ID: 904575119

View in Genome Browser
Species Human (GRCh38)
Location 1:31500426-31500448
Sequence CAGGGTGGCCGAGGTTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904575107_904575119 24 Left 904575107 1:31500379-31500401 CCTAGGAAGGTACATTTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 904575119 1:31500426-31500448 CAGGGTGGCCGAGGTTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904575119 Original CRISPR CAGGGTGGCCGAGGTTTAGA GGG Intergenic
No off target data available for this crispr