ID: 904571740

View in Genome Browser
Species Human (GRCh38)
Location 1:31471165-31471187
Sequence GATCCTTTCCCCTGGGTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904571733_904571740 21 Left 904571733 1:31471121-31471143 CCTCGGTCTGTGCACAGAGTTGC No data
Right 904571740 1:31471165-31471187 GATCCTTTCCCCTGGGTCGCCGG No data
904571736_904571740 -1 Left 904571736 1:31471143-31471165 CCTGGTCACTGTGGTGTGTGAGG No data
Right 904571740 1:31471165-31471187 GATCCTTTCCCCTGGGTCGCCGG No data
904571732_904571740 25 Left 904571732 1:31471117-31471139 CCTTCCTCGGTCTGTGCACAGAG No data
Right 904571740 1:31471165-31471187 GATCCTTTCCCCTGGGTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904571740 Original CRISPR GATCCTTTCCCCTGGGTCGC CGG Intergenic
No off target data available for this crispr