ID: 904571732

View in Genome Browser
Species Human (GRCh38)
Location 1:31471117-31471139
Sequence CTCTGTGCACAGACCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904571732_904571737 3 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571737 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data
904571732_904571740 25 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571740 1:31471165-31471187 GATCCTTTCCCCTGGGTCGCCGG No data
904571732_904571742 29 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571742 1:31471169-31471191 CTTTCCCCTGGGTCGCCGGCTGG No data
904571732_904571738 17 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571738 1:31471157-31471179 TGTGTGAGGATCCTTTCCCCTGG No data
904571732_904571739 18 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571739 1:31471158-31471180 GTGTGAGGATCCTTTCCCCTGGG No data
904571732_904571735 -6 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904571732 Original CRISPR CTCTGTGCACAGACCGAGGA AGG (reversed) Intergenic
No off target data available for this crispr