ID: 904571735

View in Genome Browser
Species Human (GRCh38)
Location 1:31471134-31471156
Sequence ACAGAGTTGCCTGGTCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904571731_904571735 4 Left 904571731 1:31471107-31471129 CCAGGCGTTTCCTTCCTCGGTCT No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data
904571733_904571735 -10 Left 904571733 1:31471121-31471143 CCTCGGTCTGTGCACAGAGTTGC No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data
904571727_904571735 27 Left 904571727 1:31471084-31471106 CCAAGGAAATACTTTGCTGGCTC No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data
904571725_904571735 30 Left 904571725 1:31471081-31471103 CCACCAAGGAAATACTTTGCTGG No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data
904571730_904571735 5 Left 904571730 1:31471106-31471128 CCCAGGCGTTTCCTTCCTCGGTC No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data
904571732_904571735 -6 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571735 1:31471134-31471156 ACAGAGTTGCCTGGTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904571735 Original CRISPR ACAGAGTTGCCTGGTCACTG TGG Intergenic
No off target data available for this crispr