ID: 904571737

View in Genome Browser
Species Human (GRCh38)
Location 1:31471143-31471165
Sequence CCTGGTCACTGTGGTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904571733_904571737 -1 Left 904571733 1:31471121-31471143 CCTCGGTCTGTGCACAGAGTTGC No data
Right 904571737 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data
904571731_904571737 13 Left 904571731 1:31471107-31471129 CCAGGCGTTTCCTTCCTCGGTCT No data
Right 904571737 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data
904571730_904571737 14 Left 904571730 1:31471106-31471128 CCCAGGCGTTTCCTTCCTCGGTC No data
Right 904571737 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data
904571732_904571737 3 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571737 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904571737 Original CRISPR CCTGGTCACTGTGGTGTGTG AGG Intergenic
No off target data available for this crispr