intergenic
1060662188 9:125410999-125411021 CAGCCCCCTGCCTCCAGCCAGGG + Intergenic
1060764236 9:126281941-126281963 CAGGCCACTTACAACACCCAAGG + Intergenic
1061413389 9:130432822-130432844 CACGCCACTCACAGCGGCCACGG + Intronic
1061495666 9:130973016-130973038 GAGCCCACCCCCAGCAGCCAGGG + Intergenic
1062038623 9:134393874-134393896 CAGCCCACTCATACAGCCCAGGG - Intronic
1062157915 9:135064001-135064023 CATCCCAGCCACTCCAGCCATGG - Intergenic
1062429127 9:136519210-136519232 CGGCCCACACAGACCAACCAGGG + Intronic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1186873038 X:13791251-13791273 CACACCACTCACTCCAGCCTGGG - Intronic
1186888378 X:13937751-13937773 CAGCCGCCTTACACCAGCCTCGG + Intronic
1187550275 X:20295863-20295885 CTGCCCCCTAACACCAGCCATGG + Intergenic
1188149947 X:26660756-26660778 AAGCCCACTCACATCAGGGAGGG - Intergenic
1188624308 X:32265213-32265235 CATCCCAGCCACTCCAGCCATGG + Intronic
1188804519 X:34570591-34570613 CATCCCAGCCACTCCAGCCATGG - Intergenic
1189571791 X:42306382-42306404 AAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1190428444 X:50354466-50354488 CATGCCACTCACTCCAGCCTGGG + Intergenic
1191255933 X:58279646-58279668 CAGCCCCCGCACCCCACCCAGGG - Intergenic
1192008510 X:67242582-67242604 CATCCCAGCCACTCCAGCCATGG + Intergenic
1192363754 X:70454884-70454906 CCGCCCATTCGCCCCAGCCAAGG - Intronic
1192522460 X:71814656-71814678 CCGCAGACTCACCCCAGCCATGG + Intergenic
1192801163 X:74465956-74465978 CAGCCCTCTCCCACCAGATAAGG - Intronic
1193153422 X:78148050-78148072 CATCCCAGCCACTCCAGCCATGG + Intergenic
1193221248 X:78929204-78929226 CATCCCAGTCACTCCAGTCATGG - Intergenic
1193918733 X:87400067-87400089 CATCCCAGCCACTCCAGCCATGG + Intergenic
1194364391 X:92996265-92996287 CATCCCAGCCACTCCAGCCATGG + Intergenic
1195045341 X:101050324-101050346 CAGCACACTCATACTAGTCAAGG + Intronic
1195906852 X:109852500-109852522 CAGGCCACGCACTCCAGCCTGGG + Intergenic
1195941227 X:110169513-110169535 CATCCCCTGCACACCAGCCAGGG + Intronic
1196579373 X:117361417-117361439 CATCCCAACCACTCCAGCCATGG + Intergenic
1197856610 X:130919726-130919748 CATCCCAGCCACTCCAGCCATGG - Intergenic
1200212815 X:154354448-154354470 CAGCCCATTGACACCCACCAGGG + Exonic
1200672622 Y:6112530-6112552 CATCCCAGCCACTCCAGCCATGG + Intergenic
1200686564 Y:6264494-6264516 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200992112 Y:9355743-9355765 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200994764 Y:9376021-9376043 CAGCCGCCTCACACCACCCCCGG - Intronic
1200997428 Y:9396367-9396389 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200999940 Y:9464903-9464925 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201002601 Y:9485213-9485235 CAGCCGCCTCACACCACCCCCGG - Intronic
1201005256 Y:9505497-9505519 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201007917 Y:9525826-9525848 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201010534 Y:9546017-9546039 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201224132 Y:11800375-11800397 CACACCACTCACTCCAGCCTGGG + Intergenic