ID: 904571290

View in Genome Browser
Species Human (GRCh38)
Location 1:31467742-31467764
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904571290_904571293 -3 Left 904571290 1:31467742-31467764 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 904571293 1:31467762-31467784 GGTCTGGTCAGACCTTTGTATGG 0: 40
1: 82
2: 96
3: 77
4: 128
904571290_904571295 28 Left 904571290 1:31467742-31467764 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 904571295 1:31467793-31467815 TAAGATTTAGATCCCCTGTTAGG 0: 100
1: 103
2: 66
3: 42
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904571290 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr