ID: 904575119 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:31500426-31500448 |
| Sequence | CAGGGTGGCCGAGGTTTAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904575107_904575119 | 24 | Left | 904575107 | 1:31500379-31500401 | CCTAGGAAGGTACATTTTTCTGG | 0: 1 1: 0 2: 1 3: 19 4: 201 |
||
| Right | 904575119 | 1:31500426-31500448 | CAGGGTGGCCGAGGTTTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904575119 | Original CRISPR | CAGGGTGGCCGAGGTTTAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||