ID: 904575107

View in Genome Browser
Species Human (GRCh38)
Location 1:31500379-31500401
Sequence CCAGAAAAATGTACCTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 201}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904575107_904575120 25 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575120 1:31500427-31500449 AGGGTGGCCGAGGTTTAGAGGGG No data
904575107_904575111 -10 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575111 1:31500392-31500414 ATTTTTCTGGCTGGGAGATTTGG No data
904575107_904575119 24 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575119 1:31500426-31500448 CAGGGTGGCCGAGGTTTAGAGGG No data
904575107_904575115 9 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575115 1:31500411-31500433 TTGGGCTGAGCAGTCCAGGGTGG No data
904575107_904575116 15 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575116 1:31500417-31500439 TGAGCAGTCCAGGGTGGCCGAGG No data
904575107_904575114 6 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575114 1:31500408-31500430 GATTTGGGCTGAGCAGTCCAGGG No data
904575107_904575118 23 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575118 1:31500425-31500447 CCAGGGTGGCCGAGGTTTAGAGG No data
904575107_904575112 -9 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575112 1:31500393-31500415 TTTTTCTGGCTGGGAGATTTGGG No data
904575107_904575113 5 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575113 1:31500407-31500429 AGATTTGGGCTGAGCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904575107 Original CRISPR CCAGAAAAATGTACCTTCCT AGG (reversed) Intergenic
901077225 1:6562800-6562822 CAAGAAAAATGTACCTTGGCTGG + Intronic
902172189 1:14621046-14621068 CCAGGAAAATGTCCCCTCCTTGG - Intronic
903059567 1:20660699-20660721 TTAGAAAGATGTACCCTCCTAGG + Intronic
903476197 1:23620593-23620615 CCAGGAAAATGTTCCTGCCCAGG + Intronic
904006924 1:27367862-27367884 GAAGAAAAAGGTACCTTCCTTGG + Intergenic
904575107 1:31500379-31500401 CCAGAAAAATGTACCTTCCTAGG - Intergenic
908632966 1:66130622-66130644 CCAGAATCATGGTCCTTCCTGGG + Intronic
908667442 1:66509318-66509340 CTAAAAATATGTACATTCCTGGG - Intergenic
908778858 1:67669754-67669776 ACAGAAAAATGTACCTTTAGAGG - Intergenic
909333284 1:74441106-74441128 GCAGTAAAATTTACCTTTCTAGG + Intronic
910722889 1:90306914-90306936 CCATAAAAATGCAGATTCCTGGG - Intergenic
911462342 1:98206523-98206545 CCAGATTCATATACCTTCCTTGG + Intergenic
911512271 1:98821657-98821679 CCACAAATATGGAGCTTCCTTGG + Intergenic
912267170 1:108169782-108169804 CTAGAAAAATATAACTTACTGGG - Intronic
917058327 1:171008008-171008030 CCAAACAAAAGTACCTTGCTGGG - Intronic
917544383 1:175948153-175948175 CCAGAGAAATGTTTTTTCCTTGG - Intronic
918303849 1:183228257-183228279 CCAGAGAAATGTGCTTCCCTAGG - Intronic
919389451 1:196963876-196963898 TCAGAAGAATGTAACTTGCTAGG - Intergenic
919741499 1:200983888-200983910 CCACAGAAATGCCCCTTCCTGGG - Intronic
920208817 1:204313408-204313430 CCAGAAACATGCACATTCCTGGG + Intronic
921631063 1:217434426-217434448 CCAGAAAAAACTACATACCTTGG - Intronic
921919558 1:220651406-220651428 AAAGAAAAATGTATCTTCTTTGG + Intronic
923283098 1:232463594-232463616 CCACAAAAATGTACTTTCCCTGG - Intronic
1063800706 10:9574095-9574117 ACAAAAAAATATACCTTCCTGGG - Intergenic
1065440233 10:25746041-25746063 CCAGAAAATTCTAACTTCTTTGG - Intergenic
1066442232 10:35449682-35449704 CCCTAAAAAGGTACCTCCCTGGG - Intronic
1069118339 10:64536127-64536149 CCAGAAAGAAGCAACTTCCTGGG - Intergenic
1069386652 10:67889177-67889199 CCAGAAAAATGTTTCCTACTTGG - Intronic
1070235981 10:74626867-74626889 ACAGAAATATGAACCTTGCTAGG - Intronic
1070410703 10:76137295-76137317 CCATATAAATATATCTTCCTTGG - Intronic
1070522621 10:77267567-77267589 CAAGAAAAATCTTCCTGCCTTGG - Intronic
1070705637 10:78635949-78635971 CAAGAAAAATGTGGTTTCCTTGG - Intergenic
1071812525 10:89199043-89199065 CCAGAAAAAAGTCCCAACCTTGG + Intergenic
1071849706 10:89556560-89556582 CCAGGAAAAAGTTCCTGCCTTGG - Intronic
1073138690 10:101233829-101233851 CCAGAAAAATGTGCCCACCTGGG - Intergenic
1074276709 10:112009512-112009534 GCAAAAACATGTACCTTTCTTGG - Intergenic
1076361790 10:129894711-129894733 CCAGAAAACTGCATCTGCCTGGG + Intronic
1076614063 10:131744784-131744806 CCCCAAAAATGTATCTTCCTGGG - Intergenic
1078991841 11:16655813-16655835 CCAGAAAAAAGTTCTTTACTAGG - Intronic
1079072867 11:17363308-17363330 CCAGAAAAATTTTCCTTCAAAGG - Intronic
1080292307 11:30684650-30684672 CCAGAAACATCTGCCTTCATGGG + Intergenic
1080390022 11:31836359-31836381 CAAGAAAAATGAATCTTTCTAGG + Intronic
1080655379 11:34253829-34253851 CCAGAGAAAGATCCCTTCCTTGG - Intronic
1080996938 11:37615013-37615035 CCAGAAAAATATACATACATGGG - Intergenic
1081147388 11:39580039-39580061 CAAGAAACATGTATATTCCTGGG + Intergenic
1083160376 11:60850601-60850623 CCAGAAGAATGTACAGTTCTTGG - Exonic
1086327897 11:85723276-85723298 CCAGAGAAATGTACCTGGCCAGG + Intronic
1087846907 11:102983823-102983845 TCAAAAAAATGTAGCTTCATGGG - Intergenic
1087867556 11:103249916-103249938 CAAGAAAAATGTACTTTTCCTGG - Intronic
1089014286 11:115154002-115154024 CCAGAAACACGGTCCTTCCTCGG + Intergenic
1089367292 11:117928817-117928839 CCAGAAAACTGTGACTTTCTGGG - Intronic
1089802202 11:121042235-121042257 AAAGAACAATGTAACTTCCTTGG + Intronic
1091152864 11:133344856-133344878 TGAAAATAATGTACCTTCCTGGG + Intronic
1091917063 12:4277239-4277261 CCAGAAGAAAGCACCTTTCTAGG - Intronic
1092148563 12:6231649-6231671 CCAGAACAATGCAAATTCCTGGG - Intronic
1092478357 12:8838089-8838111 CTGGAAAATTGTACCTTACTGGG - Intronic
1092538583 12:9406355-9406377 CCAGCAGAAGGTACCTTACTTGG + Intergenic
1092633933 12:10419030-10419052 AAATAAAAATGTACCTTTCTGGG + Exonic
1093152560 12:15640095-15640117 CCATAAGAATGGACCTTCATGGG + Intronic
1093408180 12:18831914-18831936 CAACACAAATGTCCCTTCCTTGG - Intergenic
1094419653 12:30257286-30257308 ACACAAAAATGCACCTTCCTAGG + Intergenic
1094790336 12:33905537-33905559 ACAGAAAAAAGTAACTTCTTGGG + Intergenic
1095541900 12:43319810-43319832 CCACAAAAATCTGCCTTACTGGG - Intergenic
1096182134 12:49556894-49556916 CCAGGCAAATGGACATTCCTAGG - Intronic
1097787492 12:63777799-63777821 AAAGAAAAATGTATCTTCTTAGG + Intergenic
1099044126 12:77694793-77694815 CCAGGCAAATCTACCTTTCTAGG + Intergenic
1099885371 12:88523558-88523580 TCAGAGAAATTTACCTTCATTGG - Intronic
1100885760 12:99068173-99068195 CCAGGAATATGTAATTTCCTTGG + Intronic
1102710730 12:114924219-114924241 CCATAAAAATGAACATTTCTTGG - Intergenic
1106982414 13:35303486-35303508 CCAGAAAACTGTAAACTCCTTGG - Intronic
1110385961 13:74911229-74911251 CAAGGAAAATGTACCTTCAAGGG + Intergenic
1110683158 13:78340214-78340236 ACAGTAAAATATGCCTTCCTTGG + Intergenic
1113299209 13:108998277-108998299 CCAGAAAAATGAATCCTACTAGG - Intronic
1117189355 14:53275452-53275474 CCAGAAGAAGGTCCCTTCCCTGG + Intergenic
1118044285 14:61949837-61949859 CCAGAAAAGTGTGCCTCCTTAGG - Intergenic
1121325998 14:93019912-93019934 CCAGAAAAAAGAACATTCCCAGG + Intronic
1125370359 15:38969392-38969414 CAAGAAAAAAATATCTTCCTTGG - Intergenic
1127215891 15:56822767-56822789 CCAGAAAAATCAACCTTCAGTGG - Intronic
1127821515 15:62660542-62660564 CCAATAAAATGTCCCTTCTTAGG - Intronic
1127830771 15:62749144-62749166 CCAGAAAATGGAACGTTCCTTGG - Intronic
1127892755 15:63269730-63269752 CCCGAGAAATGTTCTTTCCTTGG + Intergenic
1128759228 15:70204125-70204147 CCAGAAACACTTCCCTTCCTGGG + Intergenic
1129447213 15:75626899-75626921 CCAGAAAAATTGGCCTTCCAGGG - Intergenic
1131184407 15:90262835-90262857 ACAGCAAAAGGAACCTTCCTGGG + Intronic
1131506632 15:93025450-93025472 CCAGAGAAACCTACCTTCCCTGG - Exonic
1132082366 15:98877761-98877783 GCAAAAAAATCTACCTCCCTAGG + Intronic
1133541839 16:6763413-6763435 CCAGCAAACTGTATCTTCATGGG + Intronic
1137049521 16:35695769-35695791 GCTGAGAAATGTTCCTTCCTGGG - Intergenic
1138567181 16:57841952-57841974 CCTTAAAAATGTCACTTCCTCGG + Intronic
1140391585 16:74591729-74591751 CCAGAGAAATGTTCCAACCTGGG + Intronic
1140761504 16:78113172-78113194 CAATAAAAATGTACATTCCCAGG + Intronic
1141471188 16:84239738-84239760 CCAGAAACCTGTCCCTTCCCTGG - Intronic
1143066769 17:4255740-4255762 CCAGAAAATACTATCTTCCTTGG + Intronic
1146100566 17:29977311-29977333 ACAGTAAAATTTACCTTCTTTGG - Intronic
1146800800 17:35819384-35819406 CTAAATAAATGTACCCTCCTGGG - Intronic
1153060264 18:987562-987584 GCAGAACAATTTACATTCCTTGG + Intergenic
1156113458 18:33756901-33756923 CCATTCAAATGTACCTTTCTGGG + Intergenic
1156759191 18:40566887-40566909 CCAGAGTAATGTACCTTCATTGG - Intergenic
1157879169 18:51303920-51303942 TCACAAAAATGTACCTTCATAGG + Intergenic
1157932402 18:51837730-51837752 CCAGAAAAGGCTGCCTTCCTAGG + Intergenic
1161902053 19:7126265-7126287 CCAGCAAAATGTAGCTACATGGG + Intronic
1162855063 19:13461786-13461808 CCAGAAAAATCAGCCATCCTAGG + Intronic
1164492923 19:28730905-28730927 CCAGAAAAACTTCACTTCCTGGG + Intergenic
1164937157 19:32223851-32223873 CCAGAAGAAAGTTCCTGCCTAGG + Intergenic
1166815685 19:45543946-45543968 CCAGCAACAGGAACCTTCCTGGG - Intronic
925110529 2:1331846-1331868 TCAGAAAAATGCACACTCCTGGG + Intronic
925899122 2:8495896-8495918 CCAGCTGAATGTGCCTTCCTGGG + Intergenic
927026446 2:19073541-19073563 CCAGAAACAGATACCTCCCTGGG + Intergenic
927269094 2:21186787-21186809 CCAGAAAGAAGTAACTTCCAAGG - Intergenic
927302514 2:21531934-21531956 CCAGTAAAGTGTGCCTTTCTAGG + Intergenic
930090322 2:47527147-47527169 TAAGAAAAATGGAGCTTCCTTGG - Intronic
933045265 2:77527778-77527800 CCAGAGAAATGAAACTCCCTGGG + Intronic
933098142 2:78213908-78213930 GAAGAAAAATATACATTCCTTGG - Intergenic
933294389 2:80472689-80472711 CAAGAAAAATGGGCCTTCTTGGG - Intronic
935681721 2:105644105-105644127 ACAGAAAATTGTCCCTTTCTTGG - Intergenic
937556920 2:123169179-123169201 CCAGAAAAAAGTGCCCTCTTGGG - Intergenic
937631881 2:124110767-124110789 ACTGTAAAATGTACCTTCCAAGG + Intronic
938473462 2:131587268-131587290 CCATAAAAATGTACTGTGCTTGG - Intergenic
939062492 2:137439742-137439764 CCAAAAAACTGTACCTTTCACGG - Intronic
939359395 2:141149123-141149145 CAAGAGAAATGTAACTTGCTTGG + Intronic
940318554 2:152349988-152350010 CCATTAAAATGTAAATTCCTTGG - Intronic
944542131 2:200764257-200764279 AAAGAAAAATCTACCTCCCTAGG + Intergenic
1169657612 20:7942560-7942582 CCAGAAGAATGAACTTTCTTGGG - Intergenic
1169700705 20:8443585-8443607 CCAGAATAATGCAGCTTTCTGGG - Intronic
1173130136 20:40384650-40384672 CCATAGAATTGTACCATCCTAGG - Intergenic
1173937445 20:46879715-46879737 CTAGAACAATGCACCTCCCTCGG + Intergenic
1178602335 21:34005422-34005444 CCAAAAAAATGTTTCTTCTTTGG - Intergenic
1181854850 22:25774419-25774441 CTATAAAAATGTCCCTTCCAGGG - Intronic
1181996186 22:26884661-26884683 CCACTAAACTGTACATTCCTTGG - Intergenic
1183612724 22:38921431-38921453 CCAGAAAAATCTCCATTCCCTGG - Intergenic
949092296 3:42594-42616 CCAGATAGATGTAACTTTCTTGG - Intergenic
950470769 3:13184913-13184935 GCAGATAGATGGACCTTCCTTGG + Intergenic
951050404 3:18087124-18087146 TCAGAAAAATGTGCCATCCACGG - Intronic
951580142 3:24154070-24154092 TTAGAAAAATGTTCCTTCTTGGG + Intronic
952176929 3:30874223-30874245 CCTAAAAATTGTAGCTTCCTGGG + Intronic
953520331 3:43636294-43636316 CCAGAAAAATTAACCTCCCTTGG - Intronic
954901042 3:54020241-54020263 TCAGAAAATTGCACCCTCCTTGG - Intergenic
955075782 3:55611708-55611730 CCAGAGAAATGTGACTGCCTAGG + Intronic
957032557 3:75258532-75258554 CCAGATAGATGTAACTTTCTTGG - Intergenic
957100295 3:75818563-75818585 CCAGACAAATGTAAGTCCCTAGG + Intergenic
958012826 3:87902341-87902363 CCAGAAAAATTTAATTTCATTGG + Intergenic
958941096 3:100315460-100315482 CCATAAAAATGAATCTGCCTCGG - Intronic
960051212 3:113241141-113241163 CCAGTGACATCTACCTTCCTGGG - Intronic
960404004 3:117237878-117237900 CCACAAAAAAGCACCTTCATAGG + Intergenic
965706522 3:171513512-171513534 GCAGAAAAATCTAGCTTTCTAGG + Intergenic
966550847 3:181202390-181202412 TCTGAAAAATGTTCATTCCTAGG + Intergenic
972182758 4:36489121-36489143 CCAGATAAATATGCCTTCCCTGG + Intergenic
973209146 4:47596148-47596170 CCTGAAAAAGGTAATTTCCTGGG - Intronic
977079724 4:92509864-92509886 GCAGAAAAATGTGCATTCCAAGG + Intronic
979297750 4:119052446-119052468 CCATAAAAATGTCCCTCTCTGGG + Intronic
979379041 4:119986871-119986893 CCAGGAAAAAGAAACTTCCTGGG - Intergenic
979725108 4:123951876-123951898 CTTGGAAAATGTTCCTTCCTGGG + Intergenic
984201478 4:176726208-176726230 CCAGAAAAATGTACAGTTGTAGG - Intronic
984668339 4:182452354-182452376 CCAGTAAACTGTACCCTTCTGGG + Intronic
984756709 4:183331505-183331527 CCAGAACAGTGAGCCTTCCTGGG + Intergenic
985922530 5:2989824-2989846 CCAGAAACATGTAACTTCCTAGG + Intergenic
986370988 5:7079787-7079809 CCAGCAAAATTTACCTTTCTCGG + Intergenic
989193878 5:38696884-38696906 TCACAGAAATGTTCCTTCCTTGG + Intergenic
989311052 5:40018415-40018437 CCAGTAAAATTTGCCTTGCTAGG + Intergenic
990973891 5:61540554-61540576 ACAGGAAAATGTACCTACCATGG + Intronic
994681869 5:102898104-102898126 TCAGAAAAATGTACTTTTCTTGG + Intronic
997480220 5:134179017-134179039 CAAGAAAAATGCAGATTCCTGGG + Intronic
997727095 5:136131106-136131128 CCAGAAATATTTGCCTTCCAAGG + Intergenic
998966939 5:147551349-147551371 CCAGAAATAAGAACCTTCTTTGG - Intergenic
999394251 5:151216783-151216805 CAAGAAAAAGGTACCTCTCTTGG + Intronic
1000048558 5:157542072-157542094 CCAGAAAAGTGGACCTCCCAAGG - Intronic
1000254259 5:159522955-159522977 CCACAAGAATGTACCATACTTGG - Intergenic
1003372078 6:5538233-5538255 CCTGAAAATTATACCTACCTTGG + Intronic
1004165043 6:13249457-13249479 CCAGAAAAATGTAATCTTCTGGG - Intronic
1005515461 6:26550382-26550404 CCGCTAAAATGTACCTCCCTCGG + Intergenic
1005756017 6:28925495-28925517 CCAGAAAAATGTAGAGTACTTGG + Intergenic
1008352355 6:50506884-50506906 CCAGAAAAATCTCCCTTCCCTGG + Intergenic
1008694258 6:54015593-54015615 CAATAAACATGTTCCTTCCTTGG - Intronic
1009315552 6:62214672-62214694 AGAGAAAAATCTACCTTCCTAGG - Intronic
1011489847 6:87880005-87880027 CCAGGAAAGTGTCTCTTCCTAGG - Intergenic
1012305716 6:97654359-97654381 TCAGAAAAAAGTGCCTTCCATGG + Intergenic
1013510434 6:110839924-110839946 CCATAAAAATGTGCCTGCTTTGG + Intronic
1015465458 6:133543741-133543763 CAAGAAAATTGGACATTCCTTGG - Intergenic
1017830574 6:158124816-158124838 CCAGGAAAAGGTATCTTCCCTGG - Intronic
1019038156 6:169079522-169079544 TCAGAAAAAGGAACCTACCTGGG + Intergenic
1019168222 6:170113090-170113112 CCAGAAAATAGTAATTTCCTAGG - Intergenic
1019273649 7:164595-164617 GGAGAAAAATGTTCCTTCCATGG + Intergenic
1019759703 7:2801321-2801343 ACATAAAAATGAAACTTCCTAGG - Intronic
1020038118 7:4977943-4977965 TCAGAAAAAAGTACCTACATTGG - Intergenic
1020494286 7:8828507-8828529 CCATAAATATGTACATTTCTTGG + Intergenic
1022140728 7:27491389-27491411 CCAGAAAAATGTACTGTTCTTGG + Intergenic
1022484095 7:30764755-30764777 CCAGATAAATGTGCCTTCTCTGG - Intronic
1024160769 7:46672952-46672974 CCAGCAGAATGAAACTTCCTCGG - Intergenic
1025068430 7:55877778-55877800 AAATAAAAATGTACCTTTCTGGG - Intergenic
1026218992 7:68375133-68375155 ACAGAAAACTCAACCTTCCTGGG - Intergenic
1028852762 7:95554722-95554744 ACAGAAAAACGTCCCTTCGTGGG - Intergenic
1030123023 7:106129196-106129218 CCAGAAAAATGTCCCTTTTTTGG + Intergenic
1030409535 7:109158030-109158052 CCAGCAAAATATACCATCTTGGG + Intergenic
1031971836 7:128070234-128070256 CCAGAACCATGTGTCTTCCTAGG + Intronic
1036041730 8:5090941-5090963 ACTGAAAAATGTACCTTGCATGG - Intergenic
1036464725 8:8985995-8986017 CCATAATAATGTAGATTCCTGGG - Intergenic
1037502717 8:19500879-19500901 CCAGACAACTGAACCTGCCTGGG - Intronic
1040409163 8:47137388-47137410 CCACAAAAATGTACTGTGCTTGG + Intergenic
1041332393 8:56740888-56740910 CCTGAAAAATGTACCTAGCCAGG + Intergenic
1044215499 8:89604709-89604731 CCAGAAACATATACATTCTTTGG - Intergenic
1044823674 8:96176770-96176792 CCAGAAAAAGTATCCTTCCTTGG + Intergenic
1045167022 8:99617986-99618008 CCAGAAAAATGTACCCATCTTGG + Intronic
1045876045 8:106981633-106981655 CCAGAAGAATGATGCTTCCTGGG - Intergenic
1045931546 8:107633078-107633100 GCAGAAAAATGTGTCTTCCCTGG + Intergenic
1046375155 8:113368852-113368874 CCAGAAAACATTACCTTCATTGG - Intronic
1046485122 8:114877356-114877378 CCAGAAATTTGGACCTTCTTGGG - Intergenic
1055147587 9:72955339-72955361 CCATAAAAACGTACAATCCTGGG - Intronic
1056493766 9:87135256-87135278 CCTCAACAATGTACTTTCCTTGG - Intergenic
1056824000 9:89864299-89864321 CCCAACAAATCTACCTTCCTCGG - Intergenic
1185984818 X:4820421-4820443 CCTGAAAAACGTACTGTCCTAGG + Intergenic
1187583606 X:20635964-20635986 CCCATAAAATGTACCTTCCTTGG - Intergenic
1188201540 X:27298418-27298440 CCAAAAAAATGGGCCTTCCATGG + Intergenic
1188752839 X:33924626-33924648 CCAGGAATAAGTAACTTCCTGGG - Intergenic
1188982609 X:36740349-36740371 CCAGAAGAATTCTCCTTCCTAGG - Intergenic
1193764871 X:85515169-85515191 CCATAAAACTGTACATTCCCTGG + Intergenic
1194088703 X:89560068-89560090 CCAGAGAGATGCAACTTCCTGGG - Intergenic
1195486584 X:105414725-105414747 GCAGCAAAATGTACCTACATTGG - Intronic
1196592035 X:117496684-117496706 CCAGCTAAATGTAGCTCCCTTGG + Intergenic
1196933577 X:120706251-120706273 CCACAAAAATGTAAATACCTAGG + Intergenic
1199908323 X:152258883-152258905 ACACAAAAAAGTACCTTCATAGG + Intronic
1199981406 X:152922554-152922576 CCAAGAAAAAGTACCATCCTTGG + Intronic
1200441380 Y:3216121-3216143 CCAGAGAGATGCAACTTCCTGGG - Intergenic